ID: 905664278

View in Genome Browser
Species Human (GRCh38)
Location 1:39753173-39753195
Sequence CTGCTGCTGCCCAGGTTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905664267_905664278 17 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664278 1:39753173-39753195 CTGCTGCTGCCCAGGTTCCGGGG 0: 1
1: 0
2: 1
3: 27
4: 294
905664270_905664278 3 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664278 1:39753173-39753195 CTGCTGCTGCCCAGGTTCCGGGG 0: 1
1: 0
2: 1
3: 27
4: 294
905664274_905664278 -10 Left 905664274 1:39753160-39753182 CCAGCGGGAGGGGCTGCTGCTGC 0: 1
1: 0
2: 12
3: 81
4: 540
Right 905664278 1:39753173-39753195 CTGCTGCTGCCCAGGTTCCGGGG 0: 1
1: 0
2: 1
3: 27
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905664278 Original CRISPR CTGCTGCTGCCCAGGTTCCG GGG Intronic