ID: 905664281

View in Genome Browser
Species Human (GRCh38)
Location 1:39753182-39753204
Sequence CCCAGGTTCCGGGGTGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905664267_905664281 26 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664281 1:39753182-39753204 CCCAGGTTCCGGGGTGGAAGTGG 0: 1
1: 0
2: 0
3: 34
4: 357
905664270_905664281 12 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664281 1:39753182-39753204 CCCAGGTTCCGGGGTGGAAGTGG 0: 1
1: 0
2: 0
3: 34
4: 357
905664274_905664281 -1 Left 905664274 1:39753160-39753182 CCAGCGGGAGGGGCTGCTGCTGC 0: 1
1: 0
2: 12
3: 81
4: 540
Right 905664281 1:39753182-39753204 CCCAGGTTCCGGGGTGGAAGTGG 0: 1
1: 0
2: 0
3: 34
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905664281 Original CRISPR CCCAGGTTCCGGGGTGGAAG TGG Intronic