ID: 905664283

View in Genome Browser
Species Human (GRCh38)
Location 1:39753183-39753205
Sequence CCAGGTTCCGGGGTGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905664270_905664283 13 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664283 1:39753183-39753205 CCAGGTTCCGGGGTGGAAGTGGG 0: 1
1: 0
2: 1
3: 24
4: 289
905664274_905664283 0 Left 905664274 1:39753160-39753182 CCAGCGGGAGGGGCTGCTGCTGC 0: 1
1: 0
2: 12
3: 81
4: 540
Right 905664283 1:39753183-39753205 CCAGGTTCCGGGGTGGAAGTGGG 0: 1
1: 0
2: 1
3: 24
4: 289
905664267_905664283 27 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664283 1:39753183-39753205 CCAGGTTCCGGGGTGGAAGTGGG 0: 1
1: 0
2: 1
3: 24
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905664283 Original CRISPR CCAGGTTCCGGGGTGGAAGT GGG Intronic