ID: 905664929

View in Genome Browser
Species Human (GRCh38)
Location 1:39757651-39757673
Sequence GAGGGTTGGAAGGATGATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 875
Summary {0: 1, 1: 0, 2: 9, 3: 86, 4: 779}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905664929_905664939 25 Left 905664929 1:39757651-39757673 CCACCATCATCCTTCCAACCCTC 0: 1
1: 0
2: 9
3: 86
4: 779
Right 905664939 1:39757699-39757721 CATGCCCTGAGCAAAGAAAAGGG 0: 1
1: 0
2: 2
3: 21
4: 262
905664929_905664938 24 Left 905664929 1:39757651-39757673 CCACCATCATCCTTCCAACCCTC 0: 1
1: 0
2: 9
3: 86
4: 779
Right 905664938 1:39757698-39757720 CCATGCCCTGAGCAAAGAAAAGG 0: 1
1: 1
2: 2
3: 23
4: 270
905664929_905664936 1 Left 905664929 1:39757651-39757673 CCACCATCATCCTTCCAACCCTC 0: 1
1: 0
2: 9
3: 86
4: 779
Right 905664936 1:39757675-39757697 TCTGGTGCAACGAGATAAACAGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905664929 Original CRISPR GAGGGTTGGAAGGATGATGG TGG (reversed) Exonic
900312330 1:2039902-2039924 GAGAGTTGGAAGGAGGAGGCAGG + Intergenic
900745579 1:4358459-4358481 GAGGGTTGGAATCATGACGCAGG + Intergenic
900930958 1:5737210-5737232 GATGGATGGATGGATGATAGAGG + Intergenic
900993133 1:6106987-6107009 GAAGGATGGAGGGATGATGGAGG + Intronic
900993150 1:6107058-6107080 GAGCGATGGAAGGATGATGGAGG + Intronic
900993168 1:6107117-6107139 GAGGGATGGAGGGATAATGTAGG + Intronic
900993179 1:6107158-6107180 GAGGGATGGAGGGAAGGTGGAGG + Intronic
900993192 1:6107195-6107217 GAGGGATGGAGGGATGATGGAGG + Intronic
900993198 1:6107214-6107236 GAGGGATGGAGGGATGATGGAGG + Intronic
900993203 1:6107233-6107255 GAGGGATGGAGGGATAATGAAGG + Intronic
900993210 1:6107263-6107285 GAGAGATGGAGGGATGATGGTGG + Intronic
900993227 1:6107339-6107361 GAGGGATGGAGGGATAATGAAGG + Intronic
900993233 1:6107369-6107391 GAGAGATGGAGGGATGATGGAGG + Intronic
900993246 1:6107412-6107434 GAGGGATGGAGGGATGATGGAGG + Intronic
900993259 1:6107461-6107483 GAGGGATGGAGGGATGATGAAGG + Intronic
900993277 1:6107534-6107556 GAGGGATGGAGGGATAATGAAGG + Intronic
900993312 1:6107705-6107727 GAGAGATGGAGGGATGATGGAGG + Intronic
900993322 1:6107749-6107771 GAGAGATGGAGGGATGATGGAGG + Intronic
900993338 1:6107817-6107839 GAGGGATGGAGGGATGATGAAGG + Intronic
900993347 1:6107854-6107876 GAGGGATGGAGGGATGATGGAGG + Intronic
900993366 1:6107923-6107945 GAAGGATGGAAGGAAGGTGGAGG + Intronic
900993414 1:6108077-6108099 GAGAGATGGAGGGATGATGGAGG + Intronic
900993423 1:6108115-6108137 GAGGCATAGAGGGATGATGGAGG + Intronic
900993428 1:6108134-6108156 GAGGGATGGAGGAATGATGGAGG + Intronic
900993436 1:6108161-6108183 GAAAGATGGAGGGATGATGGAGG + Intronic
900993509 1:6108474-6108496 GGAGAATGGAAGGATGATGGAGG + Intronic
900993562 1:6108699-6108721 GAGGAATGGAGGGATGATGAAGG + Intronic
900993577 1:6108761-6108783 GAGGCATGGAAGAATTATGGAGG + Intronic
900993609 1:6108874-6108896 GAGGCATGGAGGGATGATGGAGG + Intronic
901033882 1:6324681-6324703 GAGGGTTGGATGGAACATGGGGG - Intronic
901055304 1:6446383-6446405 GAGGGCTGGAAGGAGGGTGGGGG + Intronic
901751370 1:11412176-11412198 GAGGGTGGAAAGGATGGTGGGGG - Intergenic
902635679 1:17733640-17733662 GAGGGTTAGAGGGATGGAGGAGG - Intergenic
902777823 1:18685881-18685903 GATGGATGGAAGGTTGCTGGGGG - Intronic
902870780 1:19312420-19312442 GAGGGCTGGAAGGATGTGGCAGG - Exonic
903067352 1:20708050-20708072 GAGGATTTGAAGGATGAGGCAGG - Intronic
904232028 1:29082582-29082604 TAGGGGTGGAGGGATGAAGGTGG - Intronic
904601336 1:31674216-31674238 GAGGGTGGCCAGGATGAGGGGGG + Intronic
904901916 1:33864477-33864499 AAGAGTAGGAAGGATGATGGAGG - Exonic
905064510 1:35168779-35168801 GAGGGTGAGAAGGAAGATTGGGG + Intergenic
905420980 1:37843867-37843889 GGGGGTTGGATGGATGGGGGAGG - Intronic
905595758 1:39205180-39205202 GAGGGTGGGGTGAATGATGGAGG + Intronic
905664929 1:39757651-39757673 GAGGGTTGGAAGGATGATGGTGG - Exonic
905803774 1:40861901-40861923 AAGGGCTGGAAGGAGGACGGCGG + Exonic
905921209 1:41720121-41720143 GAGGGTGGGGAGGATGTTTGAGG - Intronic
906264570 1:44418255-44418277 GAGGGATGGGAGGAGGTTGGGGG + Intronic
906668584 1:47638757-47638779 GAGGGTGGGAAGTGTGAGGGTGG + Intergenic
906972442 1:50530486-50530508 GAGGTTGGGAAGGGTGGTGGGGG + Intronic
907835722 1:58106835-58106857 GAGGGAGGGAGGGATGAAGGAGG - Intronic
908656837 1:66397106-66397128 GAGGGTTAGAAGGTTAATGGAGG + Intergenic
909263563 1:73527029-73527051 GGGAGTTGGAAGGGAGATGGTGG - Intergenic
909608558 1:77530991-77531013 GAGGGGTGCAAGGATGAGTGTGG + Intronic
911122420 1:94309663-94309685 GAGGGAGGGATGGATGATGCAGG + Intergenic
911283579 1:95961269-95961291 GAGGCTGGGAAGGATACTGGAGG - Intergenic
911326551 1:96475320-96475342 GAGGGTGGGAAGGAAAATTGTGG - Intergenic
912628091 1:111222908-111222930 AAAGGTTGGAAGGATGAGTGGGG - Intronic
913552409 1:119928411-119928433 TAGGGGTGGAAAGATCATGGTGG + Intronic
915361413 1:155288269-155288291 GAGGGTTGGGAGGCTGAGAGTGG - Exonic
917896425 1:179492644-179492666 GAGGGATGGAAGGGAGAAGGAGG + Intronic
918055186 1:181015202-181015224 TAGGGTTGGAAGTATAGTGGGGG - Intronic
918208534 1:182330633-182330655 TAGGGTTGGGAGGATCTTGGAGG - Intergenic
918294561 1:183144136-183144158 GTGGGTTGGTAGGAGGAAGGGGG - Exonic
918339135 1:183552865-183552887 GAGGGTGGGAAGTAGAATGGGGG - Intronic
918345480 1:183603890-183603912 GAATGGTGGAAGGAAGATGGGGG + Intergenic
918410576 1:184254158-184254180 GAGGGTTTTTAGGATGTTGGTGG - Intergenic
918857755 1:189780669-189780691 GAGGGATGGAGGGAAGAAGGAGG + Intergenic
919088013 1:192944726-192944748 GAAGGTTGGAAGGGAGGTGGGGG - Intergenic
919106656 1:193161062-193161084 GAGGTTTGGTAGGATGGGGGAGG - Intronic
919935155 1:202246159-202246181 GAGGGATGGAGGGATGGGGGAGG - Intronic
919935201 1:202246280-202246302 GAGGGATGGAGGGATGGGGGAGG - Intronic
920647771 1:207815873-207815895 GTGGGAAGGAAGGAGGATGGGGG + Intergenic
920700567 1:208215386-208215408 GATGGGTAGATGGATGATGGTGG + Intronic
921176369 1:212598607-212598629 GAGGCTGGGAAGGGTAATGGGGG - Intronic
921657749 1:217760895-217760917 GAAGGTTTGTAGGAGGATGGTGG + Intronic
922000350 1:221471267-221471289 GAGGATGGGGAGGGTGATGGTGG - Intergenic
922277782 1:224095312-224095334 GAGGGTGGGAAGGAAAATGAAGG - Intergenic
922707145 1:227795643-227795665 GAGGGAAGGAAGGAGGTTGGGGG - Intergenic
922766001 1:228157084-228157106 GGGGGCTGGAGGGAGGATGGAGG + Intronic
922963155 1:229665246-229665268 GGAGGTTTGAAGGAAGATGGAGG - Intergenic
923534805 1:234840947-234840969 GTGGGTTGGAAGTGTGGTGGGGG - Intergenic
923563968 1:235062868-235062890 GAGGGTCTGTAGGAGGATGGGGG - Intergenic
924536114 1:244937185-244937207 GAGGGATGGAGGGATTGTGGGGG + Intergenic
1063401627 10:5751997-5752019 TGGGGTTGGGAGGAGGATGGGGG - Intronic
1064587341 10:16852069-16852091 GAGGGAGGGAAAGATGATGGAGG - Intronic
1065323096 10:24526849-24526871 GAGGGTTAGAATGGTGAAGGTGG + Intronic
1066130854 10:32392296-32392318 GAGGCTGGGAAGGATAGTGGAGG - Intergenic
1066163557 10:32760594-32760616 GTGGGGTGGGAGGATGAGGGAGG + Intronic
1066566671 10:36728563-36728585 GAGGGAAGGAAGGCTGATTGGGG + Intergenic
1067553731 10:47253518-47253540 CAGGGTTGGAGGGATGAAGCAGG + Intergenic
1067667261 10:48289038-48289060 GAGGGTGGGAAGGAGCAAGGAGG - Intergenic
1068283187 10:54903131-54903153 GACGGTTGGAGGTATGAAGGAGG + Intronic
1068611777 10:59068273-59068295 GAGGATGGGAAGGTTGATGAGGG - Intergenic
1068747305 10:60547634-60547656 GAGGGTGGGGAGGGTGGTGGTGG + Intronic
1068750973 10:60591919-60591941 CAGACTTGGAAGGATAATGGAGG + Intronic
1069678891 10:70269755-70269777 GAGGGTTGGGAGGCTGAGGCAGG - Intronic
1069723302 10:70562790-70562812 GAGGGGTGGAAGGAGCAGGGTGG + Intronic
1069823923 10:71243717-71243739 GTGGGCTGGAAGGAACATGGAGG + Intronic
1070050730 10:72887106-72887128 CAGGATGGAAAGGATGATGGGGG + Exonic
1070279574 10:75038693-75038715 AAGAGTTGGAAGGGAGATGGAGG + Intronic
1070792636 10:79198534-79198556 GATGGTTGGCAGGGTGAGGGTGG + Intronic
1071106302 10:82099870-82099892 GATGCTTGGAAGTTTGATGGGGG + Intronic
1071221345 10:83468778-83468800 GAGGCTGGGAAGGGTAATGGGGG + Intergenic
1071245716 10:83760734-83760756 GATGGTTGGTAGTGTGATGGTGG - Intergenic
1071294797 10:84211754-84211776 GGGGATTGGAAGGCTGAGGGTGG + Intronic
1071368303 10:84923985-84924007 GAGGTTTGGAAAGATAATGGTGG + Intergenic
1071406293 10:85336224-85336246 GAGGCTGGGAAGGATACTGGGGG + Intergenic
1072720451 10:97777747-97777769 GGGGCTTGGGATGATGATGGAGG + Intergenic
1072878208 10:99197214-99197236 GAGGCTGGGAAGGGTCATGGGGG + Intronic
1072976214 10:100061077-100061099 GAGGCTGGGAAGGATGGTGGGGG + Intronic
1073008694 10:100343543-100343565 AGGGCTTGGAAGGAGGATGGAGG - Intergenic
1073093278 10:100963157-100963179 GTGGGGGGGAAAGATGATGGAGG + Intronic
1073467380 10:103702054-103702076 GATAGATGGATGGATGATGGTGG - Intronic
1074115300 10:110453393-110453415 GAGGTTGGGAAGGATAGTGGGGG + Intergenic
1074435723 10:113432530-113432552 GAGAGCTGGAAGGATGAGGAAGG + Intergenic
1074728940 10:116347831-116347853 GAGGGAGGGAAGAATGGTGGAGG - Intronic
1075934632 10:126328951-126328973 GAGGGTAGGAAGGAGGAAGCTGG + Intronic
1075936110 10:126342899-126342921 GAGGGCTGGAGGGAGGGTGGAGG + Intronic
1076077317 10:127544852-127544874 GAGAGTTGGAAGGATGGAGGGGG - Intergenic
1077497352 11:2892609-2892631 GAGGGAAGGAAGGAGGAGGGAGG - Intronic
1077904631 11:6520311-6520333 GGGGGTAGGAAGGCTGAAGGAGG + Intronic
1078127310 11:8580463-8580485 GAGGCTGGGAAGGAGAATGGAGG + Intronic
1078584683 11:12572842-12572864 GAGGCTTGGAATGGTGATGGTGG + Intergenic
1079045693 11:17100669-17100691 GAGGGTAGGAAGGGGGATGGTGG - Intronic
1079252900 11:18800412-18800434 GAGACTTGGAAGGGTGAAGGGGG + Intergenic
1079415537 11:20232406-20232428 GAGGTTGGGAAGGGTAATGGGGG + Intergenic
1081075372 11:38667043-38667065 GAGGCATGGAAGAAAGATGGGGG + Intergenic
1081616029 11:44591715-44591737 GCTGGTTGTGAGGATGATGGGGG + Intronic
1081722015 11:45296725-45296747 GAGGCTTGGAAGGGTAGTGGGGG - Intergenic
1082131483 11:48495120-48495142 GAAGGAAGGAAGGAAGATGGAGG - Intergenic
1082739005 11:56889851-56889873 GAGGGTGGGAAGGGTAGTGGGGG - Intergenic
1082786193 11:57318355-57318377 GAGGGAGAGAAGGAAGATGGCGG + Intronic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1083729142 11:64643534-64643556 GAGGGCTGGAAGGGAGAGGGAGG + Intronic
1083931816 11:65850372-65850394 GGGGGCAGGCAGGATGATGGGGG + Intronic
1083985815 11:66214554-66214576 GAAGGAAGGAAGGAAGATGGAGG - Intronic
1084313952 11:68332797-68332819 GACGGATGGAGGGATGTTGGGGG + Intronic
1084366545 11:68705005-68705027 GGGGGTTGGGAGCAGGATGGAGG + Intergenic
1084479464 11:69410383-69410405 GGGGGTGGGAGGGCTGATGGCGG - Intergenic
1084596315 11:70118973-70118995 GATGGATGGATGGATGCTGGAGG + Intronic
1084596374 11:70119240-70119262 GATGGGTTGATGGATGATGGGGG + Intronic
1084597946 11:70128432-70128454 GAAGGAAGGAAGGAAGATGGAGG - Intronic
1084949728 11:72657970-72657992 GAGGGGTGGAGGGAAGAGGGAGG + Intronic
1085224051 11:74902762-74902784 GAGGCTGGGAAGGATAGTGGGGG + Intronic
1085406835 11:76268537-76268559 GATGGATGGATGGATGGTGGAGG - Intergenic
1085424790 11:76394336-76394358 GAGGCTGGGAAGGATAGTGGAGG - Intronic
1085884084 11:80501579-80501601 GAGGGTAGTGAGGATGATGACGG + Intergenic
1085895907 11:80639121-80639143 GGGAGTTGGAAGCATGGTGGTGG - Intergenic
1086260916 11:84939542-84939564 GATGGTGGGAAGGGTGATGGTGG - Intronic
1086571639 11:88291523-88291545 GAGGGAGGGAAGGAGGAAGGAGG + Intergenic
1087096139 11:94320101-94320123 GTGGGTTGGAGGGATGGGGGAGG + Intergenic
1087957919 11:104312713-104312735 GAGAGTTTGAATGATGATGCAGG - Intergenic
1088136774 11:106564988-106565010 AAGGGTTGTAAGCATGATGGTGG - Intergenic
1088182377 11:107127304-107127326 CAGGGGTGGAGGGATGTTGGGGG - Intergenic
1088878685 11:113957068-113957090 CAGGGATGGAAGAACGATGGAGG + Intergenic
1088953466 11:114594017-114594039 GAGGCTGGGAAGGGTGGTGGGGG + Intronic
1089541986 11:119194825-119194847 GAGAGTTGGAGGTATGGTGGGGG - Intronic
1089641607 11:119851363-119851385 GAGGGAAGGAAGAATGAAGGTGG - Intergenic
1089696374 11:120218646-120218668 GAGGGTTGGAAGAATGGGAGGGG + Intronic
1090316363 11:125792496-125792518 GAGGTTTGGAATGATAGTGGGGG - Intergenic
1090691459 11:129187360-129187382 GAGGCTGGGAAGGGTGGTGGGGG + Intronic
1091661798 12:2389800-2389822 GAGGGTTGGAAGAACGAGGGTGG - Intronic
1091755882 12:3051206-3051228 GAGGGATGGAGGGAGGAAGGAGG - Intergenic
1091874590 12:3923680-3923702 GAGGGAGGGAAGGAGGAAGGAGG - Intergenic
1092246453 12:6866966-6866988 GAGGGTTGGGATGATCCTGGCGG + Intergenic
1092313924 12:7389506-7389528 GAGGCTGGGAAGGGTAATGGGGG + Intronic
1092799571 12:12150944-12150966 GTGGATGGGAAGGATGATGTCGG + Exonic
1093046856 12:14456554-14456576 GTGGGTTGGGTGGATGCTGGGGG - Exonic
1093350600 12:18095407-18095429 GAAGGAAGGAAGGAAGATGGGGG + Intronic
1093363201 12:18257734-18257756 GAGGGAAGGAAGGAAGAAGGAGG + Intronic
1094057333 12:26280596-26280618 GAGACTTGGAAGGATAAGGGAGG + Intronic
1094156974 12:27347463-27347485 GAGGGCTGGAGATATGATGGTGG - Intronic
1094380031 12:29832520-29832542 GAGGCTGGGAAGGGTGGTGGGGG - Intergenic
1094773597 12:33695220-33695242 GAGGCTGGGAAGGATAGTGGGGG - Intergenic
1095496810 12:42793835-42793857 GAGGGACGGAAGGATAAAGGAGG - Intergenic
1095697697 12:45159252-45159274 GAGGGGTGGGGGGATGATGGGGG + Intergenic
1096025101 12:48353529-48353551 GAGGCTGGGAAGGGTAATGGGGG - Intergenic
1097834116 12:64256574-64256596 GAGGGTGGGACGGAAGAAGGAGG - Intergenic
1098067967 12:66640087-66640109 GCTGGTTGGAAGGTTGGTGGAGG - Intronic
1098216384 12:68224666-68224688 GAGGGAGGGAAGGAGGGTGGAGG + Intronic
1098376654 12:69822514-69822536 GAGGCTGGGAAGGGTAATGGGGG + Exonic
1099293733 12:80804367-80804389 GAGGCTGGGAAGGATAGTGGAGG - Intronic
1099657984 12:85520098-85520120 GAGGGTGGGAAGGATAGTGAGGG + Intergenic
1099763679 12:86954362-86954384 GAGGCTGGGAAGGGTGAGGGTGG - Intergenic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1101219774 12:102626367-102626389 GAAGGTGGGAAGGATAAAGGGGG + Intergenic
1101248871 12:102911701-102911723 GTGGGTGGGGAGGAAGATGGGGG - Intronic
1101630109 12:106484932-106484954 GAGTGACAGAAGGATGATGGGGG + Intronic
1101668977 12:106848957-106848979 GAGGCTGGGAAGGATAATGGGGG + Intronic
1101746290 12:107544203-107544225 CAGGATGGGGAGGATGATGGGGG + Intronic
1102451489 12:113045040-113045062 GAGGGAGGGAAGGATGGAGGGGG + Intergenic
1102663506 12:114549775-114549797 GAGGGTGAGAAGGATGAAGATGG + Intergenic
1102856089 12:116295407-116295429 GAGAGATGGATGGATGATGGAGG + Intergenic
1103004351 12:117409359-117409381 GAGGGGTGGAAGGTGGATGGAGG + Intronic
1103012758 12:117469907-117469929 GATGGATGAATGGATGATGGAGG - Intronic
1103199540 12:119075943-119075965 GATGGTGGTAATGATGATGGTGG + Intronic
1103241914 12:119420558-119420580 GAGGCTGGGAAGGATAGTGGGGG + Intronic
1103248665 12:119480830-119480852 GATGGTGGTGAGGATGATGGTGG - Intronic
1103517042 12:121514775-121514797 GAGGGTGGGGAGTGTGATGGGGG - Intronic
1103934396 12:124467688-124467710 GAGGGTGATAAGGATGATGGAGG - Intronic
1103934535 12:124468262-124468284 GAGGGTGATGAGGATGATGGGGG - Intronic
1103934648 12:124468729-124468751 GAGGGTGATGAGGATGATGGGGG - Intronic
1104067389 12:125317020-125317042 GAGGGCTGGAAGCAGAATGGGGG + Intronic
1104690158 12:130819304-130819326 GAGGGTGGGAGGGAGGAAGGGGG - Intronic
1105214264 13:18275069-18275091 GCAGCTTGGAAGGATGATTGTGG - Intergenic
1105258359 13:18760239-18760261 GGGGGTTGGAAGGTGGATGTGGG - Intergenic
1105261022 13:18779539-18779561 GGGGGTTGGAAGGTGGATGTGGG - Intergenic
1105263380 13:18796412-18796434 GAGGGTTGGGGGGATTGTGGTGG - Intergenic
1105273888 13:18903791-18903813 GAGGGTGGCAAGGAGGAGGGGGG - Intergenic
1105354653 13:19648189-19648211 GAGGGTTGGAAAACTGATGTTGG + Intronic
1105537799 13:21285883-21285905 GAGGTTGGGAAGGGTAATGGGGG + Intergenic
1105806734 13:23955810-23955832 GAGGGTGGCAAGGAGGAGGGGGG + Intergenic
1106217450 13:27715831-27715853 GGGAGTTGGAAGGAAGATGGAGG + Intergenic
1106689066 13:32094510-32094532 GAGGCTGGGAAGGATAGTGGGGG - Intronic
1107445628 13:40468047-40468069 TGGGGGTGGTAGGATGATGGAGG - Intergenic
1107917641 13:45168900-45168922 GAGGGAAGGAAGGAGGAGGGAGG - Intronic
1107999998 13:45897199-45897221 GAGGGAGGGAAGGAGGAGGGAGG - Intergenic
1108082470 13:46750917-46750939 GAGTGTGGAAAGGATGAAGGAGG - Intronic
1108232076 13:48355912-48355934 GAGGCTGGGAAGGGTGGTGGAGG + Intronic
1108461931 13:50675605-50675627 GAGGCTTGGAAGGATGGAGTAGG - Intronic
1109053517 13:57515511-57515533 GAGGGTTGGAAGGGTAAAGTGGG - Intergenic
1109493931 13:63143157-63143179 GAGGGTGGGAGGGAGGAGGGAGG + Intergenic
1109890207 13:68601976-68601998 TAGGGCTGGAAGAATCATGGGGG + Intergenic
1111391444 13:87600671-87600693 GAGTTTTGGAAGGGTGAGGGGGG + Intergenic
1111412153 13:87891286-87891308 GAGGGCTGTGATGATGATGGAGG - Intergenic
1111653055 13:91116786-91116808 GAGGGTGGGAAAGATGTTTGGGG - Intergenic
1113336618 13:109383192-109383214 GAGGATTGGGTAGATGATGGTGG + Intergenic
1113336629 13:109383242-109383264 GAGGATTGGGTAGATGATGGTGG + Intergenic
1113336640 13:109383292-109383314 GAGGATTGGGTAGATGATGGTGG + Intergenic
1113336651 13:109383342-109383364 GAGGATTGGGTAGATGATGGTGG + Intergenic
1113336662 13:109383392-109383414 GAGGATTGGGTAGATGATGGTGG + Intergenic
1113336673 13:109383442-109383464 GAGGATTGGGTAGATGATGGTGG + Intergenic
1113336695 13:109383539-109383561 GAGGATTGGGTAGATGATGGTGG + Intergenic
1113336706 13:109383589-109383611 GAGGATTGGGTAGATGATGGTGG + Intergenic
1113336717 13:109383639-109383661 GAGGATTGGGTAGATGATGGTGG + Intergenic
1113584533 13:111455798-111455820 GAGAGAGGGAAGGATGATGAAGG + Intergenic
1113780181 13:112972316-112972338 GATGGATGGATGGATGATGATGG + Intronic
1113780215 13:112972477-112972499 GATGGATGGATGGATGATGATGG + Intronic
1114237454 14:20835197-20835219 GAGGGTTTGAAGGGGGAAGGGGG + Intergenic
1114667086 14:24384617-24384639 GAGGGGTGTTAGGATGGTGGTGG + Intergenic
1115309346 14:31963928-31963950 GAGGGTGGGGAGGAAGAGGGAGG - Intergenic
1115656930 14:35452201-35452223 GAGGCTGGGAAGGGTCATGGGGG - Intergenic
1116109513 14:40559612-40559634 GAAGGTTGGAAGGGAGATGAGGG - Intergenic
1116116464 14:40658022-40658044 GAAGCTGGGAAGGATGCTGGAGG - Intergenic
1116946217 14:50837579-50837601 GTGGGTGGGATGGAGGATGGAGG - Intergenic
1117090713 14:52247360-52247382 GAAGGATGGAAGAGTGATGGAGG + Intergenic
1117164572 14:53020586-53020608 GGGGGTGGGAAGGGGGATGGGGG + Intergenic
1117207450 14:53458752-53458774 GAGGGTTGGAGGAATGAAAGTGG + Intergenic
1117877673 14:60272380-60272402 GAGTGTTGGGGGGATGAGGGTGG + Intronic
1117971048 14:61251347-61251369 GAGGGTGGGAAGGGTAGTGGAGG - Intronic
1118556425 14:67028029-67028051 GAGGCTGGGAAGGATGGTGTGGG - Intronic
1118744398 14:68763311-68763333 GAGGGAGGGAAGGATGGAGGAGG - Intergenic
1118916339 14:70110336-70110358 GAGGCTGGGAAGGGTGGTGGGGG - Intronic
1118941828 14:70346107-70346129 GAGGGTTTGAAGGGGGAAGGAGG - Intronic
1119038537 14:71251417-71251439 GAGGCTGGGAAGGGTGGTGGGGG + Intergenic
1119780600 14:77274473-77274495 GAGTGTTGGACAGAGGATGGGGG - Intergenic
1120997556 14:90428077-90428099 GGGGGCTGGAAGGAAGGTGGAGG - Intergenic
1121320479 14:92988947-92988969 GAGGGTTGGAGGGGTGGCGGTGG + Intronic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1121586641 14:95067513-95067535 AAGGGTGGGAAGGTTGATGCTGG + Intergenic
1122095102 14:99364708-99364730 GAGGGTGAGGATGATGATGGTGG - Intergenic
1122149101 14:99714991-99715013 GAGGCTGGGAAGGATGAGTGGGG + Intronic
1122150634 14:99724352-99724374 GAGGCTTGGATGGATGCTGGAGG - Intronic
1122292642 14:100687866-100687888 GAGGGATGGAGAGATGATGACGG - Intergenic
1122292647 14:100687894-100687916 GAGGGATGGAGAGATGATGACGG - Intergenic
1122292652 14:100687922-100687944 GAGGGGTGGAGAGATGATGACGG - Intergenic
1122292658 14:100687950-100687972 GAGGGATGGAGAGATGATGACGG - Intergenic
1122292663 14:100687978-100688000 GAGGGATGGAGAGATGATGACGG - Intergenic
1122663775 14:103315263-103315285 TATGGTTCGAAGGATGCTGGTGG - Intergenic
1122958314 14:105083069-105083091 GGTGGATGGATGGATGATGGAGG - Intergenic
1122958336 14:105083150-105083172 GGTGGATGGATGGATGATGGAGG - Intergenic
1122958361 14:105083239-105083261 GATGGGTGGATGGAGGATGGAGG - Intergenic
1122958401 14:105083394-105083416 GACGGGTGGATGGAGGATGGAGG - Intergenic
1122958512 14:105083784-105083806 GATGGGTGGAGGGAGGATGGAGG - Intergenic
1202835028 14_GL000009v2_random:71564-71586 GGGGGTTGGAAGGGGGATGTGGG + Intergenic
1123389223 15:19852745-19852767 GAGGGAAGGAAGGCTGATTGGGG + Intergenic
1124126954 15:26945035-26945057 GAGGGTTGGAGGGAGGAGAGAGG + Intronic
1124400497 15:29343703-29343725 GTGTGTGGGAAGGATGAGGGAGG + Intronic
1124858670 15:33415854-33415876 GAGGGAGGGAGGGATGAAGGTGG - Intronic
1124916299 15:33978022-33978044 GAGGGATGGAAGGATGGAGGAGG + Intronic
1124964482 15:34423139-34423161 GAAGGTTCGAAGTGTGATGGAGG - Intronic
1125537897 15:40453083-40453105 TCGGGTTGGAAGGATGGGGGAGG + Intronic
1125883561 15:43212605-43212627 GAGGGTTGGAAGGAGCAGCGGGG + Intronic
1127155315 15:56118340-56118362 GAGGCTTGGAAGGGTAGTGGGGG - Intronic
1127660743 15:61098089-61098111 GAGGGAGGGAAGGAGGAAGGAGG - Intronic
1127717307 15:61661718-61661740 CAGGTTTGGAAGGATGCTGGAGG - Intergenic
1127788536 15:62377920-62377942 GAAAGTTGGCAGGAGGATGGGGG - Intergenic
1127893272 15:63273358-63273380 GAGGGTTGGAATCATGAAGTGGG - Intergenic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1130044897 15:80436014-80436036 GCGGGGGGGAAGGATGAAGGAGG - Intronic
1130282549 15:82531238-82531260 GAGGGTGGGAGGGATGGCGGGGG + Intergenic
1130927147 15:88394189-88394211 GAGGGGAGGAGGGATGTTGGGGG + Intergenic
1131793343 15:95988418-95988440 GAGGGAGGGAAGGAAGAGGGAGG + Intergenic
1132030882 15:98437850-98437872 GATGGATGGATGGAAGATGGAGG + Exonic
1132989935 16:2787271-2787293 GAGGGGGTGAAGGATGAGGGAGG - Intronic
1133384608 16:5358958-5358980 GAGGCTAGGAAGGGTAATGGAGG - Intergenic
1133435123 16:5772611-5772633 GTGAGTTGAAAGGATGGTGGCGG + Intergenic
1134053844 16:11156829-11156851 GAGGGTTGGATGGCACATGGGGG - Intronic
1134224766 16:12381530-12381552 GATAGGTGGATGGATGATGGGGG - Intronic
1134291747 16:12907162-12907184 GAAGGGTGGAAGGGGGATGGAGG - Intronic
1134618919 16:15672950-15672972 CAGCGTTGGAAGGATGAGGAGGG - Intronic
1134649579 16:15898140-15898162 GAGGGCTGGGAGGAGGAAGGAGG - Intergenic
1135107750 16:19665327-19665349 GAGGCTGGGAAGGGTAATGGTGG - Intronic
1135693544 16:24565818-24565840 GAGCTTTGGGAGGCTGATGGGGG + Intronic
1135728037 16:24872286-24872308 GAGGGATGGCGGGATGAGGGAGG - Intronic
1136071421 16:27789844-27789866 GATGGATGGATGGATGATGAAGG + Exonic
1136096813 16:27962862-27962884 GACTGTGGGAGGGATGATGGGGG - Intronic
1136174354 16:28506983-28507005 GGGGGTGGGAGGTATGATGGGGG + Intronic
1136618141 16:31410910-31410932 GAGGGTGGGGAGGATGAGGGTGG + Intronic
1137617456 16:49856148-49856170 GGGGGTTGGGAGGAGGAGGGGGG - Intronic
1137738680 16:50743080-50743102 GAAGGTGGCAGGGATGATGGGGG - Intronic
1138110770 16:54321983-54322005 AGGGGCTGGAAGGAGGATGGTGG + Intergenic
1138590814 16:57998797-57998819 AAGGGTTGGCAGGAAGCTGGAGG - Intronic
1138647657 16:58436877-58436899 GAGGGATGGATGGAAGAGGGAGG - Intergenic
1139659570 16:68411510-68411532 GAGGGATGGGAGGGTGATGGAGG + Intronic
1140604735 16:76522139-76522161 GAGGGTTGAAAGGAACATGAAGG + Exonic
1141028557 16:80569477-80569499 CAGGGATGGAGGGATGATGCTGG + Intergenic
1141248044 16:82329186-82329208 GAGCGTTGGGAAAATGATGGTGG - Intergenic
1141421534 16:83921000-83921022 GATGGGTGGATGGATGGTGGAGG + Exonic
1141421594 16:83921267-83921289 GATGTTTGGATGGATGGTGGAGG + Exonic
1141477750 16:84284950-84284972 GAGGATAGGAAGGATGAGGCAGG - Intergenic
1141901508 16:86994031-86994053 GTGGATTAGAAGGATGGTGGGGG + Intergenic
1142087652 16:88192657-88192679 GATGGTGGTAATGATGATGGTGG + Intergenic
1142128794 16:88422930-88422952 GATGGGTGGATGGATGATGATGG + Intergenic
1142276528 16:89121839-89121861 GAGGGTTGGAGCGATGGTCGTGG + Intronic
1142654974 17:1385643-1385665 GAGGGAAGGAAGGAAGACGGAGG + Intronic
1142909561 17:3076457-3076479 GAGGCTGGGAAGGATAGTGGTGG - Intergenic
1142924937 17:3227357-3227379 GAGGCTGGGAAGGATAGTGGTGG + Intergenic
1143152310 17:4815242-4815264 GATGGATGGATGGATGATGAAGG + Intronic
1143743956 17:8975960-8975982 GAGGCTTTGAAGGAAGCTGGAGG + Intergenic
1144077301 17:11730905-11730927 GATGGTGGTAATGATGATGGTGG + Intronic
1144077314 17:11730998-11731020 GATGGTGGTAATGATGATGGTGG + Intronic
1144374802 17:14628287-14628309 AAGGGAAGGAAGGATGGTGGCGG + Intergenic
1145061810 17:19738571-19738593 GAGGGAAGGATGGGTGATGGTGG - Intronic
1145260593 17:21352304-21352326 GCAGGATGGCAGGATGATGGAGG - Intergenic
1146524227 17:33552324-33552346 GATGGTTGGATGGCTGCTGGAGG + Intronic
1147578170 17:41614283-41614305 GAGGACTGGAGGGAGGATGGAGG + Intronic
1147671203 17:42177904-42177926 TAGGGATAGAAGGATGTTGGGGG + Intronic
1148558721 17:48593816-48593838 GGGGGTTGGAAGGGGGGTGGGGG + Exonic
1148740514 17:49890033-49890055 AGGGGTTGGAGGGCTGATGGAGG + Intergenic
1148746632 17:49921953-49921975 GATGGATGGATGGATGATGATGG - Intergenic
1149999215 17:61422466-61422488 GAGGGAGGGAAGAAGGATGGAGG + Intergenic
1150547656 17:66177714-66177736 GAGGGTGGGAAGGATGGGTGGGG - Intronic
1150645711 17:66976386-66976408 GAGGGATGGAAAGAAGTTGGAGG - Intronic
1151215083 17:72571709-72571731 GTGGGGAGGGAGGATGATGGAGG - Intergenic
1151271375 17:72998850-72998872 GAGAGGTGGAAGGGAGATGGCGG + Intronic
1151333269 17:73423757-73423779 AAGGCCTGGAAGGATGCTGGGGG + Intronic
1151345854 17:73500744-73500766 GAAGGATGGATGGAGGATGGAGG - Intronic
1151540886 17:74764047-74764069 CAGGCTTGGCAGGGTGATGGTGG - Intronic
1151967417 17:77438588-77438610 GAGGCTTGGAAGGAGGAAGGAGG + Intronic
1152131392 17:78478918-78478940 GAGGTGTGGACTGATGATGGTGG - Intronic
1152141013 17:78536748-78536770 GGGGGTTGGAAGGATGATGAGGG + Intronic
1152189592 17:78880280-78880302 GAGGATTGGAAAGATGTTGGTGG - Intronic
1152239452 17:79153891-79153913 GAGGGTGGAATGGATCATGGGGG - Intronic
1152681036 17:81668044-81668066 GAGGCTTGGAAGGAGGCTGTGGG + Intronic
1154425003 18:14265266-14265288 GGGGGTTGGAAGGTGGATGTGGG + Intergenic
1154427722 18:14284654-14284676 GAGGATTGGAAGGCAGATGTGGG + Intergenic
1154430446 18:14304165-14304187 GGGGGTTGGAAGGGGGATGTGGG + Intergenic
1154432688 18:14320492-14320514 GGGGGTTGGAAGGGGGATGTGGG + Intergenic
1154532664 18:15363369-15363391 GAGGGAAGGAAGGCTGATTGGGG - Intergenic
1155096224 18:22559219-22559241 GAGGGCTGGTGGGAGGATGGGGG + Intergenic
1155373911 18:25135413-25135435 TTGGGTTGGAAGGATGATGGGGG + Intronic
1155539318 18:26850725-26850747 GATGGATGGATGGATGATGGAGG - Intergenic
1155731547 18:29166031-29166053 GAGGCTGGGAAGGGTTATGGGGG - Intergenic
1156065859 18:33141713-33141735 GAGGATTGGAAACATGTTGGAGG - Intronic
1156471693 18:37381104-37381126 GATGGATGGATGGATGATGGTGG - Intronic
1157602217 18:48901324-48901346 GATGGATGGATGGATGATGTGGG + Intergenic
1157673468 18:49550194-49550216 GAGGATGGGAGAGATGATGGAGG + Intergenic
1157760386 18:50259442-50259464 GAGGCTGGGAAGGATAGTGGGGG + Intronic
1158509224 18:58075677-58075699 GAGGTTTGGAAGGCTGAGGCGGG + Intronic
1158836812 18:61339479-61339501 GAAGGCTGGAAGGAAGTTGGTGG - Intronic
1159005126 18:63004403-63004425 GAGATTTGGAAGGAAGATAGTGG + Intergenic
1159494582 18:69185543-69185565 GAGTGTTGGAAAGGTGGTGGTGG + Intergenic
1159636706 18:70813383-70813405 GATGGATGGATGGATGGTGGTGG - Intergenic
1159906520 18:74097396-74097418 GGGGGTTGGGAGGATGAGGGGGG + Intronic
1160502484 18:79409091-79409113 GATGGATGGATGGATGATGATGG - Intronic
1160676878 19:395674-395696 GATGATGGGAAGGATAATGGAGG + Intergenic
1160744614 19:704764-704786 CAGGGTTTGAAGGGTGGTGGAGG - Intergenic
1160918344 19:1508195-1508217 GAGGCCTGGAGGGAAGATGGGGG + Intronic
1161225474 19:3142921-3142943 GAGGGTTGGAAGGCAATTGGGGG + Intronic
1161241348 19:3225358-3225380 GGGGGATGGAAGGGTGAGGGAGG - Intronic
1161287827 19:3477873-3477895 GATGGGTGGATGGAAGATGGAGG + Intronic
1161329014 19:3677748-3677770 GAGGGAGGGATGGAGGATGGAGG + Intronic
1161329089 19:3677952-3677974 GATGGATGGATGGAGGATGGAGG + Intronic
1161329117 19:3678064-3678086 GAGAGATGGAAGGAGAATGGAGG + Intronic
1161449121 19:4334803-4334825 GATGAGTGGATGGATGATGGAGG - Intronic
1161449146 19:4334918-4334940 GATGGATGGATGGATTATGGAGG - Intronic
1161800571 19:6415091-6415113 GGGGGTTGGAAGGAGAAAGGAGG + Intronic
1161849847 19:6732587-6732609 GAGGGGTGGGAGGCTGATGGTGG + Intronic
1161934663 19:7364286-7364308 GAAGGATGGACGGATAATGGAGG + Intronic
1162177558 19:8842452-8842474 GGGGGTTTGCAGGATGATGAAGG + Intronic
1162183555 19:8887425-8887447 GATGGTGGTAAGGATGGTGGCGG - Intronic
1162342893 19:10102541-10102563 GAGGGTGGGAAGGTAGGTGGAGG - Intronic
1162600461 19:11664668-11664690 GAGGGTGGGATGTATCATGGAGG + Intergenic
1162902867 19:13805632-13805654 GAGGCATGGATGGATGATGGAGG + Intronic
1162929731 19:13951954-13951976 GCGGGTTGGTGGGATGATGGTGG - Intronic
1162979348 19:14228598-14228620 GCGGGTGGGCAGGAGGATGGAGG + Intergenic
1163020254 19:14477816-14477838 GAGGGAGGGAGGGACGATGGCGG - Exonic
1163107302 19:15132362-15132384 GAGGCTGGGAAGGGTGGTGGGGG - Intergenic
1163561983 19:18024798-18024820 GATGGTTGGGAGGCTGAAGGAGG - Intergenic
1163600931 19:18248552-18248574 GAGGGCGCGAAGGAAGATGGTGG + Intronic
1163701666 19:18789513-18789535 GAGGGGAGGAAGGATGAGGGCGG + Intronic
1164441480 19:28283344-28283366 GGGAGTGGGAAAGATGATGGTGG - Intergenic
1164441636 19:28284226-28284248 GATGGTGGGAAGAATGATGGAGG - Intergenic
1164521370 19:28982606-28982628 GTGGAAAGGAAGGATGATGGAGG + Intergenic
1164705374 19:30315422-30315444 AAAGGAAGGAAGGATGATGGTGG + Intronic
1164802357 19:31088178-31088200 GAGGGAGGGAAGGAAGAAGGAGG + Intergenic
1164813923 19:31179651-31179673 GATGGTGGCAATGATGATGGTGG + Intergenic
1165105964 19:33469876-33469898 GAGGGCTGGCAGCATGATGGGGG - Intronic
1165148811 19:33749374-33749396 GGGGGATGGTAGGAGGATGGTGG - Intronic
1165149672 19:33753477-33753499 GGGGGATGGTAGGAGGATGGTGG - Intronic
1165149756 19:33753690-33753712 GAGGGTTGGTAGGAGGATGGTGG - Intronic
1165149859 19:33753962-33753984 GGGGGATGGTAGGAGGATGGTGG - Intronic
1165520473 19:36310519-36310541 CAGGGTAGGAAGGATTATGGTGG - Intergenic
1165623599 19:37268065-37268087 CAGGGTAGGAAGGATTATGGTGG + Intergenic
1165883384 19:39059340-39059362 GAGGCTGGGAAGGATAGTGGAGG - Intergenic
1166332657 19:42087988-42088010 CAGGGTTGGGAAGGTGATGGGGG - Intronic
1166586185 19:43951398-43951420 AAGGTTTGGAAGGGTGAGGGCGG + Exonic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166813347 19:45527114-45527136 CAGGGTGGGAAGGAAGATGAAGG - Intergenic
1167019257 19:46861547-46861569 GAGGGGTGGAAGGGGGAAGGGGG - Intergenic
1167148726 19:47696874-47696896 GGCTGTTGGGAGGATGATGGGGG + Intronic
1167283632 19:48586333-48586355 GAAGGGTGGAAGGAAGTTGGTGG + Intronic
1167925010 19:52814154-52814176 GGAGGCTGGAAGGAGGATGGAGG + Intronic
1168316507 19:55486857-55486879 GGGGGTGGGAGGGATGCTGGAGG + Exonic
1168464937 19:56594825-56594847 AGGGGTTGGAAGAAGGATGGAGG - Intergenic
1202637598 1_KI270706v1_random:55784-55806 GGGGGTTGGAAGGGGGATGTGGG - Intergenic
925010177 2:479025-479047 GATGGATGGAAGCGTGATGGCGG + Intergenic
925519730 2:4730182-4730204 GAGGATTACAGGGATGATGGAGG + Intergenic
926385505 2:12332082-12332104 GAGGCTGGGAAGGGTGGTGGGGG + Intergenic
926698625 2:15787907-15787929 GACGGATGGAAGGAAGATGGAGG - Intergenic
926742523 2:16124638-16124660 GAGCTTTGGGAGGCTGATGGGGG + Intergenic
926947697 2:18206156-18206178 GAGGGAGGGAAGGAGGAAGGAGG - Intronic
927714255 2:25342044-25342066 GAGGGAGGGAAGGAGGAAGGCGG - Intronic
927894846 2:26775136-26775158 GAGGGTTGAAGGGCTGCTGGGGG - Exonic
928021082 2:27705623-27705645 GAAGGTTGGGAGGATGGTGAAGG - Intergenic
928268178 2:29830381-29830403 TAGGGCTGGAAAGGTGATGGTGG - Intronic
929363196 2:41119998-41120020 GAGGCTTGGAAGTCTCATGGTGG - Intergenic
930454624 2:51590894-51590916 GAGGGATGGAAGTAAGATGCCGG + Intergenic
931530029 2:63203643-63203665 GAGGCTGGGAAGGGTAATGGAGG - Intronic
931854625 2:66288981-66289003 GAGGCTGGGAAGGATATTGGGGG - Intergenic
932587440 2:73040394-73040416 AAGGGTGGGAAGGATGGGGGAGG - Intronic
932717705 2:74114308-74114330 GAGGGCTGGAAGGAGGATAAGGG + Intergenic
933206528 2:79513309-79513331 GATGTTGGGAAGGATGAGGGAGG - Intronic
933551907 2:83788648-83788670 TAGGGTTGGAAGGATTATTTTGG - Intergenic
933636568 2:84714444-84714466 GAGGCTGGGAAGGAGAATGGAGG + Intronic
933658752 2:84909474-84909496 GATGGTTGCAATGGTGATGGTGG - Intergenic
933768620 2:85728900-85728922 GAGGCTTGGAATGGTGAAGGAGG + Intergenic
934555926 2:95286966-95286988 TGGGGTTGGGAGGAAGATGGGGG + Intronic
934612230 2:95749009-95749031 GAGGCTGGGAAGGATAGTGGGGG + Intergenic
934841922 2:97630447-97630469 GAGGCTGGGAAGGATAGTGGGGG - Intergenic
934953659 2:98597854-98597876 GAGAGTTGGAGGGGTGGTGGGGG + Intergenic
934987874 2:98900401-98900423 GAGGGGAGGCAGGAGGATGGAGG + Intronic
935288132 2:101583959-101583981 GAGGCTAGGAAGGGTGATTGGGG - Intergenic
935424746 2:102908286-102908308 CAGGGGTGGAAGGATGAAGTGGG + Intergenic
935461319 2:103338350-103338372 GAGGCTGGGAAGGATAATAGGGG + Intergenic
937331995 2:121037522-121037544 GAGGGAGGGGAGGATGAGGGTGG - Intergenic
937668818 2:124517301-124517323 GAGGGTTGTGATGGTGATGGAGG + Intronic
937668942 2:124517975-124517997 GAGGGTTGTGATGGTGATGGGGG + Intronic
937774920 2:125765011-125765033 CAGGGTTAGATGGGTGATGGAGG + Intergenic
937819928 2:126298503-126298525 GAGGGATGGAAGGAGGGAGGGGG + Intergenic
937981658 2:127619394-127619416 GGGGGCTGGATGGATGGTGGGGG + Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938722622 2:134079861-134079883 GAAGGTTGGAAGGCTGATACAGG + Intergenic
938730543 2:134143625-134143647 GAGGGGTGGAAGGGTGGTGCTGG + Intronic
939798242 2:146674949-146674971 GAAGGTAGAAAGGATGATGGAGG - Intergenic
939963386 2:148586116-148586138 GAGGCTTGGAAGGGTAGTGGGGG + Intergenic
940259800 2:151767654-151767676 TAGTGTTGGAAGGATCCTGGAGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942206110 2:173621148-173621170 GATGGATGGATGGATGATGCAGG + Intergenic
942724467 2:178991534-178991556 GAGGGTAAGAAGGAAGAAGGAGG + Intronic
942829452 2:180222421-180222443 GATTATTGGAAGGATGATAGAGG + Intergenic
946118655 2:217489358-217489380 GTGGATTGGAAGGATGGCGGAGG + Intronic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
946414874 2:219534933-219534955 GGGGGTTGGGAGGGTGCTGGGGG + Intronic
947372038 2:229456729-229456751 GATGGTAGGATGGATGAAGGGGG - Intronic
947566305 2:231196138-231196160 GTTGATTGGAAGGATGCTGGAGG + Intergenic
948458415 2:238117931-238117953 GAAGGGTGGAAGGAGGAGGGTGG + Intronic
948765373 2:240216640-240216662 GTGGGGTGGAAGGATGGGGGTGG + Intergenic
948765424 2:240216747-240216769 GTGGGGTGGAAGGATGGGGGTGG + Intergenic
948765448 2:240216799-240216821 GTGGGGTGGAAGGATGGGGGTGG + Intergenic
948765493 2:240216903-240216925 GTGGGGTGGAAGGATGGGGGTGG + Intergenic
948765541 2:240217007-240217029 GTGGGGTGGAAGGATGGGGGTGG + Intergenic
1169493935 20:6095189-6095211 GAGGATTGGGAGGAGAATGGGGG + Intronic
1169732223 20:8798740-8798762 GAGAATTGGAGGGCTGATGGGGG - Intronic
1169762176 20:9107888-9107910 GAGGTTTGGAGGGATGGAGGTGG + Intronic
1169958487 20:11132117-11132139 GGGGTTTGGAAGGAGGAGGGAGG + Intergenic
1170177676 20:13490673-13490695 GAGGGTGGGAGGGGTGAGGGAGG - Intronic
1170589744 20:17762738-17762760 GAGCCTTGGAAGGAGGAGGGAGG - Intergenic
1170636857 20:18114171-18114193 GAAGGATGGAAGGGTAATGGGGG - Intergenic
1170837267 20:19895064-19895086 GGTGGTTGGGAGGCTGATGGTGG - Intronic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1171884174 20:30639873-30639895 GGGGGTTGGAAGGGGGATGTGGG - Intergenic
1172029232 20:31969659-31969681 GAGGCTTGGAAGGAGGAGGGCGG - Intronic
1172602831 20:36195599-36195621 GAGGGTGGGAGGGCTGAGGGAGG - Intronic
1172780170 20:37431940-37431962 GAGGGTTGGATGGAGGAAGGAGG - Intergenic
1172780844 20:37436256-37436278 GACGGATGGATGGATGATGGGGG - Intergenic
1172780862 20:37436324-37436346 GACAGATGGATGGATGATGGGGG - Intergenic
1172848560 20:37944635-37944657 GAGGGATGGTAGGAGGAGGGAGG - Exonic
1172898003 20:38314198-38314220 GATGGTGGGGATGATGATGGTGG + Intronic
1172898066 20:38314552-38314574 GATGGTGGGGATGATGATGGTGG + Intronic
1172898078 20:38314615-38314637 GATGGTGGGGATGATGATGGTGG + Intronic
1172898091 20:38314678-38314700 GATGGTGGGGATGATGATGGTGG + Intronic
1172898103 20:38314735-38314757 GATGGTGGGGATGATGATGGTGG + Intronic
1174473351 20:50777908-50777930 GAGGGAGGGAAGGAGGAAGGAGG - Intergenic
1174954715 20:55084563-55084585 GTGGGGTGGTAGGATAATGGTGG + Intergenic
1174970857 20:55274114-55274136 GAGAGCTGGAAGAATGAGGGAGG - Intergenic
1175027861 20:55921828-55921850 GAAGTTAGGAAGGATGCTGGGGG - Intergenic
1175427020 20:58874526-58874548 GAGGGTTGGAGCTAAGATGGAGG - Intronic
1175803822 20:61816178-61816200 TAGGTTTGGGAAGATGATGGTGG - Intronic
1175910968 20:62405410-62405432 GAGGGTCAGAGGGATGATTGGGG - Intronic
1175934548 20:62509058-62509080 GAGGGGTGAAAGGGTGAGGGTGG - Intergenic
1175984112 20:62755589-62755611 GAGGGAGGGAGGGATGATGGAGG - Intronic
1175984148 20:62755690-62755712 GAGGGAGAGAGGGATGATGGAGG - Intronic
1176129825 20:63492026-63492048 GATGGATGGATGGATGATGGAGG + Intronic
1176764696 21:13004842-13004864 GAGGGAAGGAAGGCTGATTGGGG + Intergenic
1176844351 21:13865256-13865278 GGGGGTTGGAAGGTGGATGTGGG - Intergenic
1176847043 21:13884779-13884801 GGGGGTTGGAAGGGGGATGTGGG - Intergenic
1176847120 21:13885109-13885131 GAGGGTTGGGGGGATTGTGGTGG - Intergenic
1177009690 21:15717060-15717082 GAGGGGTGGTAGCATGGTGGTGG - Intergenic
1177261115 21:18731817-18731839 GAGGCTTGGAAGGGTATTGGGGG - Intergenic
1179073938 21:38100228-38100250 GTGGAATGGAAGGGTGATGGAGG - Intronic
1179142616 21:38739901-38739923 GAGGGTTTGGATGGTGATGGGGG + Intergenic
1179518684 21:41927814-41927836 AAGGGTTGGAAACAAGATGGTGG + Intronic
1179667724 21:42924112-42924134 GAGGGTTTGAAGGGGGAAGGAGG + Intergenic
1180511890 22:16099646-16099668 GAGGGAAGGAAGGCTGATTGGGG + Intergenic
1180966290 22:19789493-19789515 GGGGGTTGGCAGGATGAGGGGGG + Intronic
1181528437 22:23502749-23502771 GAGGGGTGGAGGGGTGAAGGAGG - Intergenic
1181528451 22:23502783-23502805 GAGGGAGGGATGGAGGATGGAGG - Intergenic
1181528470 22:23502835-23502857 GAGGGAGGGATGGAGGATGGAGG - Intergenic
1181671201 22:24426345-24426367 GATGGATGGATGGATGAAGGCGG + Intronic
1181850807 22:25748717-25748739 AAGGGCAGGAAGGTTGATGGAGG - Intronic
1182649014 22:31835552-31835574 GAGGGTCAGAAGGCTGATGATGG + Intronic
1182931385 22:34177477-34177499 GAGAGGTGGAAGGAGGAGGGAGG - Intergenic
1183467322 22:37986319-37986341 GAGGGGTGGAAGGATGAGTGGGG - Intronic
1183570216 22:38647713-38647735 GAGGGGTGATAGGATTATGGGGG - Intronic
1184089354 22:42284118-42284140 GAGGGATGGATGGATGGAGGAGG + Intronic
1184264511 22:43339873-43339895 GAGGGTTGGAGTGATGCTTGTGG - Intronic
1184293394 22:43509686-43509708 GAGGGATGGAGGGATGAAGGGGG - Intergenic
1184460795 22:44636777-44636799 GGTGGATGGATGGATGATGGTGG + Intergenic
1184460825 22:44636904-44636926 GGTGGATGGATGGATGATGGTGG + Intergenic
1184460902 22:44637253-44637275 GGTGGATGGATGGATGATGGTGG + Intergenic
1184691117 22:46117739-46117761 GAGCCTTGGAAGGGTGAGGGTGG - Intergenic
1184753997 22:46506270-46506292 CAGGCTTGGAGGGATCATGGCGG - Intronic
1184852309 22:47127983-47128005 GTGGGGTGGAGGGAGGATGGGGG - Intronic
1184852323 22:47128011-47128033 GTGGGGTGGAGGGAGGATGGGGG - Intronic
1184852362 22:47128105-47128127 GTGGGGTGGAGGGAGGATGGGGG - Intronic
1184852375 22:47128132-47128154 GTGGGGTGGAGGGAGGATGGGGG - Intronic
1184852388 22:47128159-47128181 GTGGGGTGGAGGGAGGATGGGGG - Intronic
1184878117 22:47288365-47288387 GATGGATGGAAGGATGAAGGTGG - Intergenic
1185104342 22:48858846-48858868 GATGGTTGGATGGATGATGGAGG - Intergenic
1185104367 22:48858947-48858969 GATGGATGGATAGATGATGGAGG - Intergenic
1185104448 22:48859288-48859310 AATGGATGGATGGATGATGGAGG - Intergenic
1185147560 22:49147565-49147587 GACGGTTGGAAGGATGAGCTGGG + Intergenic
1185276457 22:49952025-49952047 GAGTCTTGGAAGGATGTGGGTGG - Intergenic
949845202 3:8362646-8362668 GATGGATGGATGGAGGATGGAGG + Intergenic
950556618 3:13699813-13699835 GAGGGCTGTGAGGATGATAGTGG + Intergenic
950823748 3:15792557-15792579 GAGGCTGGGAAGGGTAATGGGGG + Intronic
951055750 3:18144867-18144889 GAGGGGTGGAAGGAAAATGAAGG - Intronic
951124787 3:18970442-18970464 GAGGCTTGGAAGGGTAACGGGGG - Intergenic
951355812 3:21665368-21665390 GAGGGATGGGTGCATGATGGAGG - Intronic
951781530 3:26368635-26368657 GAGGGTTTTAGGGATGCTGGAGG + Intergenic
952012657 3:28918314-28918336 TAGGGTTGGAAGGCACATGGAGG - Intergenic
952167135 3:30762747-30762769 GAGAGTGGGAAGGATAGTGGGGG - Intronic
952727907 3:36607692-36607714 GAGGGTTTGGAGGATGAGGGGGG + Intergenic
952853350 3:37747544-37747566 GAGGCTGGGAAGGATAATGGGGG - Intronic
953766939 3:45750203-45750225 GGGGGACGGAAGGATGAAGGAGG + Intergenic
953837135 3:46356549-46356571 AAGTTTTGGCAGGATGATGGAGG + Intronic
955366043 3:58311054-58311076 GAGGGTAGAGAGGATGAAGGAGG - Intronic
955543277 3:60000595-60000617 GAGGGTAGGAAGAATGCTAGAGG + Intronic
955876822 3:63499266-63499288 AAGAACTGGAAGGATGATGGTGG + Intronic
957124596 3:76142656-76142678 GAGGCTGGGAAGGGTAATGGGGG + Intronic
959336392 3:105070565-105070587 AAGGGTGGGAAGGGTAATGGAGG + Intergenic
959971575 3:112415999-112416021 GAGGCTGGGAAGAATGAGGGGGG - Intergenic
960290375 3:115877275-115877297 GAGGGTGGGAGGGAGGAAGGAGG - Intronic
960330648 3:116356419-116356441 GAGGTTTGGAAGAATGGAGGTGG + Intronic
960953192 3:123012769-123012791 CTGGGGTGGAAGGATGAAGGAGG - Intronic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
962502559 3:136010065-136010087 GAGGATGGGAAAGATGCTGGAGG - Intronic
962611871 3:137084439-137084461 GATGGTTGGTGCGATGATGGAGG + Intergenic
964728447 3:159839684-159839706 GTGGGTAGGAAGGATGATGCCGG + Intronic
964804666 3:160595349-160595371 GAGGCTGGGAAGGGTAATGGGGG + Intergenic
966644381 3:182227063-182227085 GAGGGGTAGTAGGAAGATGGAGG - Intergenic
966855660 3:184192454-184192476 GAGGCTGGGAAGGATAAGGGGGG - Intronic
967078111 3:186023547-186023569 GTGGGTGGGAAACATGATGGAGG + Intergenic
968632973 4:1661675-1661697 GAGGGTTGGAGGTGTAATGGTGG - Intronic
968748275 4:2372384-2372406 GAGGACTAGAAGGAGGATGGCGG - Intronic
969033039 4:4228393-4228415 GTGAATTGGAAGAATGATGGTGG - Intergenic
969579930 4:8058731-8058753 ATGGGTTGGGAGGGTGATGGTGG - Intronic
970766483 4:19555713-19555735 GAAGTTTGGAAGGATGAGGCGGG - Intergenic
971263412 4:25077016-25077038 GAGGGCTGGAAGGAGGTTGGGGG - Intergenic
971328949 4:25666327-25666349 GAGGGTGGGAAGGACGGGGGAGG + Intronic
971425013 4:26507492-26507514 GATGGATGGAAGAAGGATGGAGG + Intergenic
971500881 4:27316693-27316715 GAGGGTGGGATTGATGAAGGGGG + Intergenic
971523168 4:27581254-27581276 GAGGCTGGGAAGGATAGTGGGGG - Intergenic
972165884 4:36283225-36283247 GAGAGTGGGAAGAATGATGACGG + Intronic
973227700 4:47804707-47804729 GAGGCTGGGAAGGATGGTGGGGG + Intronic
973279153 4:48341476-48341498 GAGGGACGGAGGGAAGATGGCGG + Exonic
973367839 4:49222146-49222168 GGGGGTTGGAAGGGGGATGTAGG - Intergenic
973393215 4:49573280-49573302 GGGGGTTGGAAGGGGGATGTGGG + Intergenic
974556003 4:63448145-63448167 GAGGGTTGGGAGGCTGAGGTTGG - Intergenic
974950209 4:68577664-68577686 GAGGGTTTGAAGGGGGAAGGCGG - Intronic
974975395 4:68885630-68885652 GAGGCTGGGAAAGATAATGGGGG + Intergenic
975497790 4:75053845-75053867 GAGGGCTGGAAGGATGGGGGAGG - Intergenic
975630278 4:76394474-76394496 GAGGGTGGGAAGGGTAGTGGGGG + Intronic
975834201 4:78404539-78404561 GGGGGTTGGAGGGAAGATGAAGG - Intronic
975924268 4:79430188-79430210 GAGGGCTGGAGGAAAGATGGAGG - Intergenic
976117996 4:81748784-81748806 GAGGCTGGGAAGGGTGGTGGGGG - Intronic
976327185 4:83785065-83785087 GTGGGTTGTTAGGATAATGGAGG - Intergenic
977477547 4:97531704-97531726 GAGGCTGGGAAGGGTAATGGGGG + Intronic
978026544 4:103882577-103882599 GAGGCTGGGAAGGGTAATGGGGG - Intergenic
978262038 4:106771507-106771529 GAGGGTGTGAAGGGTGGTGGAGG + Intergenic
979042719 4:115818516-115818538 GAGGCTGGGAAGGGTAATGGAGG - Intergenic
980236980 4:130120902-130120924 GTGGGTGGGAAGGAAGGTGGAGG + Intergenic
980944152 4:139302281-139302303 GAGGGAGGGACAGATGATGGAGG - Intronic
981172474 4:141640929-141640951 GATGGTTGTAAGGTTGATGGCGG + Intronic
981669249 4:147267888-147267910 GAGGGTTGGGAGAGTGATTGGGG - Intergenic
982010631 4:151102629-151102651 GAGGGTAGAAAGGAGGAGGGAGG + Intronic
982200336 4:152954114-152954136 GTGGGTGGGAAGGAGGGTGGAGG + Intronic
983595046 4:169457052-169457074 GAGGCTAGGAAGGGTGGTGGTGG + Intronic
984132973 4:175901117-175901139 GAGGCTGGGAAGGATAGTGGGGG + Intronic
984142263 4:176018106-176018128 GTGGGGTGGAAGGATGGCGGAGG + Intergenic
984822060 4:183890574-183890596 AAGGGAGGGAGGGATGATGGAGG + Intronic
985159298 4:187027498-187027520 GAGGGTTGGAAGGCTGGGAGTGG + Intergenic
985180230 4:187252504-187252526 GAGGGATGGAAGGCTGAGTGTGG + Intergenic
1202764916 4_GL000008v2_random:141639-141661 GGGGGTTGGAAGGGGGATGTGGG - Intergenic
985662548 5:1164331-1164353 GTGGGTGGGAAGGATGGTGTGGG + Intergenic
985670997 5:1206643-1206665 GGGGGGCGGGAGGATGATGGGGG + Intronic
985680354 5:1252814-1252836 CAGGGTGGCAGGGATGATGGGGG - Intergenic
985783975 5:1884816-1884838 GAGGGGAGGAAGGAGGGTGGGGG - Intronic
985962638 5:3314358-3314380 GAGGGCTGCAAGGAGGATGAGGG - Intergenic
985969556 5:3364274-3364296 AAGGGAGGGAAGGATGATGCAGG + Intergenic
986294013 5:6422582-6422604 GAGGGAAGGAAGGAAGAGGGAGG + Intergenic
987681503 5:21142902-21142924 GAGGGTGGGTGGGATGTTGGAGG + Intergenic
988300185 5:29414215-29414237 GAGGCTGGGAAGGATAGTGGAGG - Intergenic
988715357 5:33821804-33821826 GAGGATTGAAAGGGTGATGTTGG - Intronic
988850093 5:35172359-35172381 GAGGCTTGGTAGGAGGTTGGAGG + Intronic
989413955 5:41152025-41152047 GAAGGATGGAAGGAAGAAGGTGG + Intronic
989497492 5:42125914-42125936 GAGGGTTGGGGGGAGGGTGGTGG + Intergenic
989714190 5:44440812-44440834 GAGGGTGGGAAAGTTGAGGGTGG - Intergenic
990022326 5:51142887-51142909 GTGGGGTGGAAGGATGGGGGAGG + Intergenic
990189984 5:53249197-53249219 GAGGGGTGGAAGTAGGGTGGAGG - Intergenic
991331098 5:65492997-65493019 GAGGCTGGGAAGGATAGTGGGGG + Intergenic
991510640 5:67373136-67373158 GAGGCTGGGGAGGAGGATGGGGG - Intergenic
992327143 5:75671517-75671539 TAGGGTTGGAATGAAGATGAAGG + Exonic
992681169 5:79154673-79154695 AAGGGTGGAAAGAATGATGGTGG - Intronic
993013313 5:82508534-82508556 CAGGGTGAGAAGGGTGATGGAGG - Intergenic
993964244 5:94341512-94341534 GAGGGTTCGAGGTAGGATGGAGG + Intronic
995207447 5:109497436-109497458 GAGGGATGGAGGGAAGAAGGTGG + Intergenic
995269217 5:110202296-110202318 CAGGTTTGTAAGGATGAAGGAGG - Intergenic
995932514 5:117465036-117465058 GAGGGTGGGAAGGGTACTGGGGG - Intergenic
995996319 5:118304814-118304836 GAGAGATGGAAGGAGGAAGGAGG + Intergenic
996576265 5:124979373-124979395 GAGGGATGGGAGGAGGAAGGGGG + Intergenic
996796195 5:127350987-127351009 GAGGATGGGAAGGATAGTGGGGG + Intronic
996969954 5:129353908-129353930 CAGGCTGGGAAGGATGGTGGGGG + Intergenic
997412735 5:133702567-133702589 GTGGTGTTGAAGGATGATGGAGG - Intergenic
997895087 5:137709205-137709227 GAGATTTGGAAAAATGATGGTGG - Intronic
998535233 5:142924209-142924231 GAGAGTTGGAAAGAGGAGGGAGG - Intronic
998705063 5:144749859-144749881 GATGATTGGAGAGATGATGGAGG + Intergenic
998837754 5:146219831-146219853 CAGGGTTGGAAGGAGGAGAGTGG - Intronic
999231901 5:150066675-150066697 CAGGGTGGGAAGGATGTTGGGGG - Intronic
1000939862 5:167347637-167347659 GAAGGATGGAAGGAAGAAGGAGG - Intronic
1002298597 5:178245294-178245316 GATGGATGGATGGATGATGATGG - Intronic
1002690316 5:181045809-181045831 GAGGGCTGGAGAGATGGTGGAGG - Intronic
1003518481 6:6837169-6837191 GAGGGCAGGAAGGAAGAAGGAGG + Intergenic
1004751448 6:18566056-18566078 GAGGGAAGGAAGGAAGAAGGAGG - Intergenic
1006405688 6:33843556-33843578 GAGGCTTGGGAGGAGGCTGGGGG - Intergenic
1006521357 6:34572982-34573004 GAGGGTTGAAAGGATGCTTTGGG - Intergenic
1006535489 6:34696210-34696232 GAGGGGCGGAAGGGAGATGGTGG - Intronic
1006953841 6:37849166-37849188 GAAGGTTGGAGTGAAGATGGAGG + Intronic
1007176785 6:39902605-39902627 CAATGTTGGAAGGATGATGCAGG + Exonic
1007263605 6:40581194-40581216 GAGGATGGAAAGGAGGATGGAGG + Intronic
1007369722 6:41418378-41418400 GAGGGTGGCAGGGGTGATGGTGG - Intergenic
1007498985 6:42281001-42281023 GACGGTGGGAGGGATGATGAAGG + Intronic
1007512359 6:42383424-42383446 CAGGGTTGGGAGGAGGAAGGGGG - Intronic
1007620795 6:43213368-43213390 GAGGGGAGTAAGGATGAAGGAGG - Intronic
1007656950 6:43456123-43456145 GAGGGAGGGAAGGGTGGTGGGGG - Exonic
1008586695 6:52957313-52957335 GAGGGATCACAGGATGATGGAGG - Intergenic
1009593803 6:65708945-65708967 GAGGGGTGGAAGGGAGAGGGAGG - Intergenic
1009822441 6:68820644-68820666 GAGGCTGGGAAGGACGGTGGAGG - Intronic
1010121466 6:72380246-72380268 GTGGGGTGGAAGGATGGGGGAGG + Intronic
1011247446 6:85334517-85334539 GAAGGTTGGAAGGGTAGTGGTGG + Intergenic
1011595959 6:89016352-89016374 GAGGGTTTGAGGGTTGAAGGTGG + Intergenic
1011847330 6:91582338-91582360 GAGGATTGGAAGGATGCAGAAGG - Intergenic
1012257568 6:97051279-97051301 GAGAGTTGGAAGGAGAATGGAGG - Intronic
1012522972 6:100143056-100143078 GAGGATGGGAAGGTTGGTGGTGG + Intergenic
1013482512 6:110564689-110564711 GATGGTAGGAAGGATGGGGGGGG - Intergenic
1013703638 6:112805703-112805725 GAGAGATGGAAGGAGGATAGAGG - Intergenic
1013749074 6:113381099-113381121 GAGGGAGGGAAGAATGATGTTGG + Intergenic
1014077588 6:117253768-117253790 GAGGCTGGGAAGGGTGGTGGAGG - Intergenic
1014093057 6:117427183-117427205 GAGGCTGGGAAGGGTGGTGGTGG - Intronic
1014118934 6:117700944-117700966 GAGGCTGGGAAAGATAATGGGGG + Intronic
1015910929 6:138166999-138167021 GTGAGTTGGTGGGATGATGGAGG - Intronic
1016480089 6:144471212-144471234 GAGGGTGGGAAGGAGGGAGGAGG + Intronic
1016669878 6:146691885-146691907 GAGGGATGGAAGGAGGAAGAAGG - Intronic
1017113020 6:150950273-150950295 TAGGGCTGGCAGGAGGATGGAGG - Intronic
1017172778 6:151473395-151473417 GAGTGTTGGAAGCAGGATGGGGG - Intergenic
1017195226 6:151693432-151693454 GAATGATGGAAGAATGATGGAGG - Intronic
1017258911 6:152364660-152364682 GAGGGAGGGAAGGAGGAAGGAGG + Intronic
1017749696 6:157479819-157479841 GAGAGCTGGAAGGCTGGTGGTGG + Intronic
1018061305 6:160092011-160092033 TAGGTTTGGAAGGATGAGGAAGG - Intronic
1018101595 6:160445564-160445586 GTGGGTTGGAGGGACGATGTTGG + Intronic
1018124299 6:160667226-160667248 GAGGGTTGGAAGCAAGAGGGGGG - Intergenic
1018699561 6:166415977-166415999 GAGGATGGTGAGGATGATGGTGG - Intronic
1018834618 6:167473589-167473611 GAGGGGAGGGAGGATGATGAGGG + Intergenic
1018886358 6:167941010-167941032 GAGGGATGTAGGGATGAGGGTGG + Intronic
1018886370 6:167941068-167941090 GAGGGATGTAGGGATGAGGGTGG + Intronic
1018886393 6:167941182-167941204 GAGGGATGTAGGGATGAGGGTGG + Intronic
1018886405 6:167941240-167941262 GAGGGATGTAGGGATGAGGGTGG + Intronic
1018886441 6:167941412-167941434 GAGGGATGTAGGGATGAGGGTGG + Intronic
1018886453 6:167941470-167941492 GAGGGATGTAGGGATGAGGGTGG + Intronic
1019357617 7:589045-589067 GATGGTGGCAATGATGATGGTGG + Intronic
1021498603 7:21304332-21304354 GAGGGGTGGGAGGAGGATGAGGG + Intergenic
1021593925 7:22294502-22294524 GATGGTTAGAGGGATGAGGGTGG - Intronic
1022003179 7:26245068-26245090 GAGGGTTTGAAGGGAGAAGGGGG - Intergenic
1023095957 7:36660043-36660065 GAGGGTTGCAAGGTACATGGTGG - Intronic
1023256829 7:38320661-38320683 GAGGCTTGTAAGGGTGGTGGGGG - Intergenic
1023622024 7:42083191-42083213 GAGGCTAGGAAGGATAGTGGGGG - Intronic
1024054824 7:45653304-45653326 GAGCATTGGAAAGATGAGGGTGG + Intronic
1024644914 7:51362934-51362956 GTCGATTGGAATGATGATGGTGG - Intergenic
1026665838 7:72338965-72338987 GAGGTTGGGAAGGGTGAGGGGGG - Intronic
1028828991 7:95305999-95306021 GAGGGATGGAAGGAGGATCTGGG + Intronic
1029063425 7:97823732-97823754 GAGGCTTGGAAAGTTAATGGTGG - Intergenic
1029337768 7:99916926-99916948 GAGCATGGGAAGGAGGATGGTGG - Intronic
1029803601 7:102975039-102975061 GAGGGTTTGAAGGGGGAAGGAGG - Intronic
1030357023 7:108554673-108554695 GATGGATGGATGGATGATGCAGG - Intronic
1031390509 7:121208114-121208136 GAGGATTTTAATGATGATGGGGG - Intronic
1031501445 7:122522730-122522752 GAGGCTGGGAAGGGTGTTGGGGG - Intronic
1031755682 7:125638891-125638913 GAGGGTAAGAGGGATGATGCTGG - Intergenic
1032610632 7:133408487-133408509 TAGGGTGGTAAGGATGATGGAGG + Intronic
1033263676 7:139865875-139865897 GAGGGAGGGAAGGAGGAAGGAGG + Intronic
1033943246 7:146681519-146681541 GAGGGGTGGGAGGGTGGTGGGGG + Intronic
1034104810 7:148481381-148481403 GATGGTTGGCAGGATGCTGGAGG - Intergenic
1035278849 7:157764983-157765005 GATGGTTGGATGGATGAAAGTGG - Intronic
1035278923 7:157765323-157765345 GATGGGTGGATGGATGATGGAGG - Intronic
1035314467 7:157989599-157989621 AAGGGGTGGAGGGATGAGGGGGG + Intronic
1036171973 8:6495998-6496020 GGGGGTTGGGAGGGTGAGGGAGG + Intronic
1036602503 8:10274757-10274779 GATGGCTGAATGGATGATGGTGG - Intronic
1037435992 8:18863935-18863957 GAGGTTGGGAAGGCTGATTGTGG - Intronic
1038212641 8:25533837-25533859 GGGGGAGGGAAGGAGGATGGTGG - Intergenic
1038475334 8:27862329-27862351 CAGGGCTGGGAGAATGATGGAGG - Intergenic
1039050742 8:33490929-33490951 GAGGCTGGGAAGGGTAATGGGGG - Intronic
1039071771 8:33655421-33655443 GAGGCTGGGAAGGGTGGTGGAGG - Intergenic
1039172540 8:34764299-34764321 GAGGGAAGGAAGGATTCTGGAGG + Intergenic
1040102969 8:43521355-43521377 GAGAATGGGACGGATGATGGTGG + Intergenic
1040366677 8:46724430-46724452 GAGGCTTGGAAAGTTAATGGTGG + Intergenic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1040792968 8:51254830-51254852 CACGGTTGGAAGCATGATGCTGG - Intergenic
1041882823 8:62772054-62772076 GAGGGTGGGAAGAATAGTGGGGG - Intronic
1042065161 8:64866813-64866835 GAGGCTGGGAAGGGTAATGGGGG + Intergenic
1042372577 8:68008501-68008523 GTGTGTTTTAAGGATGATGGTGG + Intronic
1042725281 8:71868499-71868521 GACACTTGGTAGGATGATGGAGG - Intronic
1042837592 8:73092445-73092467 GAGGGTTGACAGAATGAAGGTGG + Intronic
1042853759 8:73243149-73243171 GAGGCTGGGAAGGATAGTGGAGG + Intronic
1043147990 8:76680465-76680487 GACGGTTGCAAGAATGATGGGGG - Intergenic
1043313035 8:78886184-78886206 GAGGGTGGGAGGGAGGAGGGAGG - Intergenic
1043313066 8:78886272-78886294 GAGGGTGGGAGGGAGGAGGGAGG - Intergenic
1044300005 8:90572803-90572825 GAGGGAGGGAGGGAGGATGGGGG + Intergenic
1047163734 8:122412273-122412295 GAAGGATGGAAGAATGAAGGAGG - Intergenic
1047512954 8:125529459-125529481 GAGGTTTGAATGGACGATGGTGG + Intergenic
1048344688 8:133567805-133567827 GAGGGTTTTGAGGATGATGCTGG + Intronic
1048681891 8:136851916-136851938 GTGATTTGGAAGGAGGATGGAGG + Intergenic
1048717146 8:137282803-137282825 GAGGGTTTGAAGGGGGAAGGGGG - Intergenic
1049042195 8:140120935-140120957 GATGGTTGAATGGATGATGTTGG - Intronic
1049296066 8:141839773-141839795 GATGGTTGTGATGATGATGGTGG + Intergenic
1049348211 8:142150198-142150220 AATGGATGGATGGATGATGGTGG + Intergenic
1049375088 8:142285530-142285552 GAGGGATAGATGGATGATGGGGG + Intronic
1049471052 8:142775182-142775204 GAGGGTGGCCAGGAGGATGGGGG + Intronic
1049580517 8:143408607-143408629 GGGGGTGGGAAGGCTGACGGAGG - Intergenic
1049682801 8:143927192-143927214 GACCGTTGCCAGGATGATGGCGG - Intronic
1049739830 8:144233348-144233370 GGGGGAGGGAAGGTTGATGGTGG - Intronic
1049805544 8:144537177-144537199 GTGGGTGGGAAGGGTGCTGGTGG + Intronic
1050319095 9:4432885-4432907 GAGGGATGGGAGGATGAGGCGGG - Intergenic
1050578117 9:7020956-7020978 GAGGCTAGGAAGGGTGGTGGGGG - Intronic
1050789412 9:9447513-9447535 GAGGGTAGGAAGTAAGAGGGAGG + Intronic
1051249449 9:15144692-15144714 GTGGGTTGGCAGGATGAGTGGGG - Intergenic
1051769579 9:20562342-20562364 GAGGATTGCATGAATGATGGTGG - Intronic
1051815792 9:21103888-21103910 GAGGCTAGGAAGGGTAATGGGGG + Intergenic
1052518925 9:29518199-29518221 GAGGCTGGGAAGGGTAATGGGGG - Intergenic
1052692073 9:31827666-31827688 GAGGGTGGGAAGGGTAGTGGAGG + Intergenic
1052821253 9:33139398-33139420 GTGTGTTGGAAGCATGATGGGGG - Intronic
1053013221 9:34647204-34647226 GAGGGTTGAGAGGGTCATGGCGG - Exonic
1053071379 9:35104060-35104082 GAGGGTGTGAAGGGGGATGGAGG - Intergenic
1053497908 9:38562097-38562119 GAGGGGTGGAAGTGTGTTGGGGG - Intronic
1053531606 9:38887529-38887551 GAGGCTTGGAATGCTGAGGGTGG + Intergenic
1053859494 9:42372611-42372633 GAGGTGTGAAAGGAGGATGGGGG - Intergenic
1054203830 9:62111957-62111979 GAGGCTTGGAATGCTGAGGGTGG + Intergenic
1054251693 9:62723583-62723605 GAGGTGTGAAAGGAGGATGGGGG + Intergenic
1054420280 9:64921877-64921899 GAGGGAAGGAAGGCTGATTGGGG - Intergenic
1054565805 9:66758100-66758122 GAGGTGTGAAAGGAGGATGGGGG + Intergenic
1054634532 9:67476408-67476430 GAGGCTTGGAATGCTGAGGGTGG - Intergenic
1054740956 9:68805249-68805271 AAGGGTGGGAAGAATGGTGGAGG + Intronic
1054996868 9:71401287-71401309 GTGGGGTGGAAGGAAGATGAGGG + Intronic
1055007655 9:71526942-71526964 GGGGGAGGGAAGGAGGATGGAGG - Intergenic
1055639348 9:78307523-78307545 GAGCGTTGGCAGGAAGTTGGGGG - Intronic
1055644693 9:78352012-78352034 GAGGGAAGGAAGAAGGATGGTGG - Intergenic
1055708227 9:79031779-79031801 GAGGGAGGGAGGGATGAAGGAGG + Intergenic
1055749216 9:79486367-79486389 GAGGGAAGGAAGGAAGAGGGAGG - Intergenic
1056297500 9:85207359-85207381 GGGGGTGGGAAGGGTGAAGGTGG + Intergenic
1056810529 9:89760495-89760517 GCGGGTGGGAATGCTGATGGAGG - Intergenic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1058371067 9:104268367-104268389 GAGGCTTGGAAGAATGTGGGTGG + Intergenic
1059183242 9:112240071-112240093 GAGGGGTAGAAGGATGAAGTAGG + Intronic
1059243211 9:112826317-112826339 GAGGGTTGGCAGAAGGCTGGGGG + Intronic
1059419770 9:114183571-114183593 TAGGGTGGAAAGGATGGTGGTGG + Intronic
1059446851 9:114343401-114343423 GAGGGGTGAAGGGAGGATGGAGG + Intronic
1059462831 9:114445592-114445614 GAAGGTGGGAGAGATGATGGTGG - Intronic
1059718560 9:116936294-116936316 GATGGTTGGAATGTTGGTGGTGG - Intronic
1059876925 9:118645375-118645397 GAGGGAGGGAGGGAGGATGGAGG - Intergenic
1060748596 9:126154152-126154174 GAAGGATGGATGGATGAAGGAGG + Intergenic
1060979740 9:127785471-127785493 GAGGGTGGGAGGGAGGAGGGCGG + Intergenic
1061963146 9:133998384-133998406 GAAGGATGGAAGGATGTAGGAGG - Intergenic
1061980965 9:134103440-134103462 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981005 9:134103627-134103649 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981024 9:134103717-134103739 GAAGGATGGATGGATGGTGGTGG - Intergenic
1061981118 9:134104149-134104171 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981124 9:134104171-134104193 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981160 9:134104341-134104363 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981166 9:134104363-134104385 GATGGCTGGATGGATGGTGGTGG - Intergenic
1061981225 9:134104617-134104639 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981231 9:134104639-134104661 GATGGCTGGATGGATGGTGGTGG - Intergenic
1062226603 9:135455866-135455888 GAGGGTGGGAAGGAGGAAGCTGG + Intergenic
1062469082 9:136694443-136694465 GAGGGACGGAGGGATGACGGGGG + Intergenic
1062535587 9:137019869-137019891 GAGGGTGGGACAGATGAGGGTGG - Intronic
1062703160 9:137918638-137918660 GAGGGCTGGTGGCATGATGGTGG + Intronic
1203545666 Un_KI270743v1:126527-126549 GGGGGTTGGAAGGGGGATGTGGG - Intergenic
1185602313 X:1348834-1348856 TAGGGTGGGAAGGAGGAGGGAGG - Intronic
1185627590 X:1493389-1493411 GAGGGAGGGAAGGAGGAAGGAGG + Intronic
1185642463 X:1596442-1596464 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642478 X:1596489-1596511 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642492 X:1596536-1596558 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642507 X:1596583-1596605 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642522 X:1596630-1596652 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642537 X:1596677-1596699 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185734392 X:2485964-2485986 GAGGGTTGGACGGAAGGAGGAGG + Intronic
1185834169 X:3329441-3329463 GAGGGAAGGAAGGAAGATGAAGG + Intronic
1186195805 X:7109405-7109427 GAGGGCAGGCAGGACGATGGAGG + Intronic
1186240018 X:7555517-7555539 GAGGGAAGGAGGGAGGATGGCGG + Intergenic
1186864627 X:13707344-13707366 GAGAGTTGGAGGGGTTATGGAGG + Intronic
1187188390 X:17009768-17009790 GAGGGTTTAAAGGATGAGGATGG - Intronic
1187532812 X:20112097-20112119 GAGGGTGGGACGGATGAAGCGGG + Intronic
1187574543 X:20540696-20540718 GAGGGGTGGGAGGGTGATTGGGG - Intergenic
1188323256 X:28766686-28766708 GAGGCTGGGAAGGGTAATGGGGG - Intronic
1188597084 X:31914724-31914746 GAGGCTGGGAAGGATAGTGGAGG + Intronic
1188784236 X:34324477-34324499 GAAGGTTGGAAGGAGGGTGAGGG + Intergenic
1188991431 X:36825376-36825398 GAGGCTGGGAAGGGTAATGGGGG + Intergenic
1190037338 X:47037940-47037962 GAGGGTGGGAAGGGTAGTGGGGG - Intronic
1190139566 X:47830806-47830828 GAGGCTGGGAAGGATAATGGGGG + Intergenic
1190320402 X:49176451-49176473 GAGGGTTGGAAGGAAGAACACGG + Intronic
1190406535 X:50093610-50093632 AGTGGTTGGAATGATGATGGTGG - Exonic
1190937782 X:55012307-55012329 GAGGGTGGGAAGGATGAAATTGG - Intronic
1192282743 X:69702284-69702306 GAGGGTTTGAAGGGGGAAGGGGG + Intronic
1192381114 X:70617673-70617695 AAGGATGGGAAGGATGGTGGAGG + Intronic
1193430728 X:81400884-81400906 GAGGCTGGGAAGGGTAATGGGGG - Intergenic
1194398071 X:93411380-93411402 GAGGGGTGGAAGGGTGGTGTAGG - Intergenic
1194411353 X:93562415-93562437 GAGGCTGGGAAGTATGATAGGGG + Intergenic
1195911601 X:109893788-109893810 GAGGCTGGGAAGGATAGTGGGGG - Intergenic
1196170080 X:112577781-112577803 GAGGCTGGGAAGGGTAATGGGGG - Intergenic
1196198552 X:112860188-112860210 GAGGGAGGGAGGGCTGATGGTGG - Intergenic
1196481326 X:116153236-116153258 GAGGCTTGGCAGGGTAATGGTGG + Intergenic
1197137686 X:123082205-123082227 GAGGTTTGCAAGAAGGATGGAGG - Intergenic
1197354859 X:125425895-125425917 GAGGCTGGGAAGGATGGTGGGGG + Intergenic
1198255849 X:134923921-134923943 GTGGGTTGGAAGGCTGAGGCAGG - Intergenic
1198297361 X:135300872-135300894 GAGGGAGGGAAGGATGAGGCAGG + Intronic
1198558642 X:137824430-137824452 GAGGGTTGGGTGGATGATTTTGG + Intergenic
1198686016 X:139228883-139228905 GGGGGATGGAATGAAGATGGAGG + Intergenic
1199367862 X:147008187-147008209 GAGGCTAGGAAGGATAATGGGGG - Intergenic
1199895002 X:152119527-152119549 CAGGGTTGGCAGGGTGCTGGGGG + Intergenic
1201011262 Y:9549527-9549549 GGGTGGTGGAAGGAAGATGGTGG + Intergenic
1201489833 Y:14528075-14528097 CAGGAGTGGAAGGTTGATGGTGG + Intronic
1201575380 Y:15456481-15456503 AAGGGTGTGAAGGAGGATGGAGG + Intergenic
1202116053 Y:21469580-21469602 GGGTGGTGGAAGGAAGATGGTGG + Intergenic