ID: 905666742

View in Genome Browser
Species Human (GRCh38)
Location 1:39767550-39767572
Sequence CAGGACTCCCTGGCTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 2, 1: 1, 2: 12, 3: 157, 4: 469}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905666734_905666742 12 Left 905666734 1:39767515-39767537 CCATCAGCTCTGCTTCTTACCCA 0: 2
1: 0
2: 3
3: 26
4: 320
Right 905666742 1:39767550-39767572 CAGGACTCCCTGGCTCCAGCTGG 0: 2
1: 1
2: 12
3: 157
4: 469
905666729_905666742 29 Left 905666729 1:39767498-39767520 CCCAGAGCCTCCCTTCTCCATCA 0: 2
1: 0
2: 3
3: 54
4: 372
Right 905666742 1:39767550-39767572 CAGGACTCCCTGGCTCCAGCTGG 0: 2
1: 1
2: 12
3: 157
4: 469
905666730_905666742 28 Left 905666730 1:39767499-39767521 CCAGAGCCTCCCTTCTCCATCAG 0: 2
1: 0
2: 2
3: 39
4: 411
Right 905666742 1:39767550-39767572 CAGGACTCCCTGGCTCCAGCTGG 0: 2
1: 1
2: 12
3: 157
4: 469
905666738_905666742 -8 Left 905666738 1:39767535-39767557 CCACCCATTCTTAGGCAGGACTC 0: 2
1: 0
2: 0
3: 6
4: 127
Right 905666742 1:39767550-39767572 CAGGACTCCCTGGCTCCAGCTGG 0: 2
1: 1
2: 12
3: 157
4: 469
905666733_905666742 18 Left 905666733 1:39767509-39767531 CCTTCTCCATCAGCTCTGCTTCT 0: 2
1: 2
2: 1
3: 66
4: 618
Right 905666742 1:39767550-39767572 CAGGACTCCCTGGCTCCAGCTGG 0: 2
1: 1
2: 12
3: 157
4: 469
905666731_905666742 22 Left 905666731 1:39767505-39767527 CCTCCCTTCTCCATCAGCTCTGC 0: 2
1: 1
2: 4
3: 59
4: 545
Right 905666742 1:39767550-39767572 CAGGACTCCCTGGCTCCAGCTGG 0: 2
1: 1
2: 12
3: 157
4: 469
905666737_905666742 -7 Left 905666737 1:39767534-39767556 CCCACCCATTCTTAGGCAGGACT 0: 2
1: 0
2: 0
3: 6
4: 98
Right 905666742 1:39767550-39767572 CAGGACTCCCTGGCTCCAGCTGG 0: 2
1: 1
2: 12
3: 157
4: 469
905666732_905666742 19 Left 905666732 1:39767508-39767530 CCCTTCTCCATCAGCTCTGCTTC 0: 2
1: 0
2: 2
3: 43
4: 488
Right 905666742 1:39767550-39767572 CAGGACTCCCTGGCTCCAGCTGG 0: 2
1: 1
2: 12
3: 157
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905666742 Original CRISPR CAGGACTCCCTGGCTCCAGC TGG Intronic
900363003 1:2298970-2298992 CAGGGCTCACAGGCACCAGCAGG - Intronic
900590863 1:3459230-3459252 CAGAGCTCCCAGGCTCCAGCAGG + Intronic
900637047 1:3671160-3671182 CAGGGTTCCAGGGCTCCAGCTGG + Intronic
900898229 1:5498607-5498629 CAGGACTCCCTGAATCCTGGTGG + Intergenic
901019934 1:6250388-6250410 CAGGACACCCTGTCACCCGCAGG + Intronic
901183244 1:7356133-7356155 GAGGTGTCCCTGGCTTCAGCAGG + Intronic
901746444 1:11376889-11376911 CAGGACTCGCTGGCTCACTCGGG + Intergenic
901892332 1:12277752-12277774 CAGGACTCCCCGGCTTCCGAGGG - Exonic
902030332 1:13417378-13417400 CTGGACTTCCTGGCTCCAGTGGG - Intronic
902243294 1:15102699-15102721 CAGGCCTCCCTGGGTCCCACAGG - Intronic
902373092 1:16017483-16017505 CAGCCCTCCAGGGCTCCAGCTGG + Intronic
903330479 1:22594589-22594611 CAGGAGACCCTGACTCCGGCTGG - Intronic
903423913 1:23238853-23238875 CTGGAGTCCCTGGCTCCAATAGG + Intergenic
903558031 1:24207223-24207245 CAGGACTCCCTCGTTCCGGTAGG - Intergenic
904629777 1:31832127-31832149 AAGGAATCACTCGCTCCAGCCGG - Intergenic
904905937 1:33897212-33897234 CAGCAGCACCTGGCTCCAGCAGG - Intronic
905631018 1:39518626-39518648 CAGGACTCCCTGGCTCCAGCTGG - Intronic
905666742 1:39767550-39767572 CAGGACTCCCTGGCTCCAGCTGG + Intronic
906766045 1:48435218-48435240 CTGGACTCCCTGGGTCAAGTGGG + Intronic
907643482 1:56216365-56216387 CAGGACTGCCTGTCTTCTGCTGG + Intergenic
908154357 1:61337230-61337252 CAGGAGTCCCTGATTCCAACAGG - Intronic
908163306 1:61433159-61433181 CAGTGCTCCCTGGCTCCAGTGGG + Intronic
908930553 1:69312335-69312357 CCAGTCTCCCCGGCTCCAGCAGG + Intergenic
909303073 1:74038118-74038140 CCAGACTCCCTGGCTCCATCAGG - Intronic
909697517 1:78484161-78484183 CCAGCCTCACTGGCTCCAGCAGG - Intronic
910459214 1:87430893-87430915 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
910518343 1:88088551-88088573 CCAGTCTCCCTGGCTCCAGCAGG + Intergenic
911379621 1:97096500-97096522 CTGGACTTCCTGGGTCCAGTGGG + Intronic
911508541 1:98784118-98784140 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
913347328 1:117821305-117821327 AAGGACTTCCAGGCTCAAGCAGG - Intergenic
913445196 1:118943708-118943730 CAGGAAGCCCTGACTCCAGATGG + Intronic
913541178 1:119822453-119822475 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
914446991 1:147758659-147758681 CAGGAGTCCCTGTCCCCACCCGG - Exonic
915100588 1:153496052-153496074 CAGGGCAGCCTGGCCCCAGCAGG - Intergenic
916231496 1:162545313-162545335 CTGGAGTCTCTGACTCCAGCTGG + Intergenic
916849029 1:168684027-168684049 CTAGCCACCCTGGCTCCAGCAGG + Intergenic
917024883 1:170631191-170631213 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
917059128 1:171017706-171017728 CCAGTCTCACTGGCTCCAGCAGG - Intronic
917060576 1:171033112-171033134 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
917079057 1:171237653-171237675 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
917538174 1:175889500-175889522 CAGCATTGCATGGCTCCAGCAGG - Intergenic
917582383 1:176391919-176391941 ACAGCCTCCCTGGCTCCAGCAGG + Intergenic
918142454 1:181731076-181731098 GAGGACTCCCTGTCTCCCTCTGG + Intronic
918168718 1:181975116-181975138 CCAGCCTTCCTGGCTCCAGCAGG - Intergenic
918802268 1:188986824-188986846 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
918842554 1:189560930-189560952 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
918939959 1:190980636-190980658 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
918943161 1:191027174-191027196 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
918955228 1:191199019-191199041 CTAGCCTCCCCGGCTCCAGCAGG - Intergenic
919031825 1:192251989-192252011 CCAGCCTCCCTGGCTGCAGCAGG + Intergenic
919506460 1:198404684-198404706 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
919586636 1:199447968-199447990 CCAGCCCCCCTGGCTCCAGCAGG + Intergenic
921011714 1:211148331-211148353 CTGGACTCTCTGGCTATAGCTGG - Intergenic
922802409 1:228370446-228370468 CAGTTCTCCCTGCCTCCTGCTGG - Intronic
923055247 1:230421785-230421807 CAGGATTCTGTGGCTCCAGGAGG - Intronic
923207233 1:231771006-231771028 CAGGACACCCTGGCCTCAGCCGG + Exonic
924234940 1:241992815-241992837 CAGGCATCTCTGGATCCAGCTGG - Intergenic
924412319 1:243819301-243819323 CCAGTCTCCCTGGCACCAGCAGG - Intronic
1063974533 10:11404827-11404849 CAAGACTCCCTGGTACCAGTGGG - Intergenic
1064601851 10:17001550-17001572 CTGGACTTCCTGGGTCCAGTGGG - Intronic
1065845157 10:29737104-29737126 CAGGGCTCCCTGGCTCTCACCGG + Intergenic
1067059300 10:43069759-43069781 CAGGACTTCCTTCCTACAGCAGG - Intergenic
1067087559 10:43250900-43250922 CAGGTGTCTCTGGCTTCAGCAGG - Intronic
1067096838 10:43307189-43307211 CTGGACTTTCTGGGTCCAGCAGG - Intergenic
1067539321 10:47140296-47140318 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
1068484890 10:57645117-57645139 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1068987296 10:63119029-63119051 CAGGAATCCCTCTCTCTAGCAGG + Intergenic
1069678960 10:70270259-70270281 CAGCACTGCCTGCCTGCAGCAGG - Intronic
1069939512 10:71944879-71944901 CAGGACTGGATGGCTCCAGCTGG + Intergenic
1071059050 10:81548425-81548447 CCAGCCTCTCTGGCTCCAGCAGG - Intergenic
1072922393 10:99587463-99587485 CAGGACTCAGTGGCTTCATCAGG - Intergenic
1073065801 10:100758581-100758603 AAAGACTCCCAGGCCCCAGCAGG + Intronic
1073347971 10:102798920-102798942 CAAGACTCCCTTTCTCCAGAAGG - Intronic
1074003340 10:109393770-109393792 CCACCCTCCCTGGCTCCAGCAGG - Intergenic
1074412395 10:113239682-113239704 CAGGACTCCCTGTCTCAGGATGG - Intergenic
1075104041 10:119525395-119525417 CATGACTTACTGGCTCCTGCAGG + Intronic
1075172387 10:120127821-120127843 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1075271876 10:121059486-121059508 AGAGTCTCCCTGGCTCCAGCAGG - Intergenic
1075687377 10:124373707-124373729 CAGAACCCCCTGTCCCCAGCTGG - Intergenic
1075691429 10:124397886-124397908 CAGGACCACCTGTCTCCAGCTGG + Exonic
1076505297 10:130968714-130968736 CACCAGTCCCTGGCCCCAGCAGG - Intergenic
1076607769 10:131700622-131700644 CAGGACTGCCTGGGTGCAACTGG - Intergenic
1076852883 10:133101695-133101717 CAGGCCTCCCTGTCTCCACCAGG + Intronic
1077045163 11:541442-541464 CAGGACTCTGGGGCTCCCGCTGG - Intronic
1077250728 11:1559532-1559554 AATGCCTCCCTGCCTCCAGCTGG + Intronic
1077327710 11:1970906-1970928 CAGGACTCCCAGGCTCCATCAGG - Intronic
1078691224 11:13582612-13582634 CCAGTCTCCCAGGCTCCAGCAGG - Intergenic
1079426042 11:20342980-20343002 CCTGCCTCCCTGGCTCCAGCGGG - Intergenic
1079690100 11:23406649-23406671 GGGGGCTCCCAGGCTCCAGCGGG - Intergenic
1079800268 11:24860100-24860122 TATGCCTCCCTGGCTCCAGCAGG - Intronic
1080692546 11:34570517-34570539 CTGGAGTCCCTGGGTCCAGCTGG - Intergenic
1081066953 11:38554779-38554801 CAGGAGACTCTGGATCCAGCTGG - Intergenic
1081336810 11:41876593-41876615 CAGGACTCTCAAGCTCCAGCAGG + Intergenic
1081585216 11:44379662-44379684 CAGGACTGCTGGGCGCCAGCTGG - Intergenic
1083322236 11:61854920-61854942 CAGGACCCCCTGGCTCCCGAGGG + Intronic
1084174739 11:67417404-67417426 CAGCTCTCCCTGGATCCATCGGG + Exonic
1084431238 11:69112519-69112541 GAGGCCTCCCTGGCTCCCTCAGG + Intergenic
1084698369 11:70769906-70769928 CAGCACACCCTGGGTCCTGCAGG + Intronic
1088004828 11:104927362-104927384 CCAGCCTCCCTGGCTCCAGCGGG - Intergenic
1088084463 11:105960476-105960498 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
1088697709 11:112382689-112382711 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1088983781 11:114887818-114887840 CATCAGTCCCTGGCTCCAACTGG + Intergenic
1089616934 11:119700090-119700112 CAGGACTCTATGTCTCCTGCTGG + Intronic
1089846751 11:121464759-121464781 CAGGCCTCCCTGTCCCCAGCTGG - Intronic
1090444266 11:126749805-126749827 CTGGACTTCCTAGCTTCAGCAGG - Intronic
1090734401 11:129598630-129598652 CCAGTCTCCCTGGCTCCAGCAGG - Intergenic
1090855207 11:130605038-130605060 GAGAACTCCCTGGCTGCAGGCGG + Intergenic
1202810692 11_KI270721v1_random:26086-26108 CAGGACTCCCAGGCTCCATCAGG - Intergenic
1092171286 12:6375384-6375406 CAGGACTGCAGGGCTCCAGGAGG + Intronic
1092628607 12:10354797-10354819 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1093303286 12:17479421-17479443 CCGGCCTCCCTGCCTCTAGCAGG - Intergenic
1093413684 12:18896069-18896091 CCAGCCTCCCTGGCTCCAGCCGG + Intergenic
1093420548 12:18969318-18969340 CAGGACTTGCTGGCTCAGGCTGG - Intergenic
1093522487 12:20067059-20067081 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1093808443 12:23464546-23464568 CCAGCCTCCCTGCCTCCAGCAGG - Intergenic
1094054549 12:26256005-26256027 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
1094219155 12:27974735-27974757 CAGGCCTCCCTTGCTGCAGTGGG - Intergenic
1094275317 12:28668716-28668738 CCAGCCTCCCTGGTTCCAGCAGG - Intergenic
1096454770 12:51775761-51775783 CAGGACTACCTGGCGTCAGGTGG + Intronic
1096476374 12:51911661-51911683 CAGGACTCACTGGCACCAGCAGG - Intronic
1097040698 12:56154330-56154352 TAAGAGTCCCTGCCTCCAGCAGG - Intronic
1097748943 12:63330900-63330922 TCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1099375926 12:81896412-81896434 CTGGACTCCCTGGGTCGAGTGGG + Intergenic
1099589998 12:84575130-84575152 CCAGTCTCCCTGGCACCAGCAGG - Intergenic
1099793278 12:87363509-87363531 CCAGCCTCCCTGGCTTCAGCAGG + Intergenic
1100028109 12:90153470-90153492 ACAGCCTCCCTGGCTCCAGCAGG - Intergenic
1100210499 12:92393767-92393789 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1100941078 12:99723310-99723332 CAAGCCTTCCTGGCTCCAGCAGG - Intronic
1101066530 12:101027517-101027539 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
1102097706 12:110253371-110253393 CAGGACACCCTGGCCCCAAAGGG + Intergenic
1102112332 12:110373916-110373938 CAGTCCTCCCTGGCTGGAGCAGG + Exonic
1102225829 12:111227681-111227703 CATCACTCCCTGCCCCCAGCTGG - Intronic
1103812627 12:123627877-123627899 CAGGACTCCTCAGCCCCAGCTGG + Intronic
1103926649 12:124427134-124427156 CCGGGCTCCCTGGGCCCAGCTGG - Intronic
1104648251 12:130512199-130512221 CAAGACTCCCTGGCACGAGCTGG - Intronic
1104733367 12:131121265-131121287 CAGGACTCCAAGGCTGCAGAGGG + Intronic
1105668480 13:22586680-22586702 CCAGTCTCCCTGGCTCCAGCAGG + Intergenic
1105705177 13:22963873-22963895 AAGGCCTCCCAGGCTCCTGCTGG - Intergenic
1108160387 13:47632624-47632646 CCAGCCTCCCTGGCTCCAACAGG - Intergenic
1108578765 13:51811218-51811240 GAGAACTCTCAGGCTCCAGCTGG + Intergenic
1108957775 13:56182694-56182716 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1109419782 13:62096360-62096382 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
1110790509 13:79582022-79582044 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1111729284 13:92052712-92052734 CTGGACTTCCTGGCTCAAGTGGG - Intronic
1112793303 13:103027832-103027854 AAGGCCTCCCAGGCTCCAGCTGG + Intergenic
1113030656 13:105990482-105990504 TAGCACTCCCTGGCTCCAGATGG + Intergenic
1113556710 13:111241408-111241430 CCTGGCTCCCTGACTCCAGCTGG - Intronic
1114575337 14:23707677-23707699 CTGGACTTCCTGGGTCAAGCGGG - Intergenic
1114705958 14:24726824-24726846 CTAGCCTCCCTGGCTCCAGCAGG - Intergenic
1115928851 14:38467817-38467839 CCAGCCTCCCTGACTCCAGCAGG + Intergenic
1118478885 14:66143967-66143989 CCAGCCTCCCTGGCTCCAACAGG - Intergenic
1118530669 14:66701950-66701972 CCAGCCTCCCTGGCTCCAGGAGG - Intronic
1119853195 14:77880735-77880757 CAGGAAGCACTGTCTCCAGCAGG + Intronic
1120365346 14:83561555-83561577 CCAACCTCCCTGGCTCCAGCAGG - Intergenic
1121011017 14:90520418-90520440 CCAGACTCCTGGGCTCCAGCAGG + Intergenic
1121644787 14:95510380-95510402 CAGGACTGCTTGGCTTCAGATGG - Intergenic
1121905708 14:97741104-97741126 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1122144929 14:99683661-99683683 CAGGCGTCCCTGGGTCCCGCAGG + Intergenic
1122177861 14:99934457-99934479 CAGGCCACCCTGGGTCCTGCAGG + Intronic
1122272860 14:100576148-100576170 CAGAGCTGCCTGGCCCCAGCTGG + Intronic
1122960477 14:105091754-105091776 CAGGAATCCGTGGCCCCAGGGGG - Intergenic
1124224780 15:27883627-27883649 CAGGGCTGCCTGCCTTCAGCCGG + Intronic
1126215092 15:46145830-46145852 CATGCCTCCCTGACTGCAGCTGG - Intergenic
1126284600 15:46996648-46996670 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1126553007 15:49953546-49953568 TCAGCCTCCCTGGCTCCAGCAGG + Intronic
1127525869 15:59791745-59791767 CAGGACACCCTGGCTGCAGAAGG - Intergenic
1127687720 15:61364954-61364976 CTAGCCTCCCTGGCTCCAGCAGG + Intergenic
1128306901 15:66604622-66604644 CAGGGCTTCCTGGCTGCAGCGGG + Intronic
1128541388 15:68536908-68536930 CATCACTTCCTGGCTCCAGGTGG - Intergenic
1128563769 15:68685611-68685633 CAGGAGGCCCAGGCCCCAGCAGG + Intronic
1129268804 15:74408938-74408960 CAGGACTCCCTGCCTTCAAGGGG - Intergenic
1129492650 15:75944131-75944153 CAGGACTTGCTGGCTACAGAGGG - Intronic
1129601962 15:77004362-77004384 CTGGTCTCCAGGGCTCCAGCTGG - Intronic
1130176562 15:81577472-81577494 AAGGACTCTATGTCTCCAGCTGG + Intergenic
1130316919 15:82803820-82803842 CAGGACTCTCTGAATCCAGAGGG - Intronic
1131411911 15:92214386-92214408 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1132033456 15:98458327-98458349 CAAGTCTACCAGGCTCCAGCTGG - Intronic
1132039575 15:98513580-98513602 CAGGACTCCCGGGCTCCTCCAGG - Intronic
1132525213 16:410884-410906 CAGGTCTCGCTGCCTGCAGCTGG - Intronic
1133221750 16:4321910-4321932 CGGGACAGCCTGCCTCCAGCGGG + Intronic
1133408882 16:5551459-5551481 CGGAACTCCCTGGCTGCAGCAGG - Intergenic
1134081140 16:11325946-11325968 CAGGACACCCGGCCCCCAGCTGG + Intronic
1134634249 16:15780013-15780035 CGGCTCTCCCTGGCTCCATCTGG - Intronic
1135208311 16:20500880-20500902 GAGGATTCCCAGGCTCCAACCGG + Intergenic
1135210588 16:20522820-20522842 GAGGATTCCCAGGCTCCAACCGG - Intergenic
1135243351 16:20830747-20830769 CAGGCATCTCTGGTTCCAGCTGG + Intronic
1135510924 16:23082324-23082346 CAGGACTCACTGGATCAAACAGG + Intronic
1136284353 16:29232441-29232463 GAGGACACCCTGGACCCAGCAGG - Intergenic
1136643530 16:31588859-31588881 CTAGTCTCCCTGGCACCAGCAGG + Intergenic
1136655546 16:31707026-31707048 CAGGCCCACCTGGCTCCTGCTGG + Intergenic
1137522539 16:49207101-49207123 AGGGTCTCTCTGGCTCCAGCTGG - Intergenic
1139354597 16:66360079-66360101 CAGGAAGCCCTGGCTTCCGCTGG + Intergenic
1139390779 16:66605298-66605320 CGGGACTCCCGGGCCGCAGCGGG + Intronic
1141651157 16:85393896-85393918 CAGGACTGCCGGGCGCAAGCTGG - Intergenic
1141749762 16:85950495-85950517 GAGGACTCCCTGGGTCCCTCAGG + Intergenic
1142089386 16:88201953-88201975 GAGGACACCCTGGACCCAGCAGG - Intergenic
1142222932 16:88864299-88864321 GAGGACACCCAGGCTCCAGGGGG - Exonic
1142321483 16:89385964-89385986 CAGAACTCCCTGGCTCAAGCCGG + Intronic
1143010150 17:3861799-3861821 CAGGCCTGCCCGGCCCCAGCGGG + Intronic
1143134556 17:4704229-4704251 CTGGACTCGCGGGCTCAAGCTGG + Exonic
1143355708 17:6326448-6326470 CAGGACTCACTGTCTACAGCGGG + Intergenic
1146018176 17:29250060-29250082 CAGGCATCCCAGGCTACAGCTGG + Intronic
1147253655 17:39168510-39168532 CTGGACTTCCTGGGTCGAGCGGG + Intergenic
1147912552 17:43864667-43864689 CAGGAAGCCCCGGCTCCAGTAGG - Intergenic
1148493425 17:48037677-48037699 GAGGGCTCCCCGGCTCGAGCAGG + Exonic
1148675192 17:49440796-49440818 CAGGACTTCCTGAGTCCAGATGG - Intronic
1148749809 17:49939019-49939041 CTGCCCTCCCCGGCTCCAGCAGG + Intergenic
1149229715 17:54518981-54519003 CCAGACTCCCTAGCTCCAGCAGG + Intergenic
1149242176 17:54663336-54663358 CCAGCCTCCCTGGCTCCTGCAGG + Intergenic
1149377955 17:56064569-56064591 CCAGGCCCCCTGGCTCCAGCAGG + Intergenic
1149518835 17:57303014-57303036 AAGGACCACCAGGCTCCAGCTGG + Intronic
1149676065 17:58463021-58463043 CAGGAGTAAGTGGCTCCAGCTGG + Exonic
1151185846 17:72363461-72363483 CAGGTCTCCAGGGCTGCAGCCGG - Intergenic
1151589518 17:75034227-75034249 CAGGACACCCCAGCTCCACCTGG + Intronic
1151785400 17:76272634-76272656 CACCCCTCCCAGGCTCCAGCTGG - Intergenic
1151944397 17:77311567-77311589 CAGGAGTGCCTGGCTCCACCTGG + Intronic
1152282364 17:79392513-79392535 CAGCTCCCCGTGGCTCCAGCAGG - Intronic
1152604202 17:81280897-81280919 GGGGTCTCCCTGCCTCCAGCTGG - Intronic
1152900323 17:82937424-82937446 CAGGAGTCCACGGCTCCAGGCGG + Intronic
1153448056 18:5196293-5196315 CTGGCCTCCCTTGCTCCAGTGGG + Intronic
1153460279 18:5325364-5325386 CTGGACTCTCTGGAGCCAGCAGG - Intergenic
1153482832 18:5564771-5564793 CTGGACTCCCTGCCACCAACAGG + Intronic
1153991314 18:10403297-10403319 AAGGACTCTCTGGCCCCACCTGG + Intergenic
1155209226 18:23586552-23586574 CGGGACTCCCTGGCCCGGGCTGG + Exonic
1155762880 18:29588827-29588849 CCAGTTTCCCTGGCTCCAGCAGG - Intergenic
1155847787 18:30731232-30731254 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1156507783 18:37609433-37609455 CAGGCCTCACAGGCTGCAGCTGG + Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157444012 18:47731367-47731389 CAGGCCTTCCTGGTTACAGCAGG + Intergenic
1157584174 18:48790759-48790781 CAGGCGCCCGTGGCTCCAGCCGG - Intronic
1158198020 18:54910116-54910138 CAGGACACCCTGGCTGCAGAAGG - Intronic
1159161588 18:64648766-64648788 CTGGACTTCCTGGGTCCAGTAGG - Intergenic
1160358172 18:78246342-78246364 CAGGACTCCCAGCCTCCAGCTGG - Intergenic
1160404014 18:78632122-78632144 CAGGCCTCCCTGGGACCTGCTGG + Intergenic
1160750830 19:733632-733654 CAGGCCACCCTGAATCCAGCCGG - Intronic
1160764439 19:801148-801170 CAGGACTTCCAGTCTGCAGCTGG - Intronic
1160774055 19:846669-846691 CAGGACTCCAGGTATCCAGCGGG + Intronic
1160898092 19:1412228-1412250 CTGGACTCCCTCTCCCCAGCAGG - Intronic
1161519118 19:4713801-4713823 CAGGATGCCGTGGCTCAAGCCGG - Intronic
1161560824 19:4971617-4971639 GAGGAGTCCCTGGCTCCTGTGGG + Intronic
1161572964 19:5040330-5040352 GAGGGCTCCCTGGCTCCACACGG + Intronic
1161598558 19:5165746-5165768 CTGGACTTCCTGGGTCGAGCGGG - Intronic
1162341159 19:10092184-10092206 GAGGCCACCCTGGCTCAAGCAGG - Exonic
1163430156 19:17262638-17262660 GAGGAATGCCTGGCTCCGGCTGG - Exonic
1163872150 19:19830989-19831011 CCAGCCTCCCTGGCTCTAGCAGG - Intergenic
1163886145 19:19966426-19966448 CCAGCCTCCCTGGCTCTAGCAGG + Intergenic
1163888323 19:19989052-19989074 CCAGCCTCCCTGGCTCTAGCAGG - Intergenic
1163966013 19:20748160-20748182 CAGGACTGGATGGCTCCCGCTGG - Intronic
1164163873 19:22650756-22650778 CCAGCATCCCTGGCTCCAGCAGG + Intronic
1164992404 19:32693817-32693839 CTGGACTTCCTGGGTCCAGTGGG - Intronic
1165014567 19:32871152-32871174 CAGGGCTGTCTGGCCCCAGCGGG - Intergenic
1167597525 19:50435403-50435425 CGGGGCTCCCTGGCACCCGCAGG + Intronic
1167760845 19:51447897-51447919 CCGGACTTCCTGGGTCCAGTAGG - Intergenic
1168242746 19:55095546-55095568 CAGAACTCCCTGTCTTCAGGAGG + Exonic
1168690416 19:58373323-58373345 CTTGAGTCCCAGGCTCCAGCTGG - Intronic
925259460 2:2517209-2517231 CAGCCCCTCCTGGCTCCAGCTGG - Intergenic
925617137 2:5754293-5754315 AAGGACGACCTGGCTCCAGGGGG + Intergenic
926228228 2:10983495-10983517 CAGGACCAGATGGCTCCAGCTGG - Intergenic
928442542 2:31304080-31304102 GAGGCCTCCCAGGCCCCAGCAGG - Intergenic
928757587 2:34545507-34545529 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
928784342 2:34864217-34864239 AAATACTCCCTGGCTCCACCTGG + Intergenic
929370909 2:41222929-41222951 TCAGCCTCCCTGGCTCCAGCAGG - Intergenic
929804398 2:45132134-45132156 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
930090096 2:47525679-47525701 TAGGGCCCCCTTGCTCCAGCAGG - Intronic
930545762 2:52765803-52765825 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
931286396 2:60835517-60835539 CAGGACTGCCTGGCTCCAGTAGG - Intergenic
931301402 2:60982157-60982179 CAGGACTGCCTGACTCCAGCAGG + Intronic
931804222 2:65788866-65788888 CTGGTCTCCCTGGCTCCTGCTGG - Intergenic
932013459 2:68000758-68000780 ATAGCCTCCCTGGCTCCAGCAGG - Intergenic
932335213 2:70927269-70927291 CAGGACTCCCCTCCTGCAGCTGG + Intronic
932448451 2:71794799-71794821 CAGGCCTGCCTGGCTCCATGGGG - Intergenic
932812078 2:74834151-74834173 CAGGAGTCCCGGGCTGCCGCTGG + Exonic
932826724 2:74948013-74948035 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
932861985 2:75303988-75304010 CTGGAGTCCCAGGCTCTAGCAGG - Intergenic
933237594 2:79882548-79882570 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
933537884 2:83599908-83599930 CAGGACTTCCTGGGTCTAGTGGG - Intergenic
933602554 2:84347881-84347903 CCAGCCTCCCTGGCTCTAGCAGG + Intergenic
934605321 2:95690776-95690798 CAGGACCCTCTGCCTCCTGCAGG + Intergenic
935789443 2:106577551-106577573 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
936538778 2:113333329-113333351 CAGGACCCTCTGCCTCCTGCAGG + Intergenic
936849096 2:116874051-116874073 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
936897935 2:117449781-117449803 AAGGACTCTCTGGCTCCAATTGG - Intergenic
937257995 2:120568320-120568342 CTGGCCACCCTGGCTCCTGCAGG + Intergenic
937347263 2:121133694-121133716 CCAGAGCCCCTGGCTCCAGCTGG + Intergenic
937467361 2:122146155-122146177 CACCACTCCCTGGCCCCAGCTGG + Intergenic
937931496 2:127208661-127208683 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
938121812 2:128639340-128639362 CAGGACTCGCTGGCTCCTGCAGG + Intergenic
938136835 2:128765939-128765961 TCAGCCTCCCTGGCTCCAGCAGG + Intergenic
938137493 2:128770936-128770958 CAGGAGCCCCTGAATCCAGCTGG - Intergenic
938405693 2:131031988-131032010 GAGGACGGCCTGGCTCCTGCTGG + Intronic
939808942 2:146808137-146808159 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
939852660 2:147319435-147319457 CCAGACTCCCTGGATCCAGCAGG + Intergenic
940131603 2:150388446-150388468 AAGCACTCCCAGACTCCAGCTGG - Intergenic
940167668 2:150793013-150793035 CCAGACTCCCTGGCTCCAGCAGG - Intergenic
940273398 2:151915312-151915334 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
940410720 2:153360525-153360547 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
941088566 2:161147165-161147187 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
941694384 2:168535053-168535075 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
942376105 2:175339639-175339661 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
942981536 2:182089159-182089181 CAGAATTGTCTGGCTCCAGCTGG - Intronic
943216531 2:185044398-185044420 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
943608573 2:190005462-190005484 CTGGACTTCCTGGGTCCAGTGGG - Intronic
945024352 2:205606083-205606105 CTAGTCTCCCTGGCGCCAGCAGG + Intronic
947741920 2:232488503-232488525 CAGCCTTCCCTGGCTCCAGCAGG - Intergenic
948694414 2:239725969-239725991 GAGGATTCCCTGGAGCCAGCTGG - Intergenic
948717839 2:239876773-239876795 CAGGACTCCCTGGGTTGAGAAGG + Intergenic
948742017 2:240054366-240054388 CTGGAATCCCTGGCTGCTGCAGG + Intergenic
948897166 2:240932927-240932949 CAGGACTCCCTGTCTCCCTGAGG + Intronic
1168794145 20:600048-600070 TAGGACTACCTGACTCCAGGAGG + Intergenic
1168933540 20:1644400-1644422 CTAGCCTCCCTGGCTCCAGCAGG + Intronic
1169789432 20:9393502-9393524 CAGGCCTCCCAGGCTCCTCCTGG + Intronic
1169980590 20:11379820-11379842 CCAGCCTCTCTGGCTCCAGCAGG - Intergenic
1170465338 20:16617878-16617900 CAGGTCTCCTTGTCTCCAGGTGG - Intergenic
1170496592 20:16930943-16930965 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1170568082 20:17617761-17617783 CCGGACTCACTGGCTGCTGCAGG + Intronic
1170945211 20:20885293-20885315 CTGGCATCCCTGGCTCCAGAAGG - Intergenic
1171043430 20:21788324-21788346 CTGGTCTCCATGGCTGCAGCTGG + Intergenic
1171180839 20:23089172-23089194 AAGGACTGCATGGCTCCTGCCGG + Intergenic
1171189847 20:23151132-23151154 CTGTCCTCCCTGGCCCCAGCAGG - Intergenic
1171990667 20:31694090-31694112 TGGGAGTTCCTGGCTCCAGCTGG + Intronic
1173091326 20:39974964-39974986 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1173292638 20:41728060-41728082 CTGGACTTCCTGGGCCCAGCAGG - Intergenic
1173826573 20:46051620-46051642 CAGGCCTCCCTGGCCCTGGCTGG - Intronic
1174619489 20:51863197-51863219 CATGACTCCCGGGCTGCAGAAGG + Intergenic
1175897537 20:62346020-62346042 CAGGGCTCCCGGAGTCCAGCAGG + Intronic
1177133384 21:17283719-17283741 CAGGACTGCCTGGCTCCTGAAGG + Intergenic
1177134735 21:17296948-17296970 CTGGACTTCCTGGGTCCAGCGGG + Intergenic
1177332888 21:19684236-19684258 CCAGCTTCCCTGGCTCCAGCAGG + Intergenic
1177498984 21:21925872-21925894 CAGAACTCTCTGGCCCCTGCCGG - Intergenic
1177511388 21:22091876-22091898 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1177878945 21:26669424-26669446 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1179466860 21:41581617-41581639 TGGGACTCCCTGGCTCCTGGTGG - Intergenic
1179567085 21:42255990-42256012 AGGGGCTCCCTGGCTCCAGCTGG - Intronic
1179576358 21:42310728-42310750 CAGGCCACCCTGCCACCAGCTGG - Intergenic
1179709572 21:43205523-43205545 CTGGAGTTCCAGGCTCCAGCTGG + Intergenic
1179801324 21:43812751-43812773 CAGGGCTCCCTGGCTGAAGTGGG + Intergenic
1179883251 21:44302135-44302157 CAGCGCTTCCTGGCTGCAGCTGG + Intronic
1180070368 21:45432833-45432855 CAGGCCTCCCTCGGTACAGCCGG + Intronic
1180877102 22:19179620-19179642 GAGGAAGGCCTGGCTCCAGCAGG + Exonic
1181099710 22:20531127-20531149 CAGGCCTCCCTGGCCTTAGCAGG + Intronic
1181109079 22:20590988-20591010 CAGGACTCTCGGGGTTCAGCAGG - Intergenic
1181363007 22:22353235-22353257 GAGGACTCCCTGGCTTCTGCTGG - Intergenic
1181365818 22:22376307-22376329 GAGGACTCCCTGGCTTCTGCTGG - Intergenic
1181372253 22:22427837-22427859 GAGGGCTCCCTGGCTTCTGCTGG - Intergenic
1181993980 22:26860312-26860334 CTGGACTTCCTGGCTCGAGTAGG + Intergenic
1182938945 22:34255279-34255301 CCAGTCTCCCTGGCTCCAGCAGG + Intergenic
1183423112 22:37723690-37723712 CAGGACACCCTGTGTCCAGCAGG + Exonic
1184162073 22:42702813-42702835 CAGGACCGCCTGACTCCACCAGG - Intronic
1184643915 22:45885927-45885949 CAGGACTCCACGGCCCCTGCTGG - Intergenic
1184735184 22:46393858-46393880 CAGGAATCCCTGCCTCCTCCCGG - Intronic
1184830048 22:46979617-46979639 CAGGACGCCCTGGATACGGCAGG - Intronic
1185402927 22:50627808-50627830 GAGGGCTACTTGGCTCCAGCAGG + Exonic
949119954 3:373458-373480 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
950101249 3:10358325-10358347 CAGGAGATCCTGGCTCCTGCAGG + Intronic
950107034 3:10394816-10394838 CAGCAAGGCCTGGCTCCAGCAGG - Intronic
950701992 3:14757289-14757311 CAGAGCCCCCTGGCTCCTGCTGG - Intronic
950852613 3:16077156-16077178 CTGGACTTCCTGGGTCGAGCAGG + Intergenic
951067496 3:18284012-18284034 CAGGATTCCCTGGCTAGAGAGGG + Intronic
951427137 3:22560556-22560578 CAGGACTTACTGGCTACAGGAGG + Intergenic
952503798 3:33989295-33989317 CCAGCTTCCCTGGCTCCAGCAGG + Intergenic
952527347 3:34224413-34224435 CAGGAATGCTTTGCTCCAGCAGG + Intergenic
952634001 3:35505405-35505427 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
953622348 3:44544015-44544037 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
954576880 3:51681171-51681193 CAGGGCTCCCAGGATCCAGGAGG - Intronic
954755354 3:52836216-52836238 CCTGACACCCTGGCTCCAGGAGG + Intronic
955528843 3:59851087-59851109 CAGGACTCAATGGCTCCTCCTGG + Intronic
955832134 3:63015700-63015722 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
957291333 3:78281587-78281609 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
957394729 3:79622490-79622512 CCAGCCTTCCTGGCTCCAGCAGG - Intronic
957434140 3:80152109-80152131 CCAGGCTCCCTGGCTCCAGCAGG + Intergenic
957630094 3:82707237-82707259 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
958021070 3:87996308-87996330 CAGGACTCTCTGGGTACAGAGGG - Intergenic
959006667 3:101027361-101027383 ATGCACTCCCAGGCTCCAGCAGG - Intergenic
959031102 3:101300238-101300260 CCAGCCTCCCTGGCTCCAGCAGG + Intronic
959050599 3:101521210-101521232 GTGGACTCCCTTGCTACAGCAGG - Intergenic
959452700 3:106523169-106523191 CCAGTCTCCCTGGCTCCAGCAGG - Intergenic
959553180 3:107687464-107687486 CAGGACAGCCTGGCCCCTGCTGG + Intronic
959896953 3:111616736-111616758 CAGGCCTCCCTCACTACAGCTGG - Intronic
960233434 3:115254930-115254952 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
960477267 3:118144975-118144997 CCAGCTTCCCTGGCTCCAGCAGG + Intergenic
960669843 3:120145363-120145385 CAGGAATCCCTGGAGCCACCTGG - Intergenic
961479925 3:127173051-127173073 CAGGCCTCCCCCACTCCAGCAGG - Intergenic
961522777 3:127476840-127476862 GAGGGCTCCTTGGATCCAGCAGG + Intergenic
961616133 3:128182711-128182733 GAGGACACCCAGGTTCCAGCAGG - Intronic
961622997 3:128239448-128239470 GAGGAATCCCAGGCTCCAGGAGG + Intronic
961641052 3:128365045-128365067 CAGGACTCTGGGGTTCCAGCTGG + Intronic
961651122 3:128417161-128417183 CAGGATTCTCCGGCTGCAGCCGG - Intergenic
962691926 3:137907608-137907630 CCACCCTCCCTGGCTCCAGCAGG - Intergenic
963461256 3:145617322-145617344 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
964007776 3:151852118-151852140 CAGCCCTCCCTGGCTCCACCAGG + Intergenic
964831206 3:160886013-160886035 CCAGCCTCACTGGCTCCAGCAGG - Intronic
964866199 3:161264592-161264614 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
965263324 3:166510758-166510780 CCAGCCTCCCTGACTCCAGCAGG - Intergenic
966539642 3:181075197-181075219 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
966702647 3:182872439-182872461 CAGGACTGCCTTGCAGCAGCGGG + Exonic
967110442 3:186288725-186288747 GAGGCCTCCCCGTCTCCAGCAGG + Exonic
967734270 3:192935655-192935677 GAGGACTCCTTGGATCCTGCAGG + Intergenic
968229104 3:196994179-196994201 CAGGCCCCCCAGACTCCAGCAGG - Intronic
968503281 4:960934-960956 CAGTGCTCCCTGGCCGCAGCCGG + Intronic
968648350 4:1750710-1750732 CAGGACTGCCTGGCACCAAGCGG - Intergenic
970343407 4:15130250-15130272 CAGGAGACCCTGTCTCCAGCTGG - Intergenic
970494287 4:16609510-16609532 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
970952749 4:21775790-21775812 TCAGCCTCCCTGGCTCCAGCAGG + Intronic
971302148 4:25450735-25450757 CAGGTCTCCCTGGCTCCACTAGG + Intergenic
971356227 4:25897497-25897519 CAGGACTCTCTGGCTGCAGGGGG + Intronic
971574233 4:28253804-28253826 CCAGTCTCCCTGGCACCAGCTGG - Intergenic
971853162 4:32010347-32010369 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
972249769 4:37287450-37287472 CCAGTCTCCCTGGCTCCAGCAGG - Intronic
973584659 4:52377863-52377885 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
974340070 4:60603672-60603694 CTGGACTCCCTGGAGCCGGCAGG + Intergenic
974741626 4:66014344-66014366 CCAGTCTCCCTGGCTCCAGCAGG + Intergenic
974885219 4:67809676-67809698 CCAGCCGCCCTGGCTCCAGCAGG - Intergenic
975410000 4:74038560-74038582 CAGCAATCCCCGGCTCCTGCGGG - Exonic
975415388 4:74099069-74099091 CAGCAATCCCCGGCTCCTGCGGG - Exonic
976466039 4:85369883-85369905 CAGGACTCCCAGTGCCCAGCAGG + Intergenic
976538221 4:86242683-86242705 CCAGCCTCCCTGGCTCTAGCAGG + Intronic
977509024 4:97938224-97938246 CCAGTCTCCCTGGCACCAGCAGG + Intronic
977657272 4:99536557-99536579 CTGCACTCCCTGGAGCCAGCAGG + Intronic
978206142 4:106083242-106083264 CCAGCCTCCCTTGCTCCAGCAGG - Intronic
978656813 4:111074849-111074871 CCAGACTCCCTGGCTCCAGCAGG - Intergenic
979197847 4:117941636-117941658 CCAGCTTCCCTGGCTCCAGCAGG + Intergenic
979775426 4:124583369-124583391 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
979978354 4:127224645-127224667 TCAGCCTCCCTGGCTCCAGCAGG + Intergenic
980001731 4:127497492-127497514 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
980184642 4:129446397-129446419 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
980392936 4:132169722-132169744 CTAGCCTCCCTGGCTCCAGGAGG + Intergenic
980489395 4:133505832-133505854 CCAGCGTCCCTGGCTCCAGCAGG - Intergenic
980864830 4:138542500-138542522 CCAGTCTCCCTGGCTCCAGCAGG - Intergenic
981187027 4:141815978-141816000 CCAGACCCCCTGGCTCCAGCAGG - Intergenic
981237539 4:142436062-142436084 CCAGCCTCCCTGGCTTCAGCAGG - Intronic
981273820 4:142874896-142874918 CCAGTCTCCCTGGCACCAGCAGG - Intergenic
983273637 4:165591830-165591852 CAATATTCCCTGGCACCAGCTGG - Intergenic
983726925 4:170940556-170940578 CTAGTCTCCCTGGCTCCAGCAGG - Intergenic
984092101 4:175387384-175387406 TCAGCCTCCCTGGCTCCAGCAGG - Intergenic
984334999 4:178379261-178379283 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
984626122 4:182009563-182009585 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
986871130 5:12048160-12048182 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
987382713 5:17300613-17300635 CAGCCCTACCTGGCTCCGGCAGG - Intergenic
987399848 5:17463841-17463863 CCAGTCTCCTTGGCTCCAGCAGG + Intergenic
987834709 5:23146270-23146292 CCAGCCTCCTTGGCTCCAGCAGG + Intergenic
987988585 5:25181277-25181299 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
988059493 5:26148862-26148884 CCAGCATCCCTGGCTCCAGCAGG - Intergenic
989092034 5:37743577-37743599 CTAGCCTTCCTGGCTCCAGCAGG - Intronic
989137270 5:38167705-38167727 CAGGCCGCCCTGGCTCCAGGAGG - Intergenic
989166436 5:38437430-38437452 CAGGGCACCCTGGCTCCCGGTGG - Intronic
989348225 5:40453753-40453775 CCAGTCTCCTTGGCTCCAGCAGG + Intergenic
990139095 5:52682522-52682544 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
990620126 5:57550267-57550289 CCGGTCTCCCTGGCTCCAGCAGG + Intergenic
993087243 5:83378359-83378381 CAGGACTGCCTGGCAGGAGCTGG + Intergenic
993117269 5:83733815-83733837 TCAGTCTCCCTGGCTCCAGCAGG + Intergenic
993253419 5:85556690-85556712 CCAGCCTCCCTGGCTCCAACAGG - Intergenic
994344522 5:98668901-98668923 CCAGGCTTCCTGGCTCCAGCAGG - Intergenic
994696635 5:103079877-103079899 CCAGCCTCCCTGGATCCAGCAGG + Intergenic
995258302 5:110072718-110072740 CTGGACTCCCTGGAGCTAGCAGG + Intergenic
995340937 5:111058473-111058495 CCAGCCTCCCTAGCTCCAGCAGG + Intergenic
995594225 5:113731070-113731092 CCAGCCTCCCTGGCTCCATCAGG + Intergenic
995666171 5:114544818-114544840 CCAGCTTCCCTGGCTCCAGCAGG - Intergenic
995960161 5:117829754-117829776 CCAGCTTCCCTGGCTCCAGCAGG + Intergenic
996463231 5:123770885-123770907 CCAGACTCCCTGGATCCAGCAGG + Intergenic
996639058 5:125730569-125730591 CCAGTCTCCCTGGCTCCTGCAGG - Intergenic
996893823 5:128456103-128456125 CCAACCTCCCTGGCTCCAGCAGG - Intronic
997232481 5:132254757-132254779 CAGGGCTGGCAGGCTCCAGCAGG - Intronic
997657202 5:135564187-135564209 CAGAGCTGCCTGGCTCCAGGTGG + Intergenic
998788815 5:145743981-145744003 CCAGCCTCCCTGGCTGCAGCAGG - Intronic
999402743 5:151279185-151279207 GAGGACTCCCTGGCTCGGCCAGG + Intronic
999502709 5:152162896-152162918 CAGGAGTCTCTGGCTCCTGAGGG - Intergenic
999596886 5:153214841-153214863 CCAGCCTCTCTGGCTCCAGCAGG - Intergenic
1000518357 5:162268780-162268802 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1001445792 5:171781776-171781798 CTGGACTCCCTGGGTCGAGTGGG + Intergenic
1001788816 5:174437092-174437114 CCAGACTCCCTGGCTCCAGCAGG - Intergenic
1002577455 5:180182787-180182809 CTGGACTTCCTGGGTCCAGTGGG - Intronic
1002617565 5:180465034-180465056 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1002644342 5:180645822-180645844 CAGGAATCCCTGGCTCCAGCTGG + Intronic
1002801982 6:532468-532490 AAGGACTGCCTGCCTCCAACAGG - Exonic
1002854020 6:1021899-1021921 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
1003427480 6:6007289-6007311 CAGGACTCCCCAGCTCCTGGCGG - Intronic
1005121051 6:22389811-22389833 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1005170603 6:22980607-22980629 CCAGACTCCCTGGTTCTAGCAGG - Intergenic
1005497942 6:26405190-26405212 CTGGGCTCCCTGGTTCCACCGGG - Intronic
1006715521 6:36117046-36117068 AAGGACTCCCTGGCTGCTGCTGG + Intergenic
1007236089 6:40392271-40392293 CTGGACTCCAGGACTCCAGCCGG - Exonic
1008244256 6:49150802-49150824 CCAGCCTCCTTGGCTCCAGCCGG + Intergenic
1008468270 6:51854767-51854789 CCAGCCTCCCTGGCTCCAACAGG + Intronic
1008773665 6:55009228-55009250 CCAGCCTCCCTGGCTCCAGAAGG + Intergenic
1009060036 6:58387617-58387639 CTGAACTCCCTGGAGCCAGCAGG - Intergenic
1009230879 6:61059775-61059797 CTGAACTCCCTGGAGCCAGCAGG + Intergenic
1010331273 6:74626612-74626634 CCAGCCTCCCTGGCTCTAGCAGG - Intergenic
1010483222 6:76379305-76379327 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1010718981 6:79261721-79261743 CCAGCCTCCCTGCCTCCAGCAGG + Intergenic
1010945604 6:81970200-81970222 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1012063060 6:94511858-94511880 CCAATCTCCCTGGCTCCAGCAGG - Intergenic
1013461508 6:110378882-110378904 TCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1013954049 6:115819693-115819715 CAGATATCCCTGACTCCAGCAGG + Intergenic
1014367593 6:120563431-120563453 CCAGTCTTCCTGGCTCCAGCAGG + Intergenic
1014864006 6:126505861-126505883 CTAGCCTCCCTGGCTCCAGCAGG - Intergenic
1015358182 6:132305172-132305194 CCAGCCTCTCTGGCTCCAGCAGG - Intronic
1015587341 6:134789558-134789580 CTGGTCTCCCTGGCACCAGCAGG - Intergenic
1015660192 6:135566412-135566434 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1017916533 6:158836019-158836041 CAGCCTTCCTTGGCTCCAGCAGG - Intergenic
1017920446 6:158867997-158868019 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1018125466 6:160678854-160678876 TAGGACTCCCTGAGCCCAGCAGG + Intergenic
1018134483 6:160766846-160766868 TAGGACTCCCTGAATCCAGCAGG + Intergenic
1018150374 6:160931536-160931558 CAGGATTCCCTGTGTCCAGCAGG - Intergenic
1019113539 6:169738140-169738162 CCAGCCTGCCTGGCTCCAGCAGG + Intergenic
1019116019 6:169763358-169763380 TACTACTTCCTGGCTCCAGCCGG + Intronic
1019266998 7:123330-123352 CAGGCCTCCCTGGGTGCTGCTGG - Intergenic
1020621776 7:10527894-10527916 CCAGTCTCCCTGGCTCCAGCAGG - Intergenic
1020633799 7:10672236-10672258 CCAGCCTCCCTGGCCCCAGCAGG + Intergenic
1021621228 7:22552742-22552764 CAGGACACCCTGGATGCAGCAGG + Intronic
1022323641 7:29309957-29309979 CAGGACTCCCTGCCTCAAATGGG + Intronic
1022427812 7:30285077-30285099 CACCCCTCGCTGGCTCCAGCAGG - Exonic
1022499310 7:30872646-30872668 CAGGGGACCCTGGGTCCAGCTGG + Intronic
1022634625 7:32120046-32120068 CCAGCCTCCCTGGCTCTAGCAGG - Intronic
1022697898 7:32728290-32728312 CACCCCTCGCTGGCTCCAGCAGG - Intergenic
1024099487 7:46015708-46015730 CCACCCTCCCTGGCTCCAGCAGG - Intergenic
1024945493 7:54803750-54803772 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1028012943 7:85672288-85672310 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1028459167 7:91071821-91071843 CCAGCCTCCCTGGCTTCAGCAGG - Intronic
1028517973 7:91698874-91698896 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
1029041447 7:97580382-97580404 CCAGCCTTCCTGGCTCCAGCAGG - Intergenic
1029679096 7:102095563-102095585 AAAGAGTCCCTGGCTCCTGCTGG + Intronic
1030692200 7:112547263-112547285 CCGGTCTCCCTGGCACCGGCAGG + Intergenic
1030701578 7:112646933-112646955 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1031804574 7:126292656-126292678 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1032398315 7:131606653-131606675 GAGGACACCCTGGCTGCGGCGGG - Intergenic
1032919913 7:136534083-136534105 CCAGCCTCCCTGGCTTCAGCAGG - Intergenic
1033230488 7:139593817-139593839 AAGGTCTCCATCGCTCCAGCTGG + Intronic
1033352941 7:140577064-140577086 CAGGATCCCCTTTCTCCAGCAGG - Intronic
1033879399 7:145862548-145862570 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1036155016 8:6333390-6333412 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1038243346 8:25830988-25831010 CCAGTCTCCCTGGCTCCAGCAGG + Intergenic
1039129613 8:34248159-34248181 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1039293854 8:36127777-36127799 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1039506236 8:38054547-38054569 CTGGACATCCTGGCTCCAGATGG - Intronic
1039844758 8:41318034-41318056 CAGGACACCCTTTCTCCAGGAGG - Intergenic
1039996769 8:42541348-42541370 CCCGACTCCCGGGCTCCCGCGGG - Intronic
1040416209 8:47198179-47198201 GAGGACTCCCTGGCCTCTGCTGG + Intergenic
1040959757 8:53019218-53019240 CCAGCCTCCCTGGCTTCAGCAGG - Intergenic
1041211858 8:55559784-55559806 CTAGCCTCCCTGGCTCCAGCAGG + Intergenic
1042509156 8:69593148-69593170 AAGGTCTCCCTGGCTGCTGCTGG + Intronic
1042629947 8:70805564-70805586 CCAGTCTCCCTGGCTTCAGCAGG - Intergenic
1042748000 8:72128173-72128195 CAGGACCCCCTCTCTGCAGCAGG + Intergenic
1043150078 8:76704587-76704609 CTGGACTCCCTGGCATCTGCTGG + Exonic
1043233309 8:77830223-77830245 CCAGCCTCCCTGGCTTCAGCAGG - Intergenic
1044315763 8:90748794-90748816 CCAGCCTTCCTGGCTCCAGCAGG - Intronic
1044356160 8:91225019-91225041 CCAGCCTCCCTGGCCCCAGCAGG + Intronic
1045823673 8:106371870-106371892 AAAGCCTCCCTGGCTCCAGCAGG + Intronic
1046522089 8:115338195-115338217 CTGGACTTCCTGGGTCCAGTGGG - Intergenic
1047705992 8:127500101-127500123 CAGAAATCCTTGGCTCCAGTGGG - Intergenic
1047903660 8:129450013-129450035 CAGGTGTCCCTGGCCCCAGGGGG - Intergenic
1048238405 8:132715987-132716009 CAGGCCTCCCCTGCTGCAGCTGG - Intronic
1048941026 8:139400994-139401016 CAGGCTTCCCTGTCTCCAACAGG - Intergenic
1049183339 8:141234826-141234848 CAGCACAGCCAGGCTCCAGCAGG + Intronic
1049222561 8:141434654-141434676 CAGGGCTCCCTGTCTCCTGGGGG + Intergenic
1050547212 9:6719068-6719090 CAGGCATCTCTGGATCCAGCTGG + Intergenic
1050589836 9:7149544-7149566 CATGCCTCCCTCGCTGCAGCTGG + Intergenic
1050618315 9:7426402-7426424 CCAGCCTCTCTGGCTCCAGCAGG + Intergenic
1050630089 9:7549543-7549565 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1050660732 9:7880177-7880199 CTAGCCTCCCTGGCTCCAGCAGG - Intronic
1052095660 9:24380817-24380839 CAGTACTTCCTGGCTGCATCGGG - Intergenic
1052369227 9:27645472-27645494 CTAGCCTTCCTGGCTCCAGCAGG - Intergenic
1052470296 9:28885323-28885345 CTGGACTCCCTGGAAGCAGCAGG + Intergenic
1052546635 9:29888900-29888922 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1055343348 9:75308809-75308831 CCAGACTCCCTGGAGCCAGCAGG + Intergenic
1055818852 9:80238373-80238395 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1056800456 9:89687177-89687199 CAGGCCTCCCTGGCTTCTGTCGG - Intergenic
1058703954 9:107623719-107623741 CTGGATTCCCTGGATCCAGCTGG - Intergenic
1059004232 9:110383940-110383962 CCAGTCTCCCTGGCACCAGCAGG + Intronic
1059340275 9:113594108-113594130 CTGGACTCCCAGGCACAAGCCGG - Intronic
1059357302 9:113709995-113710017 CAGAACTCCCTGATTCCAGAAGG - Intergenic
1059458288 9:114413417-114413439 CAGGACTTCCTGGCTCTCCCTGG - Intronic
1060519697 9:124287260-124287282 CAGGTTACCCTGGCACCAGCAGG + Intronic
1061085192 9:128394044-128394066 CTTGATTCCCAGGCTCCAGCAGG + Intergenic
1061954218 9:133953264-133953286 CAGGACTGCCTGCCACCAGCTGG - Intronic
1062004812 9:134233830-134233852 CAGGCCAGCCTGGCTGCAGCTGG - Intergenic
1062042841 9:134412028-134412050 CAAGACCCCTTGGCTCCAGATGG + Intronic
1062178580 9:135178441-135178463 CGGGACCCCCAGGGTCCAGCAGG - Intergenic
1062463813 9:136672572-136672594 CATGGGTCCCAGGCTCCAGCAGG - Exonic
1062595390 9:137296866-137296888 CAGTGCTTCCTGCCTCCAGCCGG + Intergenic
1203781428 EBV:103137-103159 CAGGCCTCCCTGGGTCCCGGCGG + Intergenic
1185846291 X:3441055-3441077 CCAGCCTCCCTGGCTCCAACAGG + Intergenic
1186430920 X:9503583-9503605 CCAGCCTCCCTGGCTCTAGCAGG - Intronic
1187818197 X:23256157-23256179 CTGGACTCTCTGGAGCCAGCAGG - Intergenic
1188092147 X:25977063-25977085 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1188260413 X:28016499-28016521 AGGGACTCCGAGGCTCCAGCCGG + Intergenic
1188647738 X:32591635-32591657 CACGCCTCCCTTGCTGCAGCTGG - Intronic
1188884324 X:35531360-35531382 CCAGCCTCCCTGGCTCTAGCAGG - Intergenic
1189560366 X:42185772-42185794 CAGGATCCCCTTGCCCCAGCAGG - Intergenic
1189571869 X:42306771-42306793 CCAGCCTCCCTGACTCCAGCAGG - Intergenic
1189810702 X:44778290-44778312 CTGGACTTCCTGGGTCCAGTGGG + Intergenic
1190191704 X:48281904-48281926 CAGGACCACCTGTCTCCAGCCGG - Intergenic
1190194979 X:48309091-48309113 CAAGACCACCTGTCTCCAGCCGG - Intergenic
1190200889 X:48359528-48359550 CAGGACCACCTGTCTCCAGCCGG - Intergenic
1190202231 X:48372128-48372150 CAAGACCACCTGTCTCCAGCCGG - Intergenic
1190202960 X:48380095-48380117 CAGGACCACCTGTCTCCAGCCGG + Intergenic
1190207578 X:48415318-48415340 CAGGACCACCTGTCTCCAGCCGG - Intergenic
1190208307 X:48423285-48423307 CAAGACCACCTGTCTCCAGCCGG + Intergenic
1190210881 X:48446838-48446860 CAGGACCACCTGTCTCCAGCCGG + Intergenic
1190529595 X:51361587-51361609 CCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1190661411 X:52657294-52657316 CAAGACCACCTGTCTCCAGCCGG - Intronic
1190667711 X:52709971-52709993 CAGGACCACCTGTCTCCAGCCGG - Intergenic
1190669041 X:52722562-52722584 CAGGACCACCTGTCTCCAGCCGG - Intergenic
1190670376 X:52735842-52735864 CAGGACCACCTGTCTCCAGCCGG + Intergenic
1190671707 X:52748437-52748459 CAGGACCACCTGTCTCCAGCCGG + Intergenic
1191034369 X:56008746-56008768 CCAGTCTCCCTGGCACCAGCAGG - Intergenic
1191815621 X:65241385-65241407 CTGGACTCCCTGGAGCCGGCAGG + Intergenic
1191976169 X:66873794-66873816 CAGGACTCACAGGATCCAGATGG - Intergenic
1192026336 X:67456748-67456770 CTATCCTCCCTGGCTCCAGCAGG - Intergenic
1192482167 X:71495047-71495069 CTGGACTCCCTGGGTCGAGTGGG - Intronic
1192716433 X:73647518-73647540 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
1192930265 X:75799323-75799345 CCAGCCTCTCTGGCTCCAGCAGG + Intergenic
1193048379 X:77076977-77076999 CCAGCCTCCCTGGCTCTAGCAGG + Intergenic
1193091086 X:77494463-77494485 CCAGTCTCCCTGGCTCCAGCAGG - Intergenic
1193360678 X:80575015-80575037 CAGGAGTCCCGGGCTGCCGCTGG - Intergenic
1193574932 X:83185353-83185375 CTGTACTCCCTGGTGCCAGCTGG - Intergenic
1193591450 X:83392929-83392951 CTGGACTCCCTGGCTGCTGTAGG + Intergenic
1193719525 X:84971502-84971524 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1193768545 X:85561261-85561283 CCAGCCTCCCTGGTTCCAGCAGG + Intergenic
1194058209 X:89163819-89163841 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1194286769 X:92020350-92020372 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
1194400922 X:93437130-93437152 CAGGACTGGATGGCTCCCGCTGG + Intergenic
1194523126 X:94942890-94942912 CCAGCCTCCATGGCTCCAGCAGG - Intergenic
1194596707 X:95867919-95867941 CCAGCTTCCCTGGCTCCAGCAGG - Intergenic
1194922245 X:99780514-99780536 GAGGACTCCATGCCTGCAGCAGG + Intergenic
1196517283 X:116628610-116628632 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1196607365 X:117671828-117671850 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1196830135 X:119769296-119769318 CAGGACTTCCTGGGTCGAGTGGG + Intergenic
1197030117 X:121803024-121803046 GCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1197403934 X:126027567-126027589 CCAGCCTCCCTGGCTCCACCAGG + Intergenic
1197602159 X:128543466-128543488 CCAGCCTCCCTGGCTGCAGCAGG + Intergenic
1199495873 X:148451687-148451709 CAGCATTCACGGGCTCCAGCAGG + Intergenic
1200372179 X:155739105-155739127 CTGGACTCTCTGGAGCCAGCAGG - Intergenic
1200604315 Y:5244910-5244932 CCAGCCTCCCTGGCTCCAGCAGG - Intronic
1200742026 Y:6864279-6864301 CCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1200818218 Y:7555349-7555371 CCAGCCTCCCTGGCTCCAACAGG - Intergenic
1201345803 Y:12983192-12983214 CAGCACTTCCTGGCTGCATCTGG + Intergenic
1201456010 Y:14167406-14167428 CTGGACTTCCTGGGTCGAGCGGG + Intergenic
1201979643 Y:19892889-19892911 TCAGCCTCCCTGGCTCCAGCAGG - Intergenic
1201989232 Y:20006884-20006906 CTGGACTTCCTGGGTCGAGCGGG - Intergenic
1202082004 Y:21093113-21093135 CTAGCTTCCCTGGCTCCAGCAGG - Intergenic
1202092520 Y:21208836-21208858 CCAGCCTCCCTTGCTCCAGCAGG - Intergenic