ID: 905668306

View in Genome Browser
Species Human (GRCh38)
Location 1:39775514-39775536
Sequence GAGCCTGCCCACTGCCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 1, 2: 8, 3: 24, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905668299_905668306 18 Left 905668299 1:39775473-39775495 CCGACATAACTGACGGCATCTCA 0: 1
1: 1
2: 0
3: 8
4: 63
Right 905668306 1:39775514-39775536 GAGCCTGCCCACTGCCTGGATGG 0: 1
1: 1
2: 8
3: 24
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905668306 Original CRISPR GAGCCTGCCCACTGCCTGGA TGG Intronic