ID: 905668306 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:39775514-39775536 |
Sequence | GAGCCTGCCCACTGCCTGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 308 | |||
Summary | {0: 1, 1: 1, 2: 8, 3: 24, 4: 274} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
905668299_905668306 | 18 | Left | 905668299 | 1:39775473-39775495 | CCGACATAACTGACGGCATCTCA | 0: 1 1: 1 2: 0 3: 8 4: 63 |
||
Right | 905668306 | 1:39775514-39775536 | GAGCCTGCCCACTGCCTGGATGG | 0: 1 1: 1 2: 8 3: 24 4: 274 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
905668306 | Original CRISPR | GAGCCTGCCCACTGCCTGGA TGG | Intronic | ||