ID: 905668786

View in Genome Browser
Species Human (GRCh38)
Location 1:39778093-39778115
Sequence TCTGGGGCCCCGAAACACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905668786_905668806 24 Left 905668786 1:39778093-39778115 CCCCTGTGTTTCGGGGCCCCAGA 0: 1
1: 1
2: 1
3: 13
4: 132
Right 905668806 1:39778140-39778162 CCCAAGGGTCTCTTGTCCCCAGG 0: 1
1: 1
2: 3
3: 25
4: 211
905668786_905668797 8 Left 905668786 1:39778093-39778115 CCCCTGTGTTTCGGGGCCCCAGA 0: 1
1: 1
2: 1
3: 13
4: 132
Right 905668797 1:39778124-39778146 GCCCCGGCCCCTTCTTCCCAAGG 0: 2
1: 0
2: 3
3: 31
4: 349
905668786_905668799 9 Left 905668786 1:39778093-39778115 CCCCTGTGTTTCGGGGCCCCAGA 0: 1
1: 1
2: 1
3: 13
4: 132
Right 905668799 1:39778125-39778147 CCCCGGCCCCTTCTTCCCAAGGG 0: 2
1: 0
2: 2
3: 18
4: 244
905668786_905668793 -8 Left 905668786 1:39778093-39778115 CCCCTGTGTTTCGGGGCCCCAGA 0: 1
1: 1
2: 1
3: 13
4: 132
Right 905668793 1:39778108-39778130 GCCCCAGAGCGGGGGTGCCCCGG 0: 2
1: 0
2: 4
3: 39
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905668786 Original CRISPR TCTGGGGCCCCGAAACACAG GGG (reversed) Intronic
900294866 1:1943751-1943773 TTAGGGGCCCCACAACACAGAGG + Intronic
902404933 1:16177428-16177450 TCTGGGGCCCTTGCACACAGGGG - Intergenic
904890108 1:33773474-33773496 TCTGGGGGCCCTGAACCCAGTGG + Intronic
905627638 1:39499015-39499037 TCTGGGGCCCCGGAACACAGCGG + Intronic
905668786 1:39778093-39778115 TCTGGGGCCCCGAAACACAGGGG - Intronic
910803327 1:91166325-91166347 TCTGGGTCCCCGTAAAGCAGTGG - Intergenic
911123640 1:94320216-94320238 TCTGGGGACACGAGACACACAGG - Intergenic
912502903 1:110134020-110134042 TATGGGGCCCCTCTACACAGTGG - Intergenic
914251323 1:145924325-145924347 TCTGGGGCCTGGACACACTGAGG - Intergenic
915128069 1:153679437-153679459 GCCGGGGCCCAGGAACACAGCGG - Exonic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
919245975 1:194984596-194984618 TCTGGGGCCCCATAACACTCTGG - Intergenic
923062660 1:230490113-230490135 CCTGGGGTCCCAAAGCACAGAGG + Intergenic
1063612490 10:7574855-7574877 TCGGGGGGCCAGAAAGACAGAGG - Intronic
1069580499 10:69562881-69562903 TCTGGGCCTCCCAAACACTGGGG + Intergenic
1069775882 10:70926819-70926841 TCTGGGGCACTGAAAATCAGCGG + Intergenic
1072248331 10:93562391-93562413 TCTGGGGCCCAAACACAAAGCGG + Intergenic
1075732122 10:124642633-124642655 TCAGGATCCCCGAGACACAGGGG + Intronic
1077104983 11:838300-838322 TCTGGGGACCCCAACCTCAGAGG + Exonic
1078080648 11:8202372-8202394 CCTAGGGCCTCGTAACACAGAGG - Intergenic
1078510000 11:11977845-11977867 TTTGAGGCCCCTAAACAAAGAGG - Intronic
1082102204 11:48181923-48181945 TCTTGATCCCCAAAACACAGTGG - Intergenic
1083933914 11:65860599-65860621 TCACGGGGCCCCAAACACAGGGG - Exonic
1086939510 11:92780831-92780853 TCTGGGGCCCAAAAGCTCAGTGG - Intronic
1088915843 11:114227201-114227223 CCTGGGGCCCAGGAAGACAGTGG + Intronic
1089062651 11:115638490-115638512 TCTGAGGGCCCCAAGCACAGTGG + Intergenic
1089883185 11:121794694-121794716 TTTGGGGCTCCTAAACACACTGG + Intergenic
1091267559 11:134282659-134282681 GCTGGGGGCCAGAATCACAGAGG - Intronic
1091723840 12:2832343-2832365 TCTGGGGCCCATAAACAGAGTGG - Intronic
1091788656 12:3258370-3258392 TCTGGGGCCCAGAATCACCTTGG + Intronic
1096724248 12:53548292-53548314 TCTGGGGCCTAGCGACACAGTGG - Intronic
1099949053 12:89279554-89279576 ACTGGGGACTCGAAAAACAGTGG - Intergenic
1100694341 12:97075203-97075225 GCTTGGGCCCCAGAACACAGTGG - Intergenic
1100902038 12:99252520-99252542 CCCATGGCCCCGAAACACAGAGG + Intronic
1101615209 12:106329518-106329540 TCTGGGGCGTTTAAACACAGAGG + Intronic
1101724298 12:107376299-107376321 TCTGGGGACCAGAGACGCAGTGG - Intronic
1106928598 13:34639165-34639187 TCTGGGGCCTCACAAGACAGTGG - Intergenic
1110302141 13:73940986-73941008 TCTGGTGCACTGAAACACAAGGG + Intronic
1113723138 13:112575970-112575992 TCTGGTCTCCAGAAACACAGGGG + Intronic
1115506867 14:34101362-34101384 TCTGGGGGCCTGATACACAGTGG - Intronic
1119572762 14:75690657-75690679 TCTGTAGCCCAGAACCACAGTGG + Intronic
1123113826 14:105884965-105884987 TCTGGGGCCCCCATTGACAGTGG + Intergenic
1123116053 14:105894600-105894622 TCTGGGGCCCCCATTGACAGTGG + Intergenic
1123120295 14:105913314-105913336 TCTGGGGCCCCCATTGACAGTGG + Intergenic
1123403014 15:20004891-20004913 TCTGGGGCCCCCATTGACAGTGG + Intergenic
1123512354 15:21011545-21011567 TCTGGGGCCCCCATTGACAGTGG + Intergenic
1129609147 15:77039083-77039105 TCTGGGGCCCACAGACACTGCGG - Intergenic
1130954245 15:88615668-88615690 TGTGGGGCCCAGAAAGTCAGGGG - Intergenic
1131019946 15:89088984-89089006 CCTGGAGCCCCGAAACACAGAGG - Intronic
1133669874 16:8007900-8007922 GCTGGGGGCCCCAGACACAGAGG + Intergenic
1135303081 16:21347374-21347396 ACTGTGCTCCCGAAACACAGCGG - Intergenic
1136299821 16:29326566-29326588 ACTGTGCTCCCGAAACACAGCGG - Intergenic
1138277071 16:55742906-55742928 ACTGTGGCCCGGAACCACAGAGG + Intergenic
1139692938 16:68652651-68652673 TCTGTGCGCCAGAAACACAGGGG - Intronic
1140699122 16:77565050-77565072 CCAGTGGCCCTGAAACACAGAGG + Intergenic
1141481451 16:84309355-84309377 TCTGGGGCCTTGGAGCACAGAGG + Intronic
1141512857 16:84523985-84524007 TCTGGGGCACCAACACCCAGGGG + Intronic
1142212789 16:88816377-88816399 CCTGGGGCCCCGAGACTCAGGGG + Intronic
1144316936 17:14070452-14070474 TCTGGGCACTGGAAACACAGAGG - Intronic
1145836064 17:27955153-27955175 TCTGAAGCCCTGAGACACAGCGG - Intergenic
1154125587 18:11689588-11689610 CCTGGGCCCCCGAAAAGCAGCGG - Exonic
1157699423 18:49751551-49751573 TCTGCAGCCCTGGAACACAGTGG - Intergenic
1160756256 19:758468-758490 TCTGGGGCCCTGAACCGCAGAGG - Exonic
1162742855 19:12783183-12783205 TCTGGGACCCCTACAGACAGTGG + Intronic
1166849165 19:45750084-45750106 GCTGGGGACCAGAGACACAGAGG + Intronic
1166945231 19:46392087-46392109 TCTGGGGCCCTGGGCCACAGTGG - Intronic
927694143 2:25229117-25229139 GCTGGGTCTCGGAAACACAGAGG + Exonic
936245739 2:110825786-110825808 TCTTGGGCCCCCAGCCACAGTGG + Intronic
939533601 2:143396217-143396239 TCTGTTGCTCCCAAACACAGCGG - Intronic
941438792 2:165507346-165507368 TCTGGGGTACCAAAAAACAGAGG - Intronic
942246597 2:174013600-174013622 CTTGGGGCCCCGAGGCACAGTGG + Intergenic
943625147 2:190190022-190190044 TCTGGGGCACCTAAATCCAGGGG - Intronic
946391618 2:219419796-219419818 GCTGGGAACCAGAAACACAGAGG + Intronic
948401337 2:237687867-237687889 TCTGTAGCCCCAAACCACAGTGG + Intronic
948754479 2:240150971-240150993 TCTGAGTCCCCGGAACACAGGGG + Intergenic
948754491 2:240151018-240151040 TCTGAGGCCCCGAAATGCAGGGG + Intergenic
948754503 2:240151065-240151087 TCTGAGTCCCCGGAACACAGGGG + Intergenic
948754515 2:240151112-240151134 TCTGAGGCCCCGAAATGCAGGGG + Intergenic
1169482021 20:5991460-5991482 TCTGGGCCCCTGAAAAAAAGAGG + Intronic
1171400885 20:24872505-24872527 TCTGGGGCCAGGACACTCAGTGG + Intergenic
1172276532 20:33682682-33682704 AGAGGGGCCCCGAAACGCAGGGG + Intronic
1173280014 20:41618902-41618924 GCTGGGGTCCCGCGACACAGGGG + Intergenic
1174142015 20:48421716-48421738 CCTGGGTCCCCAAACCACAGGGG + Intergenic
1174562697 20:51442888-51442910 TCCGGGGCCCCCAAACAGGGAGG + Intronic
1175187129 20:57186309-57186331 TATGGGGTCCCGGAAAACAGGGG + Intronic
1175335250 20:58191747-58191769 CCTGGAGCCCCTAAACCCAGGGG + Intergenic
1175530856 20:59673574-59673596 CCTGGGGCTCCCAAACACAAGGG + Intronic
1177012223 21:15743462-15743484 TTTGGGGCCCCCTCACACAGAGG - Intronic
1178420805 21:32441887-32441909 TCTGAGGCCCCAGAAGACAGGGG - Intronic
1179213824 21:39349297-39349319 TCTGGGGCCCCGCGAGACGGCGG - Intronic
1179883146 21:44301760-44301782 TGTGGTTCCCTGAAACACAGAGG + Intronic
1183424741 22:37733430-37733452 TCTGGGGCCCCGCACCCCAAGGG + Intronic
1183743206 22:39679538-39679560 GGTGGGGCCCAGAAAGACAGAGG - Intronic
1184149083 22:42628177-42628199 ACTGGGGCCCCGGAACTCAATGG + Exonic
1184373499 22:44097514-44097536 TCTGGAGCCCCCAGATACAGAGG + Intronic
1184617632 22:45648704-45648726 TCTGGGCCTCCGGACCACAGGGG + Intergenic
1184864931 22:47197102-47197124 TCTGGGGCAGCCAGACACAGGGG + Intergenic
1185398956 22:50606158-50606180 TCTGTGGCCCAGAGACCCAGAGG - Intronic
949559498 3:5188385-5188407 TCGGGGGCCCCGGAGGACAGAGG - Intronic
949764605 3:7512420-7512442 TCTGGAGAGCCCAAACACAGTGG + Intronic
952942178 3:38453774-38453796 TCTGGGGCCCCGCCCCTCAGGGG + Intergenic
954813211 3:53260577-53260599 TCTGGGTCCCCAAAGTACAGGGG - Intergenic
959935788 3:112026940-112026962 TCTGGGGGCACGAAATTCAGGGG + Intergenic
960939496 3:122924003-122924025 TCGGGGGCGCTGAAATACAGTGG + Intronic
961398572 3:126616585-126616607 TCTGGGGCCCAGCAGCACAGTGG - Intronic
963904583 3:150763098-150763120 TCCCGGGCCCCGAACCCCAGCGG + Exonic
963906620 3:150778779-150778801 TCTGGGGCCCTCGAACACGGCGG + Intergenic
968970597 4:3791575-3791597 TCTGGGGCCCCAACCCCCAGAGG - Intergenic
969577345 4:8044160-8044182 TCTGGAGCCTAGAAACCCAGTGG + Intronic
971213240 4:24640058-24640080 TCAGGGGCCATGAGACACAGGGG + Intergenic
973308788 4:48683957-48683979 TATGAAGCCCAGAAACACAGTGG + Intronic
973662288 4:53120590-53120612 TCTGGGGCACAGAGACACAGAGG + Intronic
978905626 4:114001995-114002017 TCTGGGAGCCCCAAACACAAGGG - Intergenic
982358274 4:154491907-154491929 CCTGGCGCCCGGAGACACAGTGG - Intergenic
984901972 4:184593490-184593512 CCTGGGACTCCGAAACAAAGTGG - Intergenic
986486526 5:8243654-8243676 CCTGAGGCCCCCAAACCCAGAGG + Intergenic
988778984 5:34502242-34502264 TCAGGGTCCCAGAAAAACAGTGG + Intergenic
996919924 5:128756152-128756174 TCTGGGGCCCAATAACTCAGTGG + Intronic
1003882946 6:10494756-10494778 ACTGCGGCTCCGAACCACAGTGG + Intronic
1005955424 6:30660065-30660087 TCCGGGGATTCGAAACACAGGGG + Exonic
1006293261 6:33157147-33157169 CATGGGGCCCAGAGACACAGAGG + Intergenic
1006364944 6:33609863-33609885 TCTGGGGCCCCTAGACTGAGGGG - Intergenic
1006581335 6:35079390-35079412 GCTGAGGACCCCAAACACAGAGG + Intronic
1009420098 6:63455785-63455807 TCTGTGGCCCAGAGGCACAGTGG + Intergenic
1011769599 6:90661035-90661057 TCTGGGCCCCCAGAACAAAGAGG + Intergenic
1013978561 6:116103461-116103483 TATGGTGCCCGAAAACACAGAGG + Intronic
1015903051 6:138087437-138087459 TATTGGGCTCAGAAACACAGAGG - Intergenic
1018199857 6:161384629-161384651 TCTTGGGCCTGGAGACACAGGGG + Intronic
1019743067 7:2684724-2684746 CCAGGACCCCCGAAACACAGAGG - Intronic
1019763557 7:2832247-2832269 TCTGGGGACAGGAAACACAACGG - Intronic
1019928549 7:4208722-4208744 TCTGTGGCCCTGAGACCCAGGGG - Intronic
1024095207 7:45977365-45977387 TCTGGTGCCCAGAAAGACATGGG + Intergenic
1024640796 7:51327129-51327151 TCTGGGGGCCCGGCACACATGGG - Intergenic
1024922937 7:54578891-54578913 CCTGGGGCTCCGCCACACAGGGG - Intergenic
1033277702 7:139985197-139985219 TCTGGGACCCCAAAGCACAGTGG + Intronic
1036501477 8:9318689-9318711 TCTGGGACAGCGAAAGACAGAGG + Intergenic
1037740456 8:21604857-21604879 TCTGAGGCCAGGAAAAACAGTGG + Intergenic
1037887842 8:22604494-22604516 GCTGGGCCCCCCAAACACAAGGG - Intergenic
1047624750 8:126645140-126645162 TCTGGGCCCCTGAAATACATGGG - Intergenic
1049649719 8:143760054-143760076 TCTGGGGCCCCAAAACACCATGG - Intergenic
1060279320 9:122205393-122205415 ACTGGGTGCCCGATACACAGTGG + Intronic
1061615201 9:131774707-131774729 CCTGGGGCCCCCAAACCCTGGGG - Intergenic
1062338634 9:136083681-136083703 GCGGGGGCCCCGAGACACTGTGG + Intronic
1062638768 9:137506074-137506096 CCTGGGCCCCCTACACACAGAGG + Exonic
1187564619 X:20436071-20436093 TCTGAGGCCGGGAATCACAGGGG - Intergenic
1187604225 X:20865700-20865722 TTTTGGGCCCCAAAAAACAGTGG + Intergenic
1190907995 X:54747005-54747027 TTTGGGGCCCCAAAACACTTTGG + Intergenic
1195784025 X:108497531-108497553 TCTGGGGCCCACAAACATAGAGG - Intronic