ID: 905673458

View in Genome Browser
Species Human (GRCh38)
Location 1:39808304-39808326
Sequence GGGCTCCTCACTTGGCAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905673458_905673471 11 Left 905673458 1:39808304-39808326 CCCGTCTGCCAAGTGAGGAGCCC No data
Right 905673471 1:39808338-39808360 AGCTGCCCCGTCCAGGAGGTGGG 0: 8
1: 84
2: 722
3: 4753
4: 3670
905673458_905673472 12 Left 905673458 1:39808304-39808326 CCCGTCTGCCAAGTGAGGAGCCC No data
Right 905673472 1:39808339-39808361 GCTGCCCCGTCCAGGAGGTGGGG 0: 19
1: 285
2: 2322
3: 2558
4: 4160
905673458_905673474 14 Left 905673458 1:39808304-39808326 CCCGTCTGCCAAGTGAGGAGCCC No data
Right 905673474 1:39808341-39808363 TGCCCCGTCCAGGAGGTGGGGGG 0: 9
1: 81
2: 499
3: 2943
4: 6125
905673458_905673470 10 Left 905673458 1:39808304-39808326 CCCGTCTGCCAAGTGAGGAGCCC No data
Right 905673470 1:39808337-39808359 CAGCTGCCCCGTCCAGGAGGTGG 0: 8
1: 70
2: 316
3: 386
4: 623
905673458_905673473 13 Left 905673458 1:39808304-39808326 CCCGTCTGCCAAGTGAGGAGCCC No data
Right 905673473 1:39808340-39808362 CTGCCCCGTCCAGGAGGTGGGGG 0: 10
1: 85
2: 517
3: 2409
4: 2101
905673458_905673466 4 Left 905673458 1:39808304-39808326 CCCGTCTGCCAAGTGAGGAGCCC No data
Right 905673466 1:39808331-39808353 GCCCGGCAGCTGCCCCGTCCAGG 0: 22
1: 236
2: 1040
3: 1592
4: 8584
905673458_905673469 7 Left 905673458 1:39808304-39808326 CCCGTCTGCCAAGTGAGGAGCCC No data
Right 905673469 1:39808334-39808356 CGGCAGCTGCCCCGTCCAGGAGG 0: 9
1: 43
2: 299
3: 1548
4: 7112
905673458_905673479 27 Left 905673458 1:39808304-39808326 CCCGTCTGCCAAGTGAGGAGCCC No data
Right 905673479 1:39808354-39808376 AGGTGGGGGGCACCTACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905673458 Original CRISPR GGGCTCCTCACTTGGCAGAC GGG (reversed) Intergenic
No off target data available for this crispr