ID: 905675324

View in Genome Browser
Species Human (GRCh38)
Location 1:39820637-39820659
Sequence CTCCCTCGGCACCACGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905675324_905675331 -4 Left 905675324 1:39820637-39820659 CCAGTCCCGTGGTGCCGAGGGAG No data
Right 905675331 1:39820656-39820678 GGAGAGCCTATAGGCTGGGCAGG No data
905675324_905675329 -9 Left 905675324 1:39820637-39820659 CCAGTCCCGTGGTGCCGAGGGAG No data
Right 905675329 1:39820651-39820673 CCGAGGGAGAGCCTATAGGCTGG No data
905675324_905675330 -8 Left 905675324 1:39820637-39820659 CCAGTCCCGTGGTGCCGAGGGAG No data
Right 905675330 1:39820652-39820674 CGAGGGAGAGCCTATAGGCTGGG No data
905675324_905675334 7 Left 905675324 1:39820637-39820659 CCAGTCCCGTGGTGCCGAGGGAG No data
Right 905675334 1:39820667-39820689 AGGCTGGGCAGGCATCCCCAGGG No data
905675324_905675338 23 Left 905675324 1:39820637-39820659 CCAGTCCCGTGGTGCCGAGGGAG No data
Right 905675338 1:39820683-39820705 CCCAGGGGCATCTACTCCAATGG No data
905675324_905675333 6 Left 905675324 1:39820637-39820659 CCAGTCCCGTGGTGCCGAGGGAG No data
Right 905675333 1:39820666-39820688 TAGGCTGGGCAGGCATCCCCAGG No data
905675324_905675335 8 Left 905675324 1:39820637-39820659 CCAGTCCCGTGGTGCCGAGGGAG No data
Right 905675335 1:39820668-39820690 GGCTGGGCAGGCATCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905675324 Original CRISPR CTCCCTCGGCACCACGGGAC TGG (reversed) Intergenic
No off target data available for this crispr