ID: 905678456

View in Genome Browser
Species Human (GRCh38)
Location 1:39847547-39847569
Sequence AGTAACCAGCTTCTAAAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905678456_905678458 11 Left 905678456 1:39847547-39847569 CCTTTCTTTAGAAGCTGGTTACT 0: 1
1: 0
2: 2
3: 15
4: 168
Right 905678458 1:39847581-39847603 TGCATTTTCCCTCAGTGATCAGG 0: 1
1: 0
2: 1
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905678456 Original CRISPR AGTAACCAGCTTCTAAAGAA AGG (reversed) Exonic
901619303 1:10569834-10569856 AATAAACAGCTTGTATAGAAAGG - Intronic
901898890 1:12341044-12341066 AGTAACCAAATTCTAAAGAGCGG - Intronic
904015474 1:27416756-27416778 AATCACCAGCTTCTAATTAATGG + Intronic
905345393 1:37307801-37307823 ACATACCAGCTTCTCAAGAAGGG - Intergenic
905678456 1:39847547-39847569 AGTAACCAGCTTCTAAAGAAAGG - Exonic
907116488 1:51972895-51972917 AGTGACCAGCTATAAAAGAAAGG - Intronic
908106365 1:60847215-60847237 AGTAACCAGATTTAATAGAAAGG + Intergenic
908938773 1:69408030-69408052 AGTAAACAGAATCTACAGAATGG - Intergenic
909369961 1:74872063-74872085 TGAAACCAGCATCTAAAGAAAGG - Intergenic
911306227 1:96235761-96235783 AGGAAAATGCTTCTAAAGAAAGG - Intergenic
914744311 1:150490417-150490439 AGTAACAAGCTTAAAAAAAAAGG - Intronic
916166348 1:161970126-161970148 AGCAAACAGCTGGTAAAGAAAGG + Intergenic
916313478 1:163422515-163422537 AGTCATCAACTTCTAAAAAAAGG + Intergenic
917794674 1:178524334-178524356 AGTGACTTGCTTCTAATGAATGG + Intronic
921883298 1:220277750-220277772 AATAATCAACTTCTGAAGAAAGG - Intergenic
924566210 1:245200593-245200615 AGTAAGCAGGGGCTAAAGAAGGG - Intronic
924603147 1:245509208-245509230 AGAAACCAGCCAATAAAGAAGGG + Intronic
924718645 1:246602619-246602641 AGTAACCTGCTTCTAATGAAAGG - Intronic
1062870812 10:902389-902411 AGTAAAGAGCTTCTTAGGAAGGG + Intronic
1065226923 10:23553242-23553264 AGTAACCACGTTCTAAATTAAGG + Intergenic
1067674441 10:48359383-48359405 TGTAACAAGCTTTTAAAAAATGG - Intronic
1073308062 10:102518831-102518853 TGGAAGCAGCTTTTAAAGAAAGG + Intronic
1074444223 10:113505206-113505228 GATAACCAGCATCTAGAGAAGGG + Intergenic
1074935631 10:118177893-118177915 AGTATCCAGATTGTAAAGAAAGG + Intergenic
1075673062 10:124277349-124277371 AGTTTCCAGCTTATAAGGAATGG + Intergenic
1076000614 10:126909894-126909916 AGAAACCAACTTTTGAAGAAAGG - Intronic
1078292658 11:10028546-10028568 AGAAAACAGCTTCTGCAGAATGG + Exonic
1078871871 11:15354578-15354600 AGCACCCAGCTTCTAAGAAAAGG + Intergenic
1079863266 11:25701279-25701301 AGAAATTACCTTCTAAAGAAGGG - Intergenic
1080939230 11:36896582-36896604 AGAAAACAGCCTCTCAAGAAAGG - Intergenic
1081298425 11:41420703-41420725 AGTAACCAGCTTGTAATTAGTGG - Intronic
1081326455 11:41751491-41751513 AATAACCTGCTTCTAAGTAATGG - Intergenic
1084133605 11:67157008-67157030 ATTAGCCAGCTTTTAATGAAAGG - Intronic
1087814147 11:102640082-102640104 ATTAACCAGAATCTAAATAAAGG + Intergenic
1091383859 12:79442-79464 AGTCACCATCTCTTAAAGAAAGG - Intronic
1093790070 12:23238361-23238383 AGAGACCTGCTTCTAAAGAATGG + Intergenic
1093790929 12:23249578-23249600 AGAAACTTGATTCTAAAGAAAGG - Intergenic
1094685454 12:32709209-32709231 AGTAACCATGTTGTATAGAACGG + Intronic
1096734882 12:53644962-53644984 AGTAAACAGAGTCTATAGAATGG + Intronic
1096965805 12:55626578-55626600 AGTGACCTGCTTTTAATGAAGGG - Intergenic
1097814808 12:64060703-64060725 ATTAAACAGGTTCTAAAGACAGG + Intronic
1098914817 12:76246299-76246321 AGAAGCCAGCTGGTAAAGAAGGG + Intergenic
1099429285 12:82562684-82562706 AATAACCAAGTTTTAAAGAATGG + Intergenic
1099915820 12:88891650-88891672 AAGAAGCAGCTTCTAAAGATAGG - Intergenic
1105794700 13:23839621-23839643 AGAGACCAGTTTATAAAGAAAGG + Intronic
1111466933 13:88625701-88625723 AGTATCCAGACTCTAAAGAATGG + Intergenic
1112230116 13:97581567-97581589 AGTAACCAGCTGATTAACAAGGG - Intergenic
1114072498 14:19125785-19125807 ATTAATGAGCTTCTGAAGAAAGG - Intergenic
1114089760 14:19274190-19274212 ATTAATGAGCTTCTGAAGAAAGG + Intergenic
1114150756 14:20036587-20036609 TTTAACCAGCTTTTTAAGAATGG - Intergenic
1114501695 14:23174191-23174213 AGTAAGCAGCTGATAAAGACAGG - Intronic
1116023650 14:39490226-39490248 CGTAATCAGTTTCTAAAGAGAGG + Intergenic
1116461554 14:45180865-45180887 AGTGACTTGCTTCTAAAAAAAGG - Intronic
1117200535 14:53385390-53385412 AGTTACCACCTTCTAGAAAAGGG - Intergenic
1117288483 14:54309951-54309973 TGAAACCAGCTTCCAAAGATGGG - Intergenic
1117501628 14:56358094-56358116 ACTAACCAACCGCTAAAGAAGGG + Intergenic
1120076856 14:80168658-80168680 AGTAACCACATTTTAAAAAAAGG - Intergenic
1120486641 14:85122437-85122459 ACCAACCAGCTTCTAATGACTGG + Intergenic
1121253961 14:92518236-92518258 AGTTACAAACTTCCAAAGAAAGG + Intronic
1125272025 15:37950145-37950167 AATAACTTACTTCTAAAGAATGG - Intronic
1126707989 15:51424694-51424716 ATTAACCAACTTCTTAATAAAGG - Intergenic
1127569374 15:60226402-60226424 AGTTTCCAGCTTCTCAAGGAAGG - Intergenic
1128669806 15:69566559-69566581 AGAGAACATCTTCTAAAGAATGG + Intergenic
1128787976 15:70412356-70412378 ACTAACCACCTTGTAAAGGAAGG - Intergenic
1129696745 15:77744811-77744833 AGGAAACAGCTTCTTAAGCAAGG - Intronic
1133231674 16:4369889-4369911 GGTAACCAGGTTCTAAAGGCGGG + Intronic
1134013932 16:10875401-10875423 AGTAATCACCTTACAAAGAAGGG + Intergenic
1137539506 16:49352555-49352577 AATAAGCAGCTTCAAAAGGAAGG + Intergenic
1138487057 16:57352634-57352656 GGAAACCAGCTTTCAAAGAAAGG - Intergenic
1143567713 17:7734604-7734626 AGTAAGCAGCTGGTGAAGAAGGG + Exonic
1145046681 17:19623400-19623422 ATTATCCAGTTTCTAAAAAAAGG + Intergenic
1147482607 17:40781392-40781414 ATTACCCATCTTCAAAAGAATGG - Intronic
1147761987 17:42804438-42804460 AGAAACCAGCTTTTATACAAAGG + Intronic
1149694619 17:58607200-58607222 TGTTACCAGCTTTCAAAGAAGGG + Intronic
1150666738 17:67147067-67147089 AGTAATCTGCTTTAAAAGAAAGG - Intronic
1152081332 17:78189191-78189213 AGGAACCAGATTTTGAAGAAAGG - Intronic
1154292170 18:13118078-13118100 AGTAAGGAGTGTCTAAAGAATGG - Intronic
1155009684 18:21764342-21764364 GATAACCAGATTCTAAACAAAGG - Intronic
1155366355 18:25052816-25052838 AGTCTCCAGCTTCTAAACAGAGG + Intergenic
1156137013 18:34053723-34053745 AATAACCAGTTTCCAAAAAAGGG + Intronic
1167761221 19:51450829-51450851 TGTAACCAGCTTCTCAATCAAGG - Intronic
926033489 2:9614092-9614114 AGTATCCAGCTTCTAAAATGTGG - Intronic
936854486 2:116940108-116940130 AGTAACTGTTTTCTAAAGAAAGG + Intergenic
937142209 2:119611755-119611777 AATAATCAGATTCTAAATAAAGG - Intronic
938486742 2:131719268-131719290 ATTAATGAGCTTCTGAAGAAAGG - Intergenic
939115826 2:138059266-138059288 AGAAACAACCTTCTAATGAATGG - Intergenic
941063199 2:160871364-160871386 CCTACCCAGCTTCTCAAGAAAGG + Intergenic
941610928 2:167661392-167661414 AGAAATCAGCCTCTAAAGACTGG - Intergenic
942191585 2:173475903-173475925 AGCAACTTGCTTCTAACGAATGG + Intergenic
943025667 2:182624676-182624698 AATAATCAGCTGCTCAAGAAGGG - Intergenic
944359864 2:198841129-198841151 AGTAACTAGCTGCTTAACAACGG + Intergenic
946846329 2:223861967-223861989 AGCAGCCTGCTTGTAAAGAAAGG + Intronic
947412950 2:229861761-229861783 AGAAATTAGCTTCTTAAGAAAGG + Intronic
948299347 2:236890408-236890430 AGTGACCATCTTCAAGAGAAGGG - Intergenic
1169525600 20:6421928-6421950 AGTAACTAGCCTCTGAATAAAGG + Intergenic
1170279294 20:14627335-14627357 AGTAACCTGCATCTAATGACTGG + Intronic
1172582638 20:36060448-36060470 AGTAACTTGCTTCCAAAGAGTGG + Intergenic
1175716877 20:61260865-61260887 AGCAACCACTTTCTAAAGACAGG - Intronic
1177022972 21:15886031-15886053 GTTAACCAGCTTGTAATGAAGGG + Intergenic
1177114995 21:17074416-17074438 AGCAACTTGCTTCTAATGAATGG - Intergenic
1180490945 22:15848157-15848179 ATTAATGAGCTTCTGAAGAAAGG - Intergenic
1181576123 22:23796278-23796300 AGTATCCAGCCTTTAAGGAAAGG + Intronic
1182914139 22:34012501-34012523 TGTAAGCTGCCTCTAAAGAAAGG - Intergenic
949730468 3:7106502-7106524 AGAAAACAGCTTCAAATGAATGG + Intronic
951317843 3:21208086-21208108 AGGCACCAGCTTCTTCAGAAGGG + Intergenic
952760380 3:36908392-36908414 GGCAACCAGGTTCTTAAGAATGG - Intronic
954032139 3:47827131-47827153 AATAACCATCTCCTGAAGAAGGG - Intronic
955268750 3:57475163-57475185 ACTAAACAGCTTCTAGAAAAGGG + Intronic
956888545 3:73586185-73586207 ATTCCCCTGCTTCTAAAGAAAGG + Intronic
957771796 3:84703672-84703694 AGTAAACAGCCTATACAGAATGG + Intergenic
957819535 3:85353520-85353542 AGAAACCATCAACTAAAGAAAGG - Intronic
958536963 3:95416368-95416390 AGTCAAAAGCTTCTTAAGAAAGG + Intergenic
963979388 3:151519565-151519587 AGTAACCACATTCTTAACAATGG - Intergenic
964144749 3:153445929-153445951 AGGAACCAGAATCTAAACAATGG - Intergenic
969945758 4:10781802-10781824 AGAAAGCTGCTTCTAAAGAAGGG - Intergenic
970950772 4:21752726-21752748 AGTAGCAGGCTCCTAAAGAAAGG - Intronic
971054146 4:22893899-22893921 AGTAACTTGCTTCTAAAAAATGG - Intergenic
971495234 4:27257437-27257459 AGTAACACGAATCTAAAGAAAGG - Intergenic
974671751 4:65039137-65039159 GGTAACCAAGTTCTAAATAATGG - Intergenic
974756042 4:66209552-66209574 AGTACTCAGCTACTAAAGTAGGG - Intergenic
975155169 4:71063902-71063924 TCTAACCTGCTTATAAAGAAAGG + Intergenic
988166896 5:27604409-27604431 ATTAACCAGATTCAAAATAAAGG + Intergenic
988318479 5:29661765-29661787 AGTAAACACAATCTAAAGAATGG + Intergenic
988354041 5:30150183-30150205 ATTAAGCAGCTTTTAGAGAAAGG + Intergenic
991629325 5:68639060-68639082 AGTGACCTGCTTCTAAAGAATGG - Intergenic
992273326 5:75088610-75088632 AGCAACCTGTTTCTAATGAAAGG + Intronic
994312466 5:98290872-98290894 GTCAACCAGCTTCTACAGAAAGG - Intergenic
996121478 5:119678863-119678885 AGTAACCAGGTCATAAAGCAAGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
999412599 5:151365494-151365516 GGTAACAAGCTTCTGAAGTAGGG + Intergenic
1002040932 5:176513599-176513621 AGTTGCCAACTTCTAGAGAATGG - Intergenic
1003606782 6:7569447-7569469 AATAAACACCTTCTAAAAAAAGG + Intronic
1006822359 6:36907480-36907502 AGTGCCCAACTTGTAAAGAAGGG + Intronic
1008770384 6:54971619-54971641 AATAACCAGCTTATAAAAAAGGG - Intergenic
1008846337 6:55968625-55968647 ACCAACCAGCTTCAGAAGAAGGG - Intergenic
1009414801 6:63403850-63403872 TGTAACTTGCTTCTAAACAATGG + Intergenic
1011471050 6:87708110-87708132 AGTAAACAGTTTTTGAAGAAGGG - Intergenic
1011731552 6:90269583-90269605 GGTAACCAGCATCAAAAGACAGG + Intronic
1012527500 6:100196149-100196171 AGACACCATCTTGTAAAGAAGGG - Intergenic
1013392819 6:109703904-109703926 CGTATCCAGCCTCTAAATAATGG + Intronic
1016801155 6:148170450-148170472 AATATGCAGCTTTTAAAGAAGGG - Intergenic
1018420116 6:163633854-163633876 AGTAACTGGCTTCTAATGAATGG - Intergenic
1019843671 7:3475149-3475171 AGTCATCAGCTTCTACATAAGGG - Intronic
1020862908 7:13516885-13516907 AGCAAGCAGCTTCTAAAAAGAGG + Intergenic
1021261851 7:18468174-18468196 AGTGACTTGCTTCTAAAGAGTGG - Intronic
1021664325 7:22960277-22960299 AGTAACCAGCATGTCAATAAGGG - Exonic
1022960715 7:35423804-35423826 ACTAAACAGCTTTTAAAGACTGG + Intergenic
1024190242 7:46999331-46999353 AGTTACAAGATTCTAAATAAAGG - Intergenic
1026002655 7:66573883-66573905 AGTAAACAACTGCTACAGAATGG + Intergenic
1026029202 7:66774912-66774934 AGTAAACAACTGCTACAGAATGG - Intronic
1026188304 7:68101444-68101466 CCTCACCATCTTCTAAAGAATGG - Intergenic
1027605623 7:80294823-80294845 ACTAACCAGCTTCAACAGAAAGG - Intergenic
1030014146 7:105201584-105201606 AGGAAACAGCTCCTAAAGAATGG + Intronic
1032951111 7:136914273-136914295 ATAAAACAGCATCTAAAGAAAGG + Intronic
1038685665 8:29715441-29715463 AATATCCATCTTCTAATGAATGG - Intergenic
1040440697 8:47438580-47438602 TGAAACCAACTTGTAAAGAAAGG - Intronic
1040568510 8:48588050-48588072 AATAACCACCTTGTAGAGAATGG - Intergenic
1041356507 8:57006152-57006174 CCTAAACAGCTTCTAAGGAAAGG - Intergenic
1042793846 8:72638500-72638522 AGAACCCAGCTTCTACAAAAGGG - Intronic
1043513892 8:80978030-80978052 AGTTTCCAGCTTCTTAAGACAGG + Intronic
1044595710 8:93956300-93956322 AGAAACCAACATATAAAGAAAGG - Intergenic
1044825901 8:96196825-96196847 AGTAACAAAGTTCTAAAGGATGG + Intergenic
1045528348 8:102960679-102960701 AGTAATCATCTTCTACAGAATGG - Intronic
1045837302 8:106537300-106537322 AGCAGTCAGCTCCTAAAGAAAGG - Intronic
1047817314 8:128478918-128478940 AGTAACCTGCTTCTGAATAATGG - Intergenic
1048007534 8:130431531-130431553 AGGAACCAGCCAGTAAAGAATGG - Intronic
1050980001 9:11997608-11997630 ATTCACCAGCTTCTAAAGGCTGG + Intergenic
1051162609 9:14225266-14225288 AATAACTGGCTTCTTAAGAATGG - Intronic
1052339198 9:27348718-27348740 AGTAACCTACTTCTAATGAATGG + Intronic
1052341311 9:27366835-27366857 AGTAACCAGGTGCTCAATAAAGG - Intronic
1052414111 9:28156314-28156336 AGTAACCCCATTCTAAGGAATGG + Intronic
1052530607 9:29679660-29679682 AGTAATCTGTTTCTAAACAAAGG + Intergenic
1056145725 9:83727357-83727379 AGTAACCACCTTTGAGAGAAAGG + Intergenic
1057572332 9:96214155-96214177 AGGAACCAGATGCTAAACAAAGG - Intergenic
1058480429 9:105387679-105387701 AGTAATAAGCATTTAAAGAAAGG + Intronic
1186107561 X:6224119-6224141 AGTATCCTCCTTCTAAAGATAGG - Intronic
1188495652 X:30780516-30780538 AGTAACCATCTTCTACATAGAGG + Intergenic
1189949934 X:46218521-46218543 ATTAACCAGTTTCTTCAGAAAGG - Intergenic
1190771098 X:53514913-53514935 AGTAATCATCTTCAAAAAAAAGG + Intergenic
1191214067 X:57917532-57917554 AGTAAAGAGCATCTCAAGAAAGG - Intergenic
1194423802 X:93711208-93711230 AGTAACCAGCTTCAATATGAAGG - Exonic
1197042917 X:121961853-121961875 AGTAACCAACTTCTTAATAAAGG + Intergenic
1197333996 X:125189141-125189163 AGGAACCAGCTTGAAAACAATGG - Intergenic
1197339234 X:125245343-125245365 AGAAATCATTTTCTAAAGAATGG + Intergenic
1197644314 X:129001589-129001611 AGTAACTTGCTACTAAAGCATGG + Intergenic
1198454253 X:136800238-136800260 AGAAACCAACTTTTAAAAAAGGG - Intergenic