ID: 905683710

View in Genome Browser
Species Human (GRCh38)
Location 1:39893553-39893575
Sequence AACATTCATGCCTGTACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905683709_905683710 14 Left 905683709 1:39893516-39893538 CCAAGTTATTGTAAGAATTAAGA 0: 1
1: 0
2: 3
3: 28
4: 300
Right 905683710 1:39893553-39893575 AACATTCATGCCTGTACCCATGG 0: 1
1: 0
2: 0
3: 15
4: 145
905683708_905683710 22 Left 905683708 1:39893508-39893530 CCTGCTCTCCAAGTTATTGTAAG 0: 1
1: 0
2: 0
3: 13
4: 160
Right 905683710 1:39893553-39893575 AACATTCATGCCTGTACCCATGG 0: 1
1: 0
2: 0
3: 15
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905683710 Original CRISPR AACATTCATGCCTGTACCCA TGG Intergenic
902463285 1:16596238-16596260 AAAAAGCATGCCTGTACCTATGG + Intronic
903158232 1:21464478-21464500 AAAAAGCATGCCTGTACCTATGG - Intronic
904958733 1:34312898-34312920 TACAACCTTGCCTGTACCCATGG - Intergenic
905683710 1:39893553-39893575 AACATTCATGCCTGTACCCATGG + Intergenic
910080085 1:83331235-83331257 AATATTCTTGCCTCTATCCAGGG + Intergenic
913552485 1:119929173-119929195 AACATTGATGACTGTGCCCGGGG - Exonic
913639778 1:120801311-120801333 AAAAAGCATGCCTGTACCTATGG - Intergenic
914212722 1:145595217-145595239 AAAAAGCATGCCTGTACCTATGG + Intergenic
914278699 1:146149030-146149052 AAAAAGCATGCCTGTACCTATGG + Intronic
914539746 1:148599972-148599994 AAAAAGCATGCCTGTACCTATGG + Intronic
914626928 1:149471646-149471668 AAAAAGCATGCCTGTACCTATGG - Intergenic
915138938 1:153754276-153754298 AACATTGATTCCAGGACCCAAGG + Intronic
921752716 1:218815766-218815788 AACACTGATTCCTATACCCAAGG - Intergenic
922114720 1:222601561-222601583 CACCTTTATGCCTGTACCCAGGG - Intergenic
1066570548 10:36766888-36766910 CACATACATGCCTGCACCGATGG - Intergenic
1067060445 10:43075594-43075616 CACACTCAGGCCTGTGCCCAGGG - Intergenic
1069713966 10:70508919-70508941 AACGTCCAGGTCTGTACCCAGGG - Intronic
1075568197 10:123519967-123519989 CACATTCCTGCCTGCACCCCTGG + Intergenic
1078014376 11:7600587-7600609 ACCATTCCTGCCTGGAGCCAAGG + Intronic
1082623513 11:55454550-55454572 TACATTCATGCCTCTTCACAGGG - Intergenic
1082637633 11:55615678-55615700 GACATTCCTGCCTGTCCCCTAGG - Intergenic
1086746192 11:90430092-90430114 AACCTTCATTCCTTTACTCATGG - Intergenic
1087484006 11:98738360-98738382 ACAATTCATGCCTGGATCCAAGG - Intergenic
1087700262 11:101429409-101429431 AACATTCCTGCCTTAACCCAAGG - Intergenic
1088849231 11:113691300-113691322 ATCATGCATGGCTGCACCCATGG - Intronic
1090603513 11:128396823-128396845 AACATGCATGCCTGGACCTCAGG - Intergenic
1091219729 11:133922956-133922978 AACATCTATGCCTGTCCCCATGG + Intronic
1095438005 12:42212765-42212787 AAAATGCATGCATTTACCCAAGG - Intronic
1098031377 12:66258195-66258217 AACTTTCATCCCTGTTGCCATGG + Intergenic
1101260481 12:103024665-103024687 CACATTCATGCCCCTTCCCAAGG - Intergenic
1102739020 12:115189665-115189687 AAAATTAATGCCTGAACCAAAGG + Intergenic
1102916925 12:116761030-116761052 AACATTCAGGGATCTACCCAGGG - Intronic
1107996209 13:45863880-45863902 AAAATACATGCCTGTTACCAGGG - Intergenic
1110053565 13:70936155-70936177 GATATTCATCCCTGTACCCATGG - Intergenic
1114447319 14:22798985-22799007 AACAGTTATCCTTGTACCCATGG + Intronic
1116090120 14:40294028-40294050 AACCCTCAGGCCTGTGCCCACGG - Intergenic
1116836583 14:49774328-49774350 ATCTCTCATGCCTGTACACATGG + Intronic
1117809478 14:59531161-59531183 ATCATTCAACCCTGTGCCCAAGG - Intronic
1121311621 14:92938525-92938547 AACATTCCTCTCTGTACCCAGGG - Exonic
1129955140 15:79629561-79629583 AAAATTCAAGCCTGTTCTCATGG + Intergenic
1131543027 15:93290324-93290346 AATATTCAAGCCTGTAGCAAGGG + Intergenic
1138090216 16:54167774-54167796 ATCATGCATGCCTGTAGCCATGG + Intergenic
1146013213 17:29212231-29212253 AGCATTCAAGCCTGAAACCAAGG + Intergenic
1148804118 17:50255690-50255712 AGCATTCTTGCCTTTCCCCAGGG - Intergenic
1149584073 17:57773278-57773300 TGCATACATGCCTGTGCCCACGG + Intergenic
1150493280 17:65588916-65588938 AACATTCAAATCTGTACCCTAGG + Intronic
1153811170 18:8753137-8753159 CACATTCATACCTGGACCCAGGG + Intronic
1155820221 18:30365566-30365588 AACATTCTGCCCTGTACCCTGGG - Intergenic
1156760604 18:40584051-40584073 CACCTTCAGGCCTGTGCCCATGG - Intergenic
1157399440 18:47375060-47375082 AACATGCATGTTTGAACCCAAGG + Intergenic
1159787398 18:72730438-72730460 AACATTCAAGCCAAAACCCAAGG + Intergenic
1160709563 19:544808-544830 ATCATCCATCCCTCTACCCATGG + Intronic
1161907984 19:7171692-7171714 AAAATTCCAGCCTGTACCCTTGG + Intronic
1162006416 19:7783147-7783169 AATAATTATGCATGTACCCAAGG - Intergenic
1167583125 19:50358099-50358121 AAACTTTGTGCCTGTACCCATGG - Intronic
1202678947 1_KI270711v1_random:33681-33703 AAAAAGCATGCCTGTACCTATGG + Intergenic
925290830 2:2747784-2747806 ACCAGGCATGCCTGTACCAAGGG + Intergenic
930278167 2:49338126-49338148 AACATTCATACCTGTATCACAGG + Intergenic
932868871 2:75376061-75376083 AACCCTCATGCCTGTCACCATGG - Intergenic
933462853 2:82611860-82611882 CACACTCAAGCCTGGACCCACGG + Intergenic
936820030 2:116509271-116509293 AAAATTCATATCTGTACCAAGGG - Intergenic
939210095 2:139163529-139163551 AACTTTTTTGCCTTTACCCAAGG + Intergenic
939739956 2:145893953-145893975 GACATTTATGCCTGTAACCCAGG - Intergenic
939776186 2:146390948-146390970 CACCCTCAAGCCTGTACCCATGG - Intergenic
939790722 2:146571184-146571206 AACATTGTTTCCTGTACCTATGG - Intergenic
941309557 2:163912273-163912295 CACCTTCAGGCCTGTGCCCACGG + Intergenic
941630755 2:167881701-167881723 AACATTCTGCCATGTACCCAAGG - Intergenic
942117909 2:172747116-172747138 AACATTAATGCCTTCATCCAGGG - Intronic
946638393 2:221756163-221756185 AACAAGCATGTCTGCACCCAGGG + Intergenic
948178789 2:235964054-235964076 AACTAGCATGCCTGTGCCCAGGG - Intronic
948186558 2:236026047-236026069 AGCATTCATACCTGTCCACAGGG + Intronic
948280943 2:236747671-236747693 AGCACTCAGGCCTGTCCCCAGGG - Intergenic
1172943962 20:38674043-38674065 AACATTCAAAGCTGGACCCAGGG + Intergenic
1174638615 20:52023623-52023645 AACAGTCACGACTGTGCCCAGGG + Intergenic
1174715782 20:52757070-52757092 AACTTTCATCCCTGATCCCAGGG + Intergenic
1175690575 20:61062981-61063003 GACATTCTTGCCTTTCCCCAAGG - Intergenic
1175735068 20:61379724-61379746 GACATTCTTTCCTGTTCCCACGG + Intronic
1179523346 21:41959536-41959558 GACATTTTTGCCTGTACCCAAGG + Intergenic
1181302939 22:21894305-21894327 TGCCTTCATGCCAGTACCCACGG - Intergenic
1182257220 22:29048086-29048108 CACACTCATGCCTCCACCCAGGG - Intronic
1183819186 22:40331090-40331112 CACATTCATGCATGTAAACAAGG + Exonic
1185078698 22:48697059-48697081 AACTTCCATCCCTGTGCCCAGGG - Intronic
951700731 3:25493996-25494018 TACATTCCTGCCTAGACCCAAGG + Intronic
954279073 3:49563185-49563207 CACATTCAAGCCTGGAGCCAGGG + Intronic
958169005 3:89915126-89915148 CACCTTCAAGCCTGGACCCATGG - Intergenic
958552910 3:95639408-95639430 AGCCTTCATCCCAGTACCCAGGG + Intergenic
959567112 3:107843917-107843939 GACATTCATGCCATTAACCAGGG + Intergenic
959919452 3:111854921-111854943 AGCATTCTTGCCTCTCCCCAAGG - Intronic
961349701 3:126292053-126292075 AGCATTCATTCCAGTCCCCAAGG + Intergenic
963780893 3:149485366-149485388 AACATTCATGACTTTAACCTAGG - Intronic
963817403 3:149847291-149847313 AACATACATGCCTATACTCTAGG + Intronic
964557586 3:157956927-157956949 AACACTAATGCCTGAAGCCAGGG + Intergenic
970574297 4:17412348-17412370 AACCCTCAGGCCTGTGCCCATGG - Intergenic
970730387 4:19096670-19096692 TTCATTCATGCCTGTACCATCGG + Intergenic
971219799 4:24694370-24694392 AACAGAAATGCCTCTACCCATGG - Intergenic
971887650 4:32473720-32473742 CACACTCAGGCCTGTGCCCAGGG - Intergenic
973859576 4:55048618-55048640 AAAAGTCATCACTGTACCCAAGG - Intergenic
974596331 4:64017651-64017673 CACCTTCAGGCCTGTGCCCACGG - Intergenic
977608507 4:99007902-99007924 AACATTCCTGCCAGAAACCAGGG - Intronic
977673234 4:99719508-99719530 AATATTCCTAACTGTACCCAGGG - Intergenic
981726599 4:147853923-147853945 AACAGTCATGCCAGCACCAATGG + Intronic
982146482 4:152400363-152400385 AAAAGTCATGTCTATACCCAAGG - Intronic
982220410 4:153119793-153119815 AACATTCTTGCCTGTTCCAAAGG - Intergenic
982981624 4:162144208-162144230 AACTTTCAAGCATGTACGCAAGG + Intronic
983238578 4:165207203-165207225 TTCATTTGTGCCTGTACCCAGGG - Intronic
983542932 4:168931630-168931652 AATGAGCATGCCTGTACCCAGGG + Intronic
983717615 4:170804955-170804977 CACCCTCAGGCCTGTACCCATGG + Intergenic
984552777 4:181180761-181180783 AACATTCATGGCAGTGTCCAAGG - Intergenic
984664436 4:182410372-182410394 CACATACATGCCTGGACGCATGG + Intronic
984856316 4:184199068-184199090 ACCATTCATGCGTGTTCCCTTGG - Intronic
989000797 5:36758236-36758258 AATATTCATGCCTGTCCCTTAGG + Intergenic
990558180 5:56956614-56956636 AAAATTAATTCATGTACCCATGG + Intronic
994917059 5:105994313-105994335 AACATTCATCCCTGCCACCATGG - Intergenic
997612923 5:135227732-135227754 ACCACTCATGCCCTTACCCATGG - Intronic
999600196 5:153253991-153254013 AAGATTTAAGCCTGTTCCCATGG - Intergenic
1003964843 6:11242899-11242921 AACATGCATGCCTTTGCTCATGG - Intronic
1004563905 6:16777708-16777730 AACTCTCATGCCTGGATCCAGGG + Intergenic
1005774577 6:29116616-29116638 AAGACCCATGCCAGTACCCAAGG - Intergenic
1005780509 6:29186827-29186849 AAGATCCATGCCAGTACCCAAGG - Intergenic
1008534528 6:52497794-52497816 AACACTCAAATCTGTACCCAAGG + Exonic
1011832614 6:91391561-91391583 TTTATTTATGCCTGTACCCATGG - Intergenic
1014670977 6:124303471-124303493 AGCATTCTTGCCTGTTCTCAAGG - Intronic
1015168379 6:130224351-130224373 CACCCTCAGGCCTGTACCCATGG - Intronic
1016990440 6:149924718-149924740 ACCATTGATGCCTGGATCCATGG + Intergenic
1017008102 6:150042719-150042741 ATCATTGATTTCTGTACCCATGG - Intergenic
1024526279 7:50352427-50352449 AAAATTCATGCATTTACTCATGG - Intronic
1024629408 7:51235059-51235081 AACGCTCATGCCTGTTCCTATGG + Intronic
1030078215 7:105754959-105754981 AACATTTATGTCTGTCCCCAGGG - Intronic
1031236974 7:119189087-119189109 AACATCCATCCCTGTCACCATGG - Intergenic
1032914967 7:136479547-136479569 CAAATTCCTGGCTGTACCCAGGG + Intergenic
1034558106 7:151862799-151862821 AACAGTGCTCCCTGTACCCAGGG - Intronic
1036199322 8:6754143-6754165 AACATTCTTACCTGTCCACAGGG + Intronic
1038630843 8:29242308-29242330 AACATTAATGCCTGTCACCATGG - Intronic
1038763409 8:30405697-30405719 AATATCAATGACTGTACCCAAGG - Intronic
1039527143 8:38226919-38226941 AACATTTATGCCTGCTACCATGG + Intronic
1042567253 8:70124607-70124629 CACCTTCATGCCTGCACCCGAGG - Intronic
1042839584 8:73110331-73110353 AAAATTCATTCATGTATCCATGG + Intronic
1042840217 8:73116225-73116247 AACAATCAAACCTGTACCCTTGG - Intronic
1043234726 8:77848862-77848884 AAAATTCATCACTATACCCAAGG + Intergenic
1048191069 8:132289663-132289685 AAAATCCATGTCTTTACCCATGG - Intronic
1048295979 8:133213380-133213402 CACATTCATGGCTGTCCCCAGGG + Intronic
1057242015 9:93419738-93419760 ACCATGCCTGCCTGTACCTATGG - Intergenic
1058561378 9:106232665-106232687 AACAGTCATGCCTGAACTCAGGG - Intergenic
1058764268 9:108165999-108166021 AACATTCATACCTATACTCATGG - Intergenic
1058818806 9:108710240-108710262 CACACTCAAGCCTGTAGCCATGG + Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1062111729 9:134785591-134785613 ACCATTCCTGCCTGAGCCCAGGG - Intronic
1062178472 9:135177413-135177435 TACATGCATACCTGTACGCATGG + Intergenic
1062178517 9:135177948-135177970 CACATGCATACCTGTACACATGG + Intergenic
1186298997 X:8178317-8178339 AACATTCATCCCAGGGCCCAAGG - Intergenic
1186733791 X:12439521-12439543 ATGATTCATGCCTGTTTCCATGG - Intronic
1187686244 X:21818414-21818436 AACCTTCATGCCTGAAAACACGG + Intergenic
1189015991 X:37096936-37096958 AATATCAATGACTGTACCCAAGG - Intergenic
1189779409 X:44499763-44499785 AAGATCCTAGCCTGTACCCATGG - Intergenic
1194015397 X:88613216-88613238 CACATTCCTGCCTCAACCCACGG + Intergenic
1195560118 X:106273619-106273641 AAGAGTCATGCCTGTATACAAGG - Intergenic
1195561844 X:106292720-106292742 AAGAGTCATGCCTGTATACAAGG + Intergenic
1195564194 X:106323156-106323178 AAACTCCATGCCAGTACCCATGG + Intergenic
1196612011 X:117726299-117726321 ATCATTAAGGCCTGTACTCATGG + Intergenic
1201439742 Y:13994604-13994626 AACATTCATCCCAGGGCCCAAGG - Intergenic
1201444829 Y:14048104-14048126 AACATTCATCCCAGGGCCCAAGG + Intergenic