ID: 905684449

View in Genome Browser
Species Human (GRCh38)
Location 1:39898778-39898800
Sequence GGTGTTATGAGCCCCATATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905684449_905684458 27 Left 905684449 1:39898778-39898800 CCAGATATGGGGCTCATAACACC 0: 1
1: 0
2: 1
3: 3
4: 69
Right 905684458 1:39898828-39898850 CTTCTCATTCACTGGCTTGAAGG 0: 1
1: 0
2: 1
3: 16
4: 216
905684449_905684455 19 Left 905684449 1:39898778-39898800 CCAGATATGGGGCTCATAACACC 0: 1
1: 0
2: 1
3: 3
4: 69
Right 905684455 1:39898820-39898842 GACACGCCCTTCTCATTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 90
905684449_905684451 -3 Left 905684449 1:39898778-39898800 CCAGATATGGGGCTCATAACACC 0: 1
1: 0
2: 1
3: 3
4: 69
Right 905684451 1:39898798-39898820 ACCAGAGACCTGGAGACACCTGG 0: 1
1: 0
2: 3
3: 37
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905684449 Original CRISPR GGTGTTATGAGCCCCATATC TGG (reversed) Intronic
903274105 1:22209846-22209868 GAAGTTAAGAGACCCATATCTGG - Intergenic
904279621 1:29409634-29409656 GGTGTTCTGAGGCTTATATCAGG + Intergenic
904373143 1:30063385-30063407 AGTGTTAGGAGCCCCAAAGCTGG - Intergenic
905684449 1:39898778-39898800 GGTGTTATGAGCCCCATATCTGG - Intronic
906582909 1:46951198-46951220 GGTGACATGTGCCCTATATCAGG - Intergenic
907286308 1:53382604-53382626 GGGGTTAAGAGCTCCAAATCTGG + Intergenic
907966322 1:59333402-59333424 GGTGTGATGAGCTCAACATCTGG - Intronic
915055822 1:153129023-153129045 AGTTTTGTTAGCCCCATATCAGG + Intergenic
923746975 1:236710591-236710613 GGCGTTGTGAGCCCCTGATCTGG - Intronic
1066238064 10:33506235-33506257 GGTTTTAGGAACCCCATGTCAGG + Intergenic
1069546609 10:69333697-69333719 GCTGTTATGAACCCCACATGAGG - Intronic
1072818392 10:98531877-98531899 GGTATTATGATCCCCATTTGTGG - Intronic
1073830948 10:107382513-107382535 GGTGTTATGATCCCCCGAACAGG - Intergenic
1077515404 11:2998729-2998751 GGGGTTTAGAGCCCCAGATCGGG + Intergenic
1078324053 11:10364922-10364944 GGTTTTAGGAGCTCCATGTCAGG - Intronic
1080302869 11:30804071-30804093 GGGATTATGAGCACCATGTCAGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1083334408 11:61914344-61914366 GGTATGATGAGCCCCGTCTCTGG + Intronic
1086597015 11:88584890-88584912 AGTGTTGTGAACCCCATCTCAGG - Intronic
1091219146 11:133920197-133920219 GGTGGTATGAGCCCCAGCCCCGG - Exonic
1091999290 12:5019350-5019372 GGTTTTCTGATCCCCAAATCTGG + Intergenic
1096278132 12:50228156-50228178 GGTGTGATAAGTACCATATCAGG - Intronic
1103632819 12:122276317-122276339 CGTGTTAAGAGCTCCATTTCAGG + Intronic
1115997937 14:39212551-39212573 GGTCGTAAGAGCCCCATTTCTGG + Intergenic
1118454797 14:65934701-65934723 GGTCTTATTAGCCCCATTTTAGG - Intergenic
1132833178 16:1939532-1939554 GCTGTTAACAGCCCCATTTCAGG + Intronic
1132898173 16:2238625-2238647 GGTGTTGTGAGCCCCATGAGGGG + Exonic
1137379105 16:47981369-47981391 GGTGTTATGAGCCCCATGCCAGG - Intergenic
1141802013 16:86316124-86316146 GGTGATATGATCCCGATACCAGG - Intergenic
1146920164 17:36704727-36704749 GGTGTTAAGAGGCCCAAACCAGG - Intergenic
1147239338 17:39080345-39080367 GGGTTTATGACCCCCATTTCTGG + Intronic
1148809219 17:50279604-50279626 GGTAGTAAGAGCCCCATTTCTGG + Exonic
1149318670 17:55462829-55462851 GGGGTTATGAGCCTCAGATGTGG + Intergenic
1151315222 17:73317659-73317681 GGTGTTCTAAGCCCCACATCTGG - Intergenic
1151419296 17:73986862-73986884 GGTGCCATCAGCCCCATTTCTGG - Intergenic
1154314961 18:13297274-13297296 GGTGCTATGATCCCCACCTCGGG - Intronic
1155542598 18:26884077-26884099 GGTATTATGATCCACATAGCAGG - Intergenic
1155914895 18:31547229-31547251 GAAGTTATGAGCACCATAGCTGG - Exonic
1158160380 18:54475815-54475837 GGTTACATTAGCCCCATATCTGG - Intergenic
1159896779 18:74004525-74004547 GGTGTTCTAAGTCCCAAATCTGG + Intergenic
1161238608 19:3209835-3209857 GGTGTTCTGAGCCCCATAGTTGG - Intergenic
1202660819 1_KI270708v1_random:69149-69171 GGTGTTTTCTGCCCCATCTCTGG + Intergenic
927504973 2:23607019-23607041 GGTCTCATGAGCCCCATATGAGG + Intronic
927890730 2:26746758-26746780 GTTGTTAAGAGCCCCATGTAAGG - Intergenic
928788174 2:34915748-34915770 GGGATTGTGAGCCCCATATTTGG - Intergenic
931228136 2:60351614-60351636 GGTGTCATGGGATCCATATCTGG - Intergenic
936975027 2:118210237-118210259 TCAGTTATGATCCCCATATCTGG + Intergenic
941352080 2:164449442-164449464 GGTGATAAGAACCCCATTTCTGG + Intergenic
942526847 2:176861929-176861951 GGTTTTAGGAGCTCCATGTCAGG + Intergenic
943650876 2:190456494-190456516 GGTGATATGAGCCCCACTCCGGG + Intronic
1172613355 20:36267485-36267507 GCTGATATGAGCCCCCCATCTGG + Intronic
1182452437 22:30429439-30429461 GGTGGTGTCAGCCCCATATGAGG + Intergenic
963044548 3:141093084-141093106 GGTGTCAGGAGCCCTATACCTGG + Intronic
965408863 3:168304434-168304456 GGTTTTAGGAGCCCCATGCCAGG + Intergenic
968274067 3:197426410-197426432 GGTGCTCTGAGCCCCATTCCAGG - Intergenic
973879486 4:55254743-55254765 AGGGTTATGACCCCCATTTCTGG + Intergenic
974485907 4:62505755-62505777 GGTGTTATCATCCCTATAGCTGG + Intergenic
974764945 4:66331883-66331905 GATGTTATGAGCACCACATGTGG + Intergenic
975783049 4:77859784-77859806 TTTATTATTAGCCCCATATCAGG + Intergenic
979056044 4:115996212-115996234 GGTGTTAAGAGCCACAAATGTGG - Intergenic
991457773 5:66822860-66822882 GGTGTTAGGAGCCCAAACTCTGG + Intronic
1001414408 5:171534561-171534583 GGTGCCATGATCCCCAAATCGGG + Intergenic
1001899299 5:175411126-175411148 GATGTTATCTGCCCCTTATCAGG + Intergenic
1004253547 6:14042462-14042484 GGGGCTCTCAGCCCCATATCAGG - Intergenic
1005410302 6:25538533-25538555 GGTTTTAGAAGCTCCATATCAGG - Intronic
1007065833 6:38989600-38989622 TCTGGTATGAGCCCCATGTCGGG + Intronic
1037564814 8:20108851-20108873 GGTGTTCTGATTCCCATTTCAGG + Intergenic
1050661830 9:7891343-7891365 GGAACTATGAGACCCATATCAGG + Intergenic
1055150344 9:72990603-72990625 AGTGTTCAGAGCCCCATATTAGG + Intronic
1058798414 9:108520529-108520551 GGTCTTATGATCACCATTTCAGG - Intergenic
1188693125 X:33155098-33155120 GTTGTTATTAGCCACAAATCAGG - Intronic
1191102449 X:56746527-56746549 GGTCTGATGAGACCCATAGCAGG - Intergenic
1196032770 X:111108974-111108996 GGTGTTAGGAGCACCAACTCTGG + Intronic
1202071625 Y:20997628-20997650 GGTGATATGAGCCTCCTGTCTGG - Intergenic