ID: 905690662

View in Genome Browser
Species Human (GRCh38)
Location 1:39940504-39940526
Sequence GGGCAAAAGGAGGCCCGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905690657_905690662 -1 Left 905690657 1:39940482-39940504 CCAACATGCTTTTTGTGCAGATG No data
Right 905690662 1:39940504-39940526 GGGCAAAAGGAGGCCCGAAGAGG No data
905690655_905690662 21 Left 905690655 1:39940460-39940482 CCGTCACAAAGCTCTGGGTTGCC No data
Right 905690662 1:39940504-39940526 GGGCAAAAGGAGGCCCGAAGAGG No data
905690656_905690662 0 Left 905690656 1:39940481-39940503 CCCAACATGCTTTTTGTGCAGAT No data
Right 905690662 1:39940504-39940526 GGGCAAAAGGAGGCCCGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905690662 Original CRISPR GGGCAAAAGGAGGCCCGAAG AGG Intergenic
No off target data available for this crispr