ID: 905690729

View in Genome Browser
Species Human (GRCh38)
Location 1:39940831-39940853
Sequence AAGCTGCGCAACGCCAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905690729_905690730 9 Left 905690729 1:39940831-39940853 CCAAGGCTGGCGTTGCGCAGCTT No data
Right 905690730 1:39940863-39940885 TGTCATTCTTAACGTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905690729 Original CRISPR AAGCTGCGCAACGCCAGCCT TGG (reversed) Intergenic
No off target data available for this crispr