ID: 905690851

View in Genome Browser
Species Human (GRCh38)
Location 1:39941537-39941559
Sequence GACTGAAGAGATTTTAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905690847_905690851 9 Left 905690847 1:39941505-39941527 CCAGAAGTCAGGTGGTAGATCTG No data
Right 905690851 1:39941537-39941559 GACTGAAGAGATTTTAGCACTGG No data
905690845_905690851 17 Left 905690845 1:39941497-39941519 CCTTTTCTCCAGAAGTCAGGTGG No data
Right 905690851 1:39941537-39941559 GACTGAAGAGATTTTAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905690851 Original CRISPR GACTGAAGAGATTTTAGCAC TGG Intergenic