ID: 905693620

View in Genome Browser
Species Human (GRCh38)
Location 1:39959983-39960005
Sequence TCTGCCAGGAGCCACCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 257}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905693620_905693630 6 Left 905693620 1:39959983-39960005 CCTTCAGGGTGGCTCCTGGCAGA 0: 1
1: 0
2: 1
3: 25
4: 257
Right 905693630 1:39960012-39960034 GATGGGGTAATACCCGGAATGGG 0: 1
1: 0
2: 0
3: 1
4: 29
905693620_905693631 7 Left 905693620 1:39959983-39960005 CCTTCAGGGTGGCTCCTGGCAGA 0: 1
1: 0
2: 1
3: 25
4: 257
Right 905693631 1:39960013-39960035 ATGGGGTAATACCCGGAATGGGG 0: 1
1: 0
2: 0
3: 3
4: 66
905693620_905693626 -10 Left 905693620 1:39959983-39960005 CCTTCAGGGTGGCTCCTGGCAGA 0: 1
1: 0
2: 1
3: 25
4: 257
Right 905693626 1:39959996-39960018 TCCTGGCAGAGCAGGGGATGGGG 0: 1
1: 0
2: 3
3: 54
4: 519
905693620_905693634 28 Left 905693620 1:39959983-39960005 CCTTCAGGGTGGCTCCTGGCAGA 0: 1
1: 0
2: 1
3: 25
4: 257
Right 905693634 1:39960034-39960056 GGTAGCAAACCCATAACCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 196
905693620_905693629 5 Left 905693620 1:39959983-39960005 CCTTCAGGGTGGCTCCTGGCAGA 0: 1
1: 0
2: 1
3: 25
4: 257
Right 905693629 1:39960011-39960033 GGATGGGGTAATACCCGGAATGG 0: 1
1: 0
2: 0
3: 2
4: 52
905693620_905693628 0 Left 905693620 1:39959983-39960005 CCTTCAGGGTGGCTCCTGGCAGA 0: 1
1: 0
2: 1
3: 25
4: 257
Right 905693628 1:39960006-39960028 GCAGGGGATGGGGTAATACCCGG 0: 1
1: 0
2: 1
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905693620 Original CRISPR TCTGCCAGGAGCCACCCTGA AGG (reversed) Intronic
900199797 1:1399337-1399359 TTCGCGAGGAGCCGCCCTGAGGG - Intronic
900923379 1:5688011-5688033 TCTCCCAGGACCCACACAGAGGG + Intergenic
901642857 1:10701840-10701862 TCGTCCAGGAGCCGACCTGAGGG + Intronic
901929120 1:12585712-12585734 TCTGGCAGGAGCCACCTGGGCGG - Intronic
902060174 1:13635210-13635232 GCTACCAGCACCCACCCTGATGG - Intergenic
903128919 1:21265827-21265849 AGTGCCAGGAGCCACACTGTTGG - Intronic
903237311 1:21958400-21958422 ATTGCCAGGAGCCACTCTGCTGG - Intergenic
903666370 1:25009984-25010006 TCTGGCTTGAGGCACCCTGAAGG + Intergenic
905693620 1:39959983-39960005 TCTGCCAGGAGCCACCCTGAAGG - Intronic
905865132 1:41372406-41372428 TCCCCCAGGAGCCAGCCTGCAGG + Intronic
905905916 1:41618462-41618484 GCTGCCAGGAGCCACAAGGATGG - Intronic
906172145 1:43735482-43735504 TCTGCCAGGGGCCAGCCTTCAGG - Intronic
906477885 1:46182089-46182111 TCTGGCATGAGCAACCCAGATGG + Intronic
906702648 1:47871295-47871317 TCTGGGAGGGGCCACACTGACGG - Intronic
907284817 1:53372782-53372804 CCTGACAGGCGCCATCCTGATGG - Intergenic
908659356 1:66420796-66420818 TCTGTCATTAACCACCCTGAGGG + Intergenic
910807843 1:91206301-91206323 TCTGCTAGAAGCCACAGTGAAGG + Intergenic
911048429 1:93648847-93648869 GCAGCCAGGAGCCAGGCTGAGGG - Intronic
912503368 1:110137302-110137324 TCTGCCAGGAGACAACAAGAAGG - Intergenic
912530465 1:110317308-110317330 ACTGCCCGGAGCCACCATCAAGG - Intergenic
913383062 1:118231123-118231145 TCTGTCATTAACCACCCTGAGGG - Intergenic
916210613 1:162356906-162356928 TGTGGCAGGAGCCATCTTGAGGG - Intronic
917642770 1:176998804-176998826 TGTGCCAGGCGGCACCGTGACGG + Intronic
920571170 1:207019077-207019099 TCTGGCAGGGGCCGCCCTGTAGG - Exonic
923255147 1:232215523-232215545 AGTTCTAGGAGCCACCCTGATGG - Intergenic
1062920531 10:1275401-1275423 GCTGCCTGGAGCCGCCCTGCAGG - Intronic
1065020279 10:21496777-21496799 TCCGCCGTGCGCCACCCTGAGGG + Exonic
1065410191 10:25417766-25417788 GATGCCAGAAGACACCCTGAGGG + Intronic
1065834548 10:29644898-29644920 TCTGACAGGAGTCAGCCTGTGGG + Intronic
1066428141 10:35327848-35327870 CCAGCCAGGAGCCACCATGGAGG - Intronic
1069638813 10:69941996-69942018 GCTGGCTGGAGCCACCCTCAGGG + Intronic
1070282937 10:75063010-75063032 TCTGCCTGGCCCCTCCCTGAAGG - Intergenic
1070915927 10:80154718-80154740 TCAGCCTGGAGGCACCCTGAGGG + Exonic
1072333918 10:94380500-94380522 TCTTCCAGAAGCCACAGTGAAGG + Intergenic
1075228011 10:120646912-120646934 AGTGGCAAGAGCCACCCTGAGGG - Intergenic
1075429338 10:122367217-122367239 TCTCCCTGGAGCCAGCCTGAGGG + Intergenic
1076996492 11:299687-299709 TCTGTCAGGAGGGACCCTGCTGG - Intergenic
1077159800 11:1107519-1107541 CCTGGGAGGAGCCACCCTCACGG + Intergenic
1077159822 11:1107604-1107626 CCTGGGAGGAGCCACCCTCACGG + Intergenic
1077298390 11:1836439-1836461 GCTGCCAGGGGCCACCCTGCAGG + Exonic
1078093832 11:8284214-8284236 CCTTGCAGGAGCCACCCTAAGGG - Intergenic
1079698186 11:23510449-23510471 TCTGCTAGGAGCCACCATCAAGG + Intergenic
1081059267 11:38452644-38452666 TCTGTCAGGAGACATCCTTAAGG - Intergenic
1083027775 11:59564960-59564982 TCTGCCAGGAGCTTCTCTGTTGG + Intergenic
1083427388 11:62595478-62595500 TCTTCTAGGAGCCACACTCAAGG - Exonic
1084745267 11:71166082-71166104 TTTGCCAGGAGCCTCCTTCAAGG - Intronic
1085519549 11:77130065-77130087 TCTGCACAGAGCCATCCTGAGGG + Intronic
1088972993 11:114789903-114789925 TCTGCCCGGAGCCACCTGGCAGG + Intergenic
1091025201 11:132135615-132135637 ACTGCTAGGGGCCACCCTGGGGG + Intronic
1091723916 12:2832869-2832891 GCTGCCAGGAGCAACCCCAAGGG - Intronic
1092270238 12:7018173-7018195 TCTTCCCGGAGCCACCCGGGAGG - Intronic
1095294207 12:40509962-40509984 TGTGCCAGGAGCTGCCCTGGTGG - Intronic
1095409069 12:41902596-41902618 AATGCCAGGAGCCACCCTGGAGG - Intergenic
1096384883 12:51188727-51188749 CCTCCCATGATCCACCCTGAGGG - Exonic
1096607487 12:52777067-52777089 GCTGCCAGCTGCCACGCTGATGG + Exonic
1097244732 12:57601237-57601259 TCTCCCAGGAGCCCCCCAGAAGG + Exonic
1097519119 12:60645986-60646008 TCTGACTGTAGCCATCCTGAGGG + Intergenic
1098271989 12:68778055-68778077 GCTGCAATGAGCCACCGTGATGG + Exonic
1101411810 12:104474924-104474946 TAAGCAAGGAGCCACTCTGATGG - Intronic
1102007044 12:109595706-109595728 TAGGCCAGGAGCGAGCCTGAGGG - Intronic
1103933558 12:124463419-124463441 TCAGGCTGCAGCCACCCTGATGG + Intronic
1103967369 12:124648263-124648285 TGTGCCAGGCACCAGCCTGAGGG - Intergenic
1104306636 12:127615806-127615828 TCTGCCATTAACCACCCCGAGGG - Intergenic
1109138960 13:58689493-58689515 TCTGGCAGCAGCCAACCTGAAGG + Intergenic
1112345308 13:98584437-98584459 TCTGTCAGATGCCACACTGACGG - Intergenic
1112412503 13:99176510-99176532 CCTGCCAGGAGCACCCCTGCGGG - Intergenic
1113674639 13:112198821-112198843 GCTGACAGGAGCCATCCTGCTGG - Intergenic
1113924640 13:113934762-113934784 TGTGCTGTGAGCCACCCTGATGG + Intergenic
1115075133 14:29379990-29380012 TCTGCCAGGAGCTAACATCATGG - Intergenic
1117514206 14:56484372-56484394 ACTGCCAGAAGCAAACCTGATGG + Intergenic
1119087792 14:71753306-71753328 TGTGCCAGGAGAAATCCTGAAGG + Intergenic
1122199582 14:100114352-100114374 TCTGCCAAGAGATACCCTGTAGG - Intronic
1122416868 14:101554227-101554249 TCTGCCATGTGCAACCCTAAAGG + Intergenic
1122849158 14:104517444-104517466 AGTACCAGGAGCCATCCTGAGGG + Intronic
1122881746 14:104693386-104693408 TCAACCAGGAGCCACACTGGGGG + Intronic
1124399964 15:29339269-29339291 TATGCTAAGAGCCACTCTGAAGG - Intronic
1124656885 15:31516107-31516129 TCTGCCAGGAGGCTCCATGCTGG - Intronic
1124880707 15:33640030-33640052 TCTGCCAGGCACTCCCCTGAGGG + Intronic
1125779686 15:42253530-42253552 CCTGCCTGGAGGCTCCCTGAAGG - Intronic
1125980642 15:43997482-43997504 ATTGCCAGCAGGCACCCTGAAGG - Intronic
1126101138 15:45119004-45119026 TCTGGTAACAGCCACCCTGAGGG + Intronic
1127510088 15:59631976-59631998 TCTGCTAGTAGCCATCCTTATGG + Intronic
1128031897 15:64488443-64488465 ACTGCAAGCACCCACCCTGAGGG - Intronic
1131434128 15:92409672-92409694 TGTGCCACGAGCCACCCTGCTGG + Intronic
1132383111 15:101380312-101380334 TCATTCAGGAGCCGCCCTGACGG + Intronic
1132553355 16:562240-562262 CCTGCCCGAAGCCACCCAGATGG + Intronic
1132603082 16:782559-782581 TCCTCCTGGAGCCAGCCTGATGG + Intronic
1133110591 16:3545838-3545860 GGTCCCAGAAGCCACCCTGAGGG + Intronic
1133194781 16:4161383-4161405 TTTGACAGTAGCCACCCGGATGG - Intergenic
1135511535 16:23088691-23088713 TTTTCCAGGAGGCACCCTGTTGG + Intronic
1135559508 16:23465112-23465134 TGAGCCAGGCACCACCCTGAAGG - Exonic
1137056633 16:35749276-35749298 GCTGCCAGGACAGACCCTGACGG - Intergenic
1137433284 16:48435476-48435498 CCTGCCGGGAGCACCCCTGATGG + Intronic
1139340088 16:66262766-66262788 TGTGCCAGGAGCCAGGCTGATGG - Intergenic
1139422787 16:66859288-66859310 TCTGCCCCAGGCCACCCTGAAGG + Intronic
1140508843 16:75492939-75492961 TCTGCCAGGAGATACCCTAGAGG + Intronic
1141448799 16:84082415-84082437 TCTGGGATGAGCCACCCTGATGG + Intronic
1141823507 16:86463668-86463690 GCTGCCTGGAGCCACTCTGTGGG - Intergenic
1141971680 16:87488392-87488414 ACTTCCAGTAGCCACACTGATGG - Intronic
1142306161 16:89287102-89287124 TCTGCCAGCAGCCCCCATGATGG - Intronic
1143564868 17:7715332-7715354 TATGCCAGCAGCCTCCCTGCCGG - Intergenic
1144806509 17:17971821-17971843 TCTGCCAGGAGGCACCCCTGAGG - Intronic
1146310974 17:31768050-31768072 TCTGTCATTAACCACCCTGAGGG - Intergenic
1146993256 17:37295197-37295219 TCTGGCCGGGGCCACTCTGAAGG - Intronic
1147263039 17:39219848-39219870 TCTGCCTGGAGCCAGGCTGCTGG - Intronic
1147570960 17:41570785-41570807 TCTACCCAGAGCAACCCTGAGGG + Intronic
1148579328 17:48732994-48733016 TCTGCCAGGAGGCTCCCAGCAGG - Intergenic
1149516128 17:57282337-57282359 CCTCCAAGGAGCCATCCTGAAGG + Intronic
1150221544 17:63498203-63498225 GCTGCCAGCAGCCACCCTGCTGG + Intronic
1152111368 17:78359359-78359381 GCTGCCCGGGGCCACCCTGCCGG - Intronic
1152390780 17:80002515-80002537 CATGACAGGGGCCACCCTGAGGG + Intronic
1152462997 17:80451022-80451044 GCTGAGAGGAGCCACCCTGGTGG + Intergenic
1153665779 18:7366864-7366886 GCTGCCAGGAACTACCCTGTTGG - Intergenic
1153915703 18:9742321-9742343 CCTGCCAGGAACTTCCCTGAAGG - Intronic
1154003830 18:10508566-10508588 TCTGCCTGGTGGCTCCCTGAGGG - Intergenic
1154172895 18:12063683-12063705 TCTGCCAAGGGCAGCCCTGAGGG + Intergenic
1155251402 18:23956632-23956654 TCTGCAAATAGCCACACTGAGGG - Intergenic
1157390942 18:47302908-47302930 CCTACCTTGAGCCACCCTGAGGG + Intergenic
1158398170 18:57095921-57095943 CTTGTCAGCAGCCACCCTGAAGG - Intergenic
1158696748 18:59710360-59710382 TCTCCCAGATCCCACCCTGAGGG - Intergenic
1160196487 18:76759538-76759560 TCTCCCATCAGCCACCCTGAGGG - Intergenic
1160365668 18:78324051-78324073 TTTGCGAGCAGCCACCTTGATGG - Intergenic
1160774413 19:848428-848450 CCTGCCCAGGGCCACCCTGATGG - Intergenic
1162451369 19:10757154-10757176 TCTGCCAGCAGCGCCCCTGGGGG + Intronic
1163109834 19:15152916-15152938 TCAGGCAGGTGGCACCCTGAGGG + Intergenic
1163206473 19:15807212-15807234 TCTGGAAGGAGACACCTTGATGG - Exonic
1164158304 19:22609983-22610005 TCTCCCAGGAGTCAGCCTGCTGG + Intergenic
1165250826 19:34532320-34532342 TCTGCCAGGAGCAACCTCCAAGG + Intergenic
1165673754 19:37703457-37703479 TTTACCAGTAGCCATCCTGATGG - Intronic
1165744901 19:38224703-38224725 TCTCCCAGCAGCCACGCTCACGG + Intronic
1166309871 19:41956920-41956942 TCCTGCAGGAGCCACCCTGGTGG - Exonic
1167272508 19:48513819-48513841 TCTCCAATGAGACACCCTGAGGG - Intergenic
1167598020 19:50437477-50437499 TCTGCCCAGAGGCATCCTGACGG - Exonic
1167711493 19:51114232-51114254 TTTGCAGGGAGCCACCCTGAGGG - Intergenic
1168459430 19:56541030-56541052 TCTGGGAGGAGCCACCATGTGGG - Intronic
926001617 2:9338091-9338113 TCTGCCAGGATGGACCCTGTTGG + Intronic
927236676 2:20881240-20881262 TGTCCCAGGAGCCATCCTGGAGG + Intergenic
928481654 2:31690104-31690126 TCTGACTGTAGCTACCCTGAGGG + Intergenic
928582449 2:32722910-32722932 GCTGCCAAGAGCGACACTGATGG + Intronic
931758330 2:65394345-65394367 GGCGCCAGCAGCCACCCTGATGG - Intronic
931982345 2:67707317-67707339 CATGACAGGAGCCAGCCTGATGG + Intergenic
933368631 2:81387752-81387774 TCTGACTGTAGCCATCCTGAGGG - Intergenic
935356038 2:102200772-102200794 TCTCCCAGCAACCACCCAGAGGG - Intronic
936899760 2:117469650-117469672 TCTGACTGCAGCCATCCTGAGGG + Intergenic
937906906 2:127056903-127056925 TCAGCAAGGAGCCACGCAGAGGG - Intronic
938010250 2:127823081-127823103 TCTGACTGTAGCCATCCTGAGGG - Intergenic
939909568 2:147963250-147963272 TCTGCCAGAGGCAACCCTCAGGG - Intronic
941272985 2:163453736-163453758 TATGCCGGGATCCACCCTGATGG + Intergenic
941450371 2:165653426-165653448 TCTGCCAGGGGCCCAGCTGAAGG + Intronic
944036328 2:195298654-195298676 TCTACCAGCAGCCACACTGGAGG - Intergenic
944432206 2:199645392-199645414 CCTGAGAGGACCCACCCTGAAGG - Intergenic
944667343 2:201968748-201968770 TGTGCCTGGAGACACCCTGCTGG - Intergenic
946282996 2:218679936-218679958 TGTGCCAGGAGCCACCTTGCTGG - Exonic
946412889 2:219523883-219523905 GCTGCAGGGAGCCACCGTGATGG - Intronic
947670672 2:231933689-231933711 TCTGCCAGAAGCACTCCTGAGGG - Intergenic
947868089 2:233415347-233415369 TCAGCTGGCAGCCACCCTGATGG - Intronic
948607963 2:239147877-239147899 TCTGCCAGAAGCAATTCTGATGG + Intronic
948627068 2:239275851-239275873 GGTGCCACGTGCCACCCTGAAGG + Intronic
1172028541 20:31966297-31966319 TCTGGCCCCAGCCACCCTGAGGG - Intergenic
1172081568 20:32345202-32345224 TCTGCCAGGGGAGACTCTGAAGG + Intergenic
1172847475 20:37938464-37938486 TCTGCCAGGAGGCCACGTGAAGG + Intronic
1172934554 20:38610329-38610351 TCTGCCACGTGACTCCCTGAGGG - Intronic
1173778487 20:45733073-45733095 TCTGCCAGGAGCAACCCACAGGG + Intergenic
1175436716 20:58957476-58957498 ACTGGCATGAGCCACCATGATGG - Intergenic
1175993854 20:62803705-62803727 TCTGCGAGGAGCTATCCTCATGG + Intergenic
1177058966 21:16347210-16347232 TCTGCCTGGTGCTAGCCTGATGG - Intergenic
1177631684 21:23736706-23736728 TCTGACAGGAGTCACACTGTCGG - Intergenic
1178692361 21:34760509-34760531 CCAGCCAGGAGCCAGCCTGCTGG - Intergenic
1179434352 21:41350049-41350071 ACTGCCTGGACCCACACTGAGGG + Intronic
1180879794 22:19195741-19195763 TCTGTCAGCAGCCACACTGTTGG - Intronic
1181083230 22:20427492-20427514 GCTTCCTGGAGCCACCCTCAGGG - Exonic
1183726334 22:39591947-39591969 TGTGCCAGGCGCCAGCCTGCCGG - Intronic
1185057555 22:48588760-48588782 TCTGCCAGGAGCATCCCCGAAGG - Intronic
1185266899 22:49909029-49909051 TCAGCCAGGAAACAGCCTGAGGG - Intronic
951160041 3:19407956-19407978 TCTGCCAGCAGGTTCCCTGATGG - Intronic
956250657 3:67230846-67230868 TTTGTCAGGGGTCACCCTGATGG + Intergenic
956700107 3:71951405-71951427 TCTGCCTGTAGCACCCCTGAAGG - Intergenic
957084596 3:75668566-75668588 TCAGGCAGAAACCACCCTGAAGG - Intergenic
959275900 3:104277372-104277394 TGGCCCAGGAGCCACGCTGATGG + Intergenic
959606783 3:108249834-108249856 TCAGCTAGGAGGCTCCCTGAAGG - Intergenic
961468762 3:127098153-127098175 TCTGCCAGGTGCCACACAGGAGG - Intergenic
961481259 3:127182690-127182712 TCTGCCAGGCCCCACCCCGACGG + Intergenic
963838454 3:150080321-150080343 TCAGCCAGCAGCCACCTTCAAGG + Intergenic
964816163 3:160719834-160719856 TCCCCCAGGAAGCACCCTGACGG + Intergenic
967188036 3:186961927-186961949 TCAGCTAGGAGCCACCCACAAGG - Intronic
968441945 4:628705-628727 TGTCCCAGGAGCCACCATGGAGG + Intronic
969280279 4:6166305-6166327 CCGGCCAGGAGCCTGCCTGAAGG + Intronic
969609954 4:8221772-8221794 TTTGCCAGGAGCCACAATGATGG + Intronic
970186079 4:13455185-13455207 TCTGCCAGAAGTCACCCAGTGGG + Intronic
971482214 4:27125022-27125044 TCTGGGAGGCGCCACCCTGTAGG + Intergenic
974990344 4:69079187-69079209 TGTCCCAGGAAACACCCTGATGG - Intronic
975647403 4:76558849-76558871 TTTGCTAGGATCCACTCTGATGG + Intronic
977727378 4:100311912-100311934 TCTGCCAGGAAGCACTCAGAGGG - Intergenic
980290447 4:130843646-130843668 TCTGTCATTAACCACCCTGAGGG + Intergenic
981092208 4:140743566-140743588 TGTGCAAAGAGCCACCCTCAGGG + Intronic
981483183 4:145258663-145258685 TCTGCCTGGAGAAAGCCTGATGG - Intergenic
982177736 4:152722112-152722134 TCTGCCAAGAGCCACCTAGTTGG - Intronic
983245999 4:165287681-165287703 TTTGCTAGTAGCCACCCTAATGG + Intronic
985827362 5:2202661-2202683 CCTGCCAGGGTTCACCCTGATGG + Intergenic
988337216 5:29922256-29922278 TCTGACTGCAGCCATCCTGAGGG + Intergenic
989635775 5:43531234-43531256 TCTGCCAGGAGCCACAGAGTAGG - Intronic
990257023 5:53981364-53981386 TAAGCCAGAAGGCACCCTGAGGG + Intronic
990350194 5:54908452-54908474 TCTCCCAAGGGCCAGCCTGATGG - Intergenic
990730992 5:58809308-58809330 TGTGCCAGAAGCCTCCTTGAAGG + Intronic
992553346 5:77880256-77880278 TCTGCCAGGGGCTGCCCTGGGGG + Intergenic
993035578 5:82753043-82753065 TTTGACAGTAGCCAACCTGATGG + Intergenic
996589289 5:125127837-125127859 TGTGACCTGAGCCACCCTGATGG - Intergenic
997895915 5:137717044-137717066 TCTGCCAGGGGCAGCACTGATGG + Intronic
997964275 5:138345315-138345337 TCTCCCAGGAGCCACTTTGAGGG - Exonic
998030845 5:138866548-138866570 TCTGCTAACAGCAACCCTGATGG - Intronic
999144894 5:149385862-149385884 TCTGCCAGGAGCGGCTCTGGGGG - Intronic
1001010318 5:168091797-168091819 TCTTCAAGAAGCCACCCTGTGGG - Intronic
1001039719 5:168325428-168325450 AATGCCAGGAACCAGCCTGAGGG - Intronic
1001668973 5:173458097-173458119 TTTGACAGTAGCCACCCTAATGG - Intergenic
1001762507 5:174220079-174220101 TCAGCCAGGAACCACCAGGATGG + Intronic
1002478832 5:179485978-179486000 TCTGCCAGAACCCACCCTGAGGG + Intergenic
1003544816 6:7051123-7051145 ACTCCCGGGAGCCGCCCTGAAGG + Intergenic
1006133304 6:31881388-31881410 TGTTCCAGGAGCCACCCGGCAGG + Intronic
1006263427 6:32895431-32895453 TCTGCCAGGCACCACCCTCTGGG + Intergenic
1006400543 6:33814735-33814757 TCTGCCAGGAGCAGCCCTACCGG + Intergenic
1006520193 6:34566912-34566934 TCTGCCAGCTGCCACACTCAGGG + Intergenic
1006897518 6:37480368-37480390 CCTGCCAGGACTCAGCCTGAAGG + Exonic
1007071901 6:39043998-39044020 TCTGGCAAGGGCCAGCCTGAGGG + Intergenic
1007496872 6:42266161-42266183 TATGCCAGGAGACCCCCTGATGG + Intronic
1007960819 6:45957476-45957498 CATGCCTGGAGCCAGCCTGAGGG + Intronic
1009936832 6:70244309-70244331 TCTCCCAGTATCCACCCTCATGG - Intronic
1011309559 6:85967132-85967154 TCAGCCAGGAGCCCTGCTGAGGG - Intergenic
1016310371 6:142727443-142727465 TCTGGAAGGAGCCTCACTGAGGG - Intergenic
1017797932 6:157864626-157864648 TCTCCCAGGCTCCACTCTGAGGG + Intronic
1018276100 6:162133208-162133230 GCTGCCTGGAGGCACCATGAGGG + Intronic
1018539218 6:164860014-164860036 TCTGCCACGAGCCTCCATTAAGG + Intergenic
1019194827 6:170274976-170274998 TCTGCAAAGGGTCACCCTGACGG - Intergenic
1019310719 7:359395-359417 TCTGCCCGGGGCCACCCAGCAGG + Intergenic
1020002678 7:4764706-4764728 GCTGCCTGTGGCCACCCTGATGG + Exonic
1021562639 7:21984228-21984250 TCTTACAGAAGCCACCCTGTGGG - Intergenic
1022286483 7:28958942-28958964 TCTTCCAGGTGCCACCCTGCGGG + Intergenic
1022704558 7:32790203-32790225 TCTGACTGGAGGCAGCCTGAGGG + Intergenic
1022904639 7:34843904-34843926 TCAGCCAGGAGCCACCCAGTGGG - Intronic
1022908734 7:34879945-34879967 TCTGACTGGAGGCAGCCTGAGGG + Intergenic
1024700220 7:51898812-51898834 TCTCCAAGAAGCCACCCAGAAGG + Intergenic
1025094629 7:56087640-56087662 GCTGCGAGAAGCCACGCTGAAGG - Exonic
1025188248 7:56877414-56877436 GCTGCAAGAAGCCACACTGAAGG - Intergenic
1025683678 7:63699506-63699528 GCTGCAAGAAGCCACACTGAAGG + Intergenic
1025790841 7:64685537-64685559 TCTACTAGGAGCCACTCAGAAGG - Intronic
1025930477 7:65989712-65989734 TCAGACAGGAGCCACCACGATGG + Intergenic
1026467958 7:70670842-70670864 GTTGACAGTAGCCACCCTGAAGG + Intronic
1026724424 7:72859482-72859504 CCAGCCAGGAGCCTCCCTGCAGG - Intergenic
1027160066 7:75795926-75795948 CCTGGCGGAAGCCACCCTGAAGG - Intergenic
1029107437 7:98189808-98189830 TGTGCCAGGAGAGACCCTGAGGG - Intronic
1029250665 7:99233831-99233853 CCAGCCAGGAGCTGCCCTGAGGG - Intergenic
1032488399 7:132305623-132305645 GCTGCCAGGAGCTCCCCGGATGG - Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1039692740 8:39879911-39879933 TCTGTCATTAACCACCCTGAGGG + Intergenic
1040616899 8:49046399-49046421 TCTGCCAGGATCCACGCTCTCGG - Intergenic
1040923410 8:52650109-52650131 TATGCCAGAAGCAACACTGAGGG - Intronic
1040971039 8:53138001-53138023 TCTGTCATTAACCACCCTGAGGG + Intergenic
1042540790 8:69905417-69905439 ACAGCCATGAGCCACCCTGCTGG - Intergenic
1043368489 8:79563039-79563061 TCTGATAGTAGCCACCCTAATGG - Intergenic
1044005020 8:86928932-86928954 TCTGTCATTAACCACCCTGAGGG + Intronic
1046567720 8:115922167-115922189 CATGCCAGGGACCACCCTGAAGG - Intergenic
1049554030 8:143273467-143273489 TCTCCCAGGGGCCGACCTGAGGG + Intronic
1053466359 9:38311522-38311544 GCTGCCAGGAGCTGTCCTGAAGG - Intergenic
1053612545 9:39729539-39729561 TCTCCCAGGAGCTCCCCTAAAGG + Intergenic
1053870582 9:42487510-42487532 TCTCCCAGGAGCTCCCCTAAAGG + Intergenic
1054085709 9:60741617-60741639 TCTCCCAGGAGCTCCCCTAAAGG - Intergenic
1054240969 9:62612853-62612875 TCTCCCAGGAGCTCCCCTAAAGG - Intergenic
1054555102 9:66647378-66647400 TCTCCCAGGAGCTCCCCTAAAGG - Intergenic
1054970372 9:71079353-71079375 TATGACAGAAGCCATCCTGAGGG - Intronic
1056545011 9:87606207-87606229 GCTCCCAGGCGCCACCCTGCAGG + Intronic
1056803030 9:89707212-89707234 TGGGCCAGGTGCCTCCCTGAAGG + Intergenic
1061181085 9:129025676-129025698 GCTCTCAGGAGCTACCCTGATGG + Intronic
1061613276 9:131762675-131762697 CCTCCCAGGAGCCACCCGGGAGG + Intergenic
1062218820 9:135403519-135403541 GCTGCCAGGAGCACCCCTGGAGG + Intergenic
1062425297 9:136503474-136503496 TCTGACAGCAGCTACCCTGCAGG + Intronic
1191204377 X:57818866-57818888 TCTGACTGTAGCCATCCTGAGGG + Intergenic
1193352643 X:80480454-80480476 TCTGACTGTAGCCATCCTGAGGG - Intergenic
1193383887 X:80848185-80848207 TTTGCCAGAAGCGACACTGATGG + Intergenic
1196974264 X:121141507-121141529 TCTGCCAGGAGCATCCCTTTTGG + Intergenic
1198294560 X:135273249-135273271 TCTGGCTGGGGCCACTCTGAAGG + Intronic
1199611177 X:149615959-149615981 TCTGCCATCTGCCACCCAGAAGG - Intronic
1199975668 X:152893620-152893642 TATCCCAGGAGCCTCCCTGCCGG + Intergenic
1201496202 Y:14593521-14593543 TCTGTCACCAACCACCCTGAAGG + Intronic
1201649866 Y:16273664-16273686 TCTGTCATTAACCACCCTGAGGG - Intergenic
1202598558 Y:26569190-26569212 ACTGGCGGGAGCCACCATGATGG + Intergenic