ID: 905701266

View in Genome Browser
Species Human (GRCh38)
Location 1:40017110-40017132
Sequence CAGCACAATCACACCCAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905701264_905701266 4 Left 905701264 1:40017083-40017105 CCAGTTTCTATAAATCAAGTTGT No data
Right 905701266 1:40017110-40017132 CAGCACAATCACACCCAGCCGGG No data
905701260_905701266 28 Left 905701260 1:40017059-40017081 CCCTAGATCAAATCTGGCCTGCC No data
Right 905701266 1:40017110-40017132 CAGCACAATCACACCCAGCCGGG No data
905701263_905701266 7 Left 905701263 1:40017080-40017102 CCTCCAGTTTCTATAAATCAAGT No data
Right 905701266 1:40017110-40017132 CAGCACAATCACACCCAGCCGGG No data
905701262_905701266 11 Left 905701262 1:40017076-40017098 CCTGCCTCCAGTTTCTATAAATC No data
Right 905701266 1:40017110-40017132 CAGCACAATCACACCCAGCCGGG No data
905701259_905701266 29 Left 905701259 1:40017058-40017080 CCCCTAGATCAAATCTGGCCTGC No data
Right 905701266 1:40017110-40017132 CAGCACAATCACACCCAGCCGGG No data
905701258_905701266 30 Left 905701258 1:40017057-40017079 CCCCCTAGATCAAATCTGGCCTG No data
Right 905701266 1:40017110-40017132 CAGCACAATCACACCCAGCCGGG No data
905701261_905701266 27 Left 905701261 1:40017060-40017082 CCTAGATCAAATCTGGCCTGCCT No data
Right 905701266 1:40017110-40017132 CAGCACAATCACACCCAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905701266 Original CRISPR CAGCACAATCACACCCAGCC GGG Intergenic
No off target data available for this crispr