ID: 905704605

View in Genome Browser
Species Human (GRCh38)
Location 1:40045418-40045440
Sequence CCCACCCAGAAATTCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905704605_905704611 30 Left 905704605 1:40045418-40045440 CCTTCAAGGAATTTCTGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 228
Right 905704611 1:40045471-40045493 TGATTGCAACCTCCAACTTTTGG 0: 1
1: 0
2: 14
3: 561
4: 8355
905704605_905704609 -5 Left 905704605 1:40045418-40045440 CCTTCAAGGAATTTCTGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 228
Right 905704609 1:40045436-40045458 GTGGGCAGGTTGGAGTACAATGG 0: 1
1: 0
2: 7
3: 339
4: 7887
905704605_905704610 6 Left 905704605 1:40045418-40045440 CCTTCAAGGAATTTCTGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 228
Right 905704610 1:40045447-40045469 GGAGTACAATGGTGCAATCATGG 0: 17
1: 650
2: 8199
3: 36537
4: 87350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905704605 Original CRISPR CCCACCCAGAAATTCCTTGA AGG (reversed) Intronic