ID: 905704605

View in Genome Browser
Species Human (GRCh38)
Location 1:40045418-40045440
Sequence CCCACCCAGAAATTCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905704605_905704609 -5 Left 905704605 1:40045418-40045440 CCTTCAAGGAATTTCTGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 228
Right 905704609 1:40045436-40045458 GTGGGCAGGTTGGAGTACAATGG 0: 1
1: 0
2: 7
3: 339
4: 7887
905704605_905704611 30 Left 905704605 1:40045418-40045440 CCTTCAAGGAATTTCTGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 228
Right 905704611 1:40045471-40045493 TGATTGCAACCTCCAACTTTTGG 0: 1
1: 0
2: 14
3: 561
4: 8355
905704605_905704610 6 Left 905704605 1:40045418-40045440 CCTTCAAGGAATTTCTGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 228
Right 905704610 1:40045447-40045469 GGAGTACAATGGTGCAATCATGG 0: 17
1: 650
2: 8199
3: 36537
4: 87350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905704605 Original CRISPR CCCACCCAGAAATTCCTTGA AGG (reversed) Intronic
901357667 1:8665312-8665334 CCCAGCTAGAAGTTCCTTGAGGG + Intronic
901855459 1:12041721-12041743 CCCAACCAAAGATTCCTGGAAGG - Intergenic
902293583 1:15451002-15451024 CCCACCCAGATAATCCAAGATGG - Intergenic
904169115 1:28578985-28579007 CCCACCCTAAAATGCATTGAAGG - Intergenic
905704605 1:40045418-40045440 CCCACCCAGAAATTCCTTGAAGG - Intronic
907474391 1:54695788-54695810 CCACACCAAAAATTCCTTGAGGG - Intronic
910293368 1:85619913-85619935 CTCATCCATAAATTCCTTTAGGG - Intergenic
911044048 1:93614308-93614330 CCGACCCAGAATTTCCTTCTGGG + Intronic
911848729 1:102787132-102787154 CCCATTCAGATATTCCTTTATGG - Intergenic
916095598 1:161347173-161347195 CCAACAGAGAAATTCCTTTATGG + Intronic
916519627 1:165552108-165552130 GCCACCCAGAAAATCCAAGAAGG + Intronic
917610417 1:176683710-176683732 GCCTGCCAGAAATTCCCTGAGGG - Intronic
918298228 1:183177933-183177955 CCCACTAGGAAATTCCTTGTGGG - Intergenic
918720114 1:187841836-187841858 CCCACAAGGAAATTCCTTGTAGG - Intergenic
919086015 1:192920576-192920598 CCAACCCAAAACCTCCTTGATGG - Intergenic
919814249 1:201427877-201427899 CCCACCCAGGCCTTCCTGGAGGG - Intronic
920700003 1:208210628-208210650 CTCACCCACAAATTCCATGTTGG + Intronic
921946610 1:220890162-220890184 CCAACCCAGAGAGTCGTTGAGGG - Intergenic
922847860 1:228703959-228703981 TCCACCAAGAATTTCCTTGTGGG - Intergenic
923656540 1:235921981-235922003 CCCACCCAGTAGTTCCATGACGG + Intergenic
923973518 1:239233056-239233078 CCCTCAAGGAAATTCCTTGAGGG + Intergenic
1062950031 10:1492261-1492283 CCCACCCAGAAAATACATGTTGG + Intronic
1066062167 10:31733812-31733834 CCCACAGAGAGATTCCTTGTGGG + Intergenic
1067718496 10:48708328-48708350 CCCAAACACACATTCCTTGAAGG - Intronic
1067807377 10:49402432-49402454 CCCATCCAGAAGTTCCTCTAGGG - Intergenic
1067854488 10:49780418-49780440 CCCATCCAGAAGTTCCTCTAGGG - Intergenic
1072226555 10:93375387-93375409 CCCACCCATAGATTGCTTAAAGG - Intronic
1072357131 10:94622923-94622945 CCCACAAGGAAATTCCTTGTGGG - Intergenic
1072723451 10:97795951-97795973 CTCACCAAGCAATTCCTTTAAGG - Intergenic
1073518913 10:104106695-104106717 CCCACTAGGAAATTCCTTGTGGG - Intergenic
1073541045 10:104316274-104316296 CCTACCCAGACATTCCTGGATGG + Intronic
1076104338 10:127808674-127808696 CCCACAAGGAAATTCCTTGTGGG + Intergenic
1077442343 11:2574585-2574607 CCCACCCAGATATGCTCTGATGG - Intronic
1077559714 11:3251913-3251935 CCCAGCAAGAATTTCCATGAGGG + Intergenic
1077565606 11:3297716-3297738 CCCAGCAAGAATTTCCATGAGGG + Intergenic
1077738259 11:4815371-4815393 CCCACGAAGAATTTCCTTGTGGG + Intronic
1079245082 11:18745952-18745974 CCCACCAAGAAGTTCCATGAAGG + Intronic
1083696428 11:64445876-64445898 CCCACCCAGAAAGTCTGTGGTGG + Intergenic
1083995158 11:66267999-66268021 CCCACCCCGGAATTGCGTGAGGG + Intergenic
1084628485 11:70328594-70328616 CCAACCCAGAAATCCCATTACGG - Intronic
1084778322 11:71391996-71392018 CCCACCCAGAAATATCTGGAAGG + Intergenic
1085538498 11:77243584-77243606 CACACACAGAAATTCCGAGATGG + Intronic
1088222107 11:107580358-107580380 CCCAGCTAGAAATTCTTTGAAGG + Intergenic
1089326637 11:117661924-117661946 CCCACCAAACAGTTCCTTGAAGG + Intronic
1089836440 11:121374579-121374601 CCCACAAGGAAATTCCTTGTGGG - Intergenic
1090251599 11:125255566-125255588 CTAACACAGAAATTCCTTGAGGG - Intronic
1091242304 11:134061831-134061853 CCCACAAGGAAATTCCTTGTGGG + Intergenic
1092554284 12:9539887-9539909 CCCACAAAGAATTTCCTTGTGGG + Intergenic
1094052021 12:26230598-26230620 CCCTCCCAGAAATTTTCTGATGG - Intronic
1094517816 12:31150743-31150765 CCCACAAAGAATTTCCTTGTGGG - Intergenic
1094772785 12:33684769-33684791 CCCACAGGGAAATTCCTTGTGGG + Intergenic
1096427176 12:51513850-51513872 CCAAGCCAGAAATTTCTTGAAGG - Exonic
1099649747 12:85410422-85410444 CTCACCTAGAAATTCCATGTAGG + Intergenic
1100529614 12:95451542-95451564 CCCATCCATGAATTCCTTGTGGG - Intergenic
1102212523 12:111137817-111137839 CCCACCCAGAATTTGCTTAGGGG + Intronic
1102888654 12:116541005-116541027 CCCACCCACCCATTCATTGATGG + Intergenic
1103601099 12:122055141-122055163 CCGACCCAGAGGCTCCTTGAGGG - Intronic
1106193659 13:27475435-27475457 CCCACCTAAAAATTCCTCGGGGG - Intergenic
1106226184 13:27789003-27789025 CCCACCCAGGAAGCCCTGGAGGG - Intergenic
1109601975 13:64643234-64643256 CCCACAGGGAAATTCCTTGTAGG + Intergenic
1110428807 13:75399705-75399727 TGCACCCATAAATTCTTTGATGG + Intronic
1110625449 13:77650340-77650362 CCCAGCCAGATATTTCTTTATGG + Intergenic
1112482848 13:99792756-99792778 CCCAAACAGAAATTCCTGCAAGG + Intronic
1112487232 13:99830918-99830940 CCCACCCAGATAATCCATGATGG - Intronic
1112730451 13:102354608-102354630 CCCACAAAGAATTTCCTTGTAGG + Intronic
1113474112 13:110567873-110567895 CCCACCCTGACATTCGTTCATGG + Intergenic
1114521786 14:23343845-23343867 CCCAGCCAGAAAATTCTTCATGG - Intergenic
1114576094 14:23715141-23715163 TCCCCCCAGTATTTCCTTGATGG + Intergenic
1116086294 14:40242748-40242770 CCCACAAAGAAATTCCTTGTGGG + Intergenic
1116426972 14:44802700-44802722 ATCACCCACAACTTCCTTGAGGG + Intergenic
1116747433 14:48838642-48838664 CACATTCAGAAAATCCTTGAAGG + Intergenic
1117094120 14:52280511-52280533 TCCACACGGAAATTCCTTGGGGG + Intergenic
1119230990 14:72979670-72979692 TACACCCAGAAATCCCTTGTTGG + Intronic
1120333746 14:83127209-83127231 CCCAACCTGTAATTCTTTGAGGG - Intergenic
1120585306 14:86305251-86305273 CCCACAGAGAAATTTTTTGAGGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122873240 14:104650963-104650985 CACTCCCAGCCATTCCTTGAAGG - Intergenic
1202854593 14_GL000225v1_random:42770-42792 CCCAGCCAGAAATTCATGGACGG - Intergenic
1124512737 15:30340582-30340604 CCCACCCAGAAATATCTGGTTGG + Intergenic
1124730178 15:32190168-32190190 CCCACCCAGAAATATCTGGTTGG - Intergenic
1125043777 15:35222849-35222871 CCCACAAGGAAATTCCTTGTGGG - Intronic
1130131494 15:81146915-81146937 CCCACAAGGAAATTCCTTGTGGG + Intronic
1134591804 16:15460749-15460771 CCAGCCCACAAATTCCTTGAGGG - Intronic
1135040978 16:19116037-19116059 CGCACCCAGGGCTTCCTTGAAGG + Exonic
1135224036 16:20639966-20639988 CCCACTAAGAAATTCCTTGTGGG + Intronic
1137417029 16:48292321-48292343 CCCACTGAGAAATTCCTTGTGGG - Intronic
1138218167 16:55223961-55223983 CTAACCCAGTAATTCCCTGAGGG - Intergenic
1139314161 16:66054077-66054099 CCCACAAGGAATTTCCTTGAGGG - Intergenic
1139718411 16:68832913-68832935 TCCACCCAGAAAGGCCTGGAAGG - Intronic
1141013111 16:80421865-80421887 CCCACTGTGAAATTCCTTAAAGG - Intergenic
1143515675 17:7418162-7418184 TCCCCACAGAAATTCTTTGAGGG - Exonic
1143798676 17:9359414-9359436 CCCAAAGAGAAATCCCTTGAAGG + Intronic
1143998270 17:11027993-11028015 CCAACCCAGAAACACCGTGAAGG + Intergenic
1144089496 17:11841698-11841720 CCCACAAGGAAATTCCTTGTGGG - Intronic
1144566307 17:16362415-16362437 CCCAGCCAGAAGTTCTTTAATGG + Intergenic
1145889093 17:28402428-28402450 CCCAGGAAGAACTTCCTTGATGG + Exonic
1148221545 17:45865898-45865920 TCCACAAAGAAATTCCTTGTGGG - Intergenic
1153867901 18:9290045-9290067 CCCCCACACCAATTCCTTGATGG + Intergenic
1153992550 18:10413203-10413225 CCCACACAGTAATGCCTTGCAGG - Intergenic
1155991516 18:32283732-32283754 GCCAACCAGAAAATCCTTGGGGG - Intronic
1157007864 18:43607492-43607514 CCCACCCAGATAATCCAGGACGG - Intergenic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1157409566 18:47452494-47452516 CCCATCCTGAAACTACTTGAAGG - Intergenic
1157761575 18:50269168-50269190 CCCACCCAGAAAAAACTTGCTGG - Exonic
1162198419 19:9003559-9003581 CCCACAAAGAATTTCCTTGTGGG - Intergenic
1162753657 19:12844113-12844135 CCCTCCCAGAAATGTGTTGAGGG - Intronic
1163812072 19:19439426-19439448 CCAACCCAGAAATGTCTTGGTGG - Intronic
1168173123 19:54602954-54602976 CTCTGCCAGAAATTCCTTGCTGG + Intronic
924998960 2:388505-388527 CCTGCCCAGAAAGTCCCTGATGG - Intergenic
925104229 2:1276266-1276288 CCAGCTCAGAAATTCCTAGATGG - Intronic
926250148 2:11150811-11150833 CCCACAAGGAAATTCCTTGTGGG + Intergenic
927947137 2:27142146-27142168 CCCACAAGGAAATTCCTTGTTGG + Intergenic
928261313 2:29769480-29769502 CCCACCTATAAGCTCCTTGAGGG + Intronic
929558224 2:42938623-42938645 CCCCCCCAAAAAACCCTTGAGGG + Intergenic
930324424 2:49897411-49897433 CCAACACGGAAATTTCTTGATGG + Intergenic
931649125 2:64453402-64453424 TCAAGCCAGAAATTCCTTTATGG - Intergenic
932212002 2:69939348-69939370 CACACCCAGAAACTTCTTTATGG + Exonic
932727617 2:74193129-74193151 CCCACAAGGAAATTCCTTGTGGG - Intergenic
935146598 2:100399676-100399698 CCCACCCAGCTCTTCCTTTATGG + Intronic
935160510 2:100525749-100525771 CCCACTAGGAAATTCCTTGTGGG + Intergenic
939614436 2:144346700-144346722 CCCACAAGGAAATTCCTTGTGGG + Intergenic
941906399 2:170718555-170718577 CCTAGCCAGAAATTCCTGGGTGG - Intergenic
942671899 2:178384825-178384847 CCCACAAAGAATTTCCTTGTGGG + Intronic
943598221 2:189882762-189882784 CCCACAAGGAAATTCCTTGTGGG - Intronic
943947426 2:194086108-194086130 CCCTCAAAGAAATTCCTTGTGGG + Intergenic
944959871 2:204859815-204859837 GCCACCAGGAAATTCCTTAAAGG - Intronic
948308879 2:236970305-236970327 ATCACCCAGAAAACCCTTGAAGG - Intergenic
1168884209 20:1234476-1234498 CACACCCAGAATCTCCTTGAGGG - Intronic
1170912043 20:20582366-20582388 GCCACCCAGCAATTCCTCGGAGG + Intronic
1171031976 20:21684953-21684975 CCCACTCAGAATTTCCCAGAGGG - Intergenic
1173079564 20:39852732-39852754 GCAACACAGAAGTTCCTTGAAGG + Intergenic
1173606956 20:44338168-44338190 CCCACCCAGAGATGTCTTTAGGG + Intronic
1173963804 20:47095896-47095918 CCAACCCAGAAATACAATGAAGG + Intronic
1177570585 21:22881059-22881081 CCCACCAGGAAATTCCTTGTGGG + Intergenic
1178835870 21:36096999-36097021 CCCACAAGGAAATTCCTTGCAGG + Intergenic
1179337138 21:40467975-40467997 CCCACTAGGAAATTCCTTGCGGG + Intronic
1179367070 21:40768494-40768516 CCCTCCCAGTAATTCCTGCAGGG + Intronic
1179672140 21:42956960-42956982 CCCACAAGGAAATTCCTTGAGGG + Intergenic
1179892328 21:44342426-44342448 CCCACAAGGAAATTCCTTGTGGG - Intergenic
1180722688 22:17921025-17921047 CCCACAAGGAAATTCCTTGTGGG + Intronic
1182453945 22:30437926-30437948 CCCACAAGGAAATTCCTTGTAGG - Intergenic
1183553845 22:38509616-38509638 CCCACAAAGAAATTCCTTGTGGG - Intergenic
1183607800 22:38876607-38876629 CCCACATGGAAATTCCTTGGGGG + Intergenic
1184579688 22:45407282-45407304 CCCACAGGGAAATTCCTTGTGGG + Intronic
1184585345 22:45444228-45444250 CCCACAAGGAAATTCCTTGTGGG - Intergenic
950576916 3:13837516-13837538 CTCACCCAGAAAATGCTTGCTGG - Intronic
952016987 3:28970080-28970102 CCCACCAAGAAAATCATAGATGG - Intergenic
953751889 3:45615471-45615493 CCCAGCCAGAAATTACTTAGTGG - Intronic
954002148 3:47566252-47566274 CCCACCCCCAAACTCCTTGCTGG - Intronic
954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG + Exonic
961791960 3:129382622-129382644 CCCACCCAGAAATGCCAGCAGGG + Intergenic
961806033 3:129489909-129489931 CCCACCCAGAAATGCCAGCAGGG + Intronic
962044593 3:131742126-131742148 CTCATCCAGAAATACCTTCACGG - Intronic
963534201 3:146507665-146507687 CCCACCCAAAAAAGCCTTGCAGG + Intergenic
966517158 3:180830292-180830314 CCCATCCAAAAATTTCTTAAAGG + Intronic
967823748 3:193862213-193862235 CCCAGCCATAAATCCTTTGATGG + Intergenic
968747730 4:2369575-2369597 CCCACCCAGAGAGTCCAGGATGG - Intronic
972222225 4:36968873-36968895 CCCACAAGGAAATTCCTTGTGGG - Intergenic
972708710 4:41571897-41571919 CAGAGCCTGAAATTCCTTGAGGG + Intronic
973200938 4:47501520-47501542 CCAACCCTCACATTCCTTGATGG + Intronic
973723231 4:53746410-53746432 CCCACAAGGAAATTCCTTGTGGG - Intronic
973973612 4:56240336-56240358 ACCACAGAGAAATTCCTTGGAGG + Intronic
974781221 4:66556192-66556214 CCCACAAGGAAATTCCTTGTGGG + Intergenic
974791775 4:66700270-66700292 CCAACTAAAAAATTCCTTGATGG + Intergenic
974943534 4:68497824-68497846 CCCAAACAGCAAATCCTTGAAGG + Intergenic
975229664 4:71917254-71917276 CACACCCGGCAAATCCTTGAGGG + Intergenic
975825901 4:78319239-78319261 CCCAGACAGAAATTCTTTCAGGG + Intronic
977912482 4:102553994-102554016 CCAACTCAGAAATTCTGTGATGG + Intronic
978766064 4:112406218-112406240 GCCACCCAGATGTTCATTGATGG + Intronic
980817455 4:137966927-137966949 CCCACAAGGAAATTCCTTGTGGG - Intergenic
981477327 4:145200025-145200047 CCCACAAGGAAATTCCTTGTGGG - Intergenic
982094086 4:151905184-151905206 CCCACCTAGAAATTGCCTCAAGG - Intergenic
982261194 4:153495744-153495766 CCCACAAGGAAATTCCTTGTAGG - Intronic
983263828 4:165486592-165486614 CTCACCCAGAATTTCCCTGTGGG - Intronic
983682899 4:170373737-170373759 CCCAGCCAGAAAGACCTTTACGG - Intergenic
983804805 4:171981469-171981491 CCAACAGAGAAATTCCTTGTGGG - Intronic
984206720 4:176793933-176793955 CTCACCCATAATTTACTTGAAGG + Intergenic
984666886 4:182438577-182438599 CCCTGCCAGAAATTCCTTGAAGG + Intronic
985018089 4:185658552-185658574 GCCACTCAGAAAGTCCTTTAAGG + Intronic
986098563 5:4584507-4584529 CCCACCAGGAAATTCCTTGTGGG - Intergenic
986505459 5:8445414-8445436 CCCACTTGGAAATTCCTTGTGGG - Intergenic
989138418 5:38178305-38178327 CCCACCCATTAATTGCTTCAAGG - Intergenic
994141872 5:96350527-96350549 CCCACTAGGAAATTCCTTGTGGG - Intergenic
996958578 5:129216201-129216223 CCCATCTAGAAATTCTTGGAAGG + Intergenic
999726370 5:154441630-154441652 CCCACAAGGAAATTCCTTGTGGG + Intergenic
1001645395 5:173277961-173277983 CTAACACAGAAGTTCCTTGAGGG - Intergenic
1001706668 5:173746035-173746057 CCCACAAGGAAATTCCTTGTGGG + Intergenic
1002896370 6:1382628-1382650 CCCACCCAGAACGTCCCAGAAGG - Intergenic
1003099509 6:3166274-3166296 CCCATCAGGAAATTCCTTGTAGG + Intergenic
1003193234 6:3892386-3892408 TCCACCCAGAAAGTTCTTGGTGG + Intergenic
1004653773 6:17638007-17638029 TCAAACTAGAAATTCCTTGAAGG - Intronic
1004815127 6:19304346-19304368 CCCTCCCAGATACTCCCTGAGGG + Intergenic
1005621647 6:27625987-27626009 CCCACAAAAAAATTCCTTGTGGG - Intergenic
1005624278 6:27648728-27648750 CCCACAAGGAAATTCCTTGTGGG + Intergenic
1008904814 6:56664880-56664902 AACACACAGAAATTCCTAGAAGG + Intronic
1010107598 6:72187786-72187808 CCAGCCCAGAAATCTCTTGATGG + Intronic
1012453473 6:99378826-99378848 CCAACCAGGAAGTTCCTTGAGGG + Intronic
1014726900 6:124982058-124982080 CCCACAAGGAAATTCCTTGTGGG - Intronic
1015162169 6:130165858-130165880 TCAACCAAAAAATTCCTTGATGG - Intronic
1016085965 6:139915048-139915070 CTCAACCAGAATTTCCTTTACGG - Intergenic
1017042621 6:150319714-150319736 CCCACCAGGAAATTCCTTATGGG - Intergenic
1018726966 6:166620399-166620421 CCCACTCAGCCATTCCTTGTGGG + Intronic
1021387307 7:20046795-20046817 GCCACACAGAAATGTCTTGAAGG - Intergenic
1023299133 7:38750160-38750182 CCCAACCAGAACTTACTTTAAGG + Intronic
1024234501 7:47387723-47387745 CCTCCCCAGACATTCCTTCAAGG + Intronic
1024656780 7:51457793-51457815 CTCATCCAGCAATTCCTTCACGG + Intergenic
1025610406 7:63072146-63072168 CCCACCCACACAGTCCTTCATGG + Intergenic
1026646447 7:72174778-72174800 CACACCCCAAAATTCCATGATGG - Intronic
1027675648 7:81154577-81154599 CCCACTAGGAAATTCCTTGTGGG + Intergenic
1028475341 7:91247666-91247688 CCTGCCCAGAAACTCCTTGCTGG + Intergenic
1028712833 7:93929391-93929413 ACAACCCAGACATTCTTTGATGG - Intergenic
1028868468 7:95738921-95738943 CCCACCTACAAGTCCCTTGATGG - Intergenic
1029580491 7:101433836-101433858 CCAACCCAGGAGTGCCTTGAAGG + Intronic
1029870354 7:103684580-103684602 CCAATCCTGAAACTCCTTGAGGG - Intronic
1031453442 7:121950353-121950375 CCAATCCTGAAATTCTTTGATGG + Intronic
1032108623 7:129056025-129056047 CCCACGAAGAACTTCCTGGAGGG - Intergenic
1032576910 7:133064153-133064175 CCAAACTAGTAATTCCTTGAAGG + Intronic
1032790426 7:135238427-135238449 CTCAGCCTGAAATTCCTGGATGG - Intronic
1032893116 7:136221076-136221098 CCCACCCTTAAATTCCTTAGAGG - Intergenic
1033820743 7:145131378-145131400 CCCACTCAGAATTCCCTTCAAGG - Intergenic
1034626840 7:152500003-152500025 CCCCCAGAGAAATTCCTTGTGGG + Intergenic
1035439213 7:158881982-158882004 TCCACCCAGAAATGCCTTTCTGG + Intronic
1035824813 8:2633114-2633136 CCCACTAAGAAATCCCTTGTGGG + Intergenic
1036218607 8:6901845-6901867 CCCACAAGGAAATTCCTTGTGGG - Intergenic
1037915525 8:22770517-22770539 CCCACCCAGAGATTCACTCAGGG - Intronic
1038717648 8:30006211-30006233 CCCACAAGGAAATTCCTTGTGGG + Intergenic
1039241147 8:35558157-35558179 CCAACCCAGAAGCTCCTTGAGGG + Intronic
1039809783 8:41036398-41036420 CCCAGCCATCAGTTCCTTGAAGG + Intergenic
1040815421 8:51503163-51503185 CTCACCCAGAGATGCCCTGAAGG + Intronic
1046836577 8:118808461-118808483 TACATCCAGAAATTCCTTCAGGG - Intergenic
1047108344 8:121760141-121760163 CTTACCCAGAAATTCCTTTGTGG + Intergenic
1047458608 8:125040085-125040107 TCCATCCAGACATTCCTTGAAGG - Intronic
1051608125 9:18936426-18936448 CCCACCCCCAAGTACCTTGAGGG - Intronic
1051629948 9:19131709-19131731 CCCACTAGGAAATTCCTTGTGGG + Intronic
1052183569 9:25562310-25562332 CCCACAAGGAAATTCCTTGTGGG - Intergenic
1052960473 9:34291965-34291987 CCCACTAGGAAATTCCTTGTGGG + Intronic
1053483575 9:38434683-38434705 CCCACAGAGAATTTCCTTGTGGG + Intergenic
1056298273 9:85215584-85215606 CCCACCCACAAACTCAATGAGGG - Intergenic
1057624601 9:96666392-96666414 CCCCCCAAGAAGTTCCTTGGTGG + Intergenic
1059961454 9:119569096-119569118 CCCACACAGCAAGTCCATGATGG + Intergenic
1062213766 9:135378169-135378191 CCCACCCAGAAGGTCCCTCAGGG - Intergenic
1186034315 X:5404401-5404423 CCCACATGGAAATTCCTTGTGGG - Intergenic
1186592609 X:10947060-10947082 CCCACACAGAAATTCTCTGCGGG - Intergenic
1187884944 X:23880853-23880875 ACCTCCCAAAAATTCCGTGAAGG - Exonic
1188909087 X:35823458-35823480 CCCACAAGGAAATTCCTTGTGGG + Intergenic
1189208296 X:39260856-39260878 CTGAACCAGAAATTCCTTAATGG - Intergenic
1189686877 X:43573631-43573653 CCTAAACATAAATTCCTTGATGG - Intergenic
1190951785 X:55152763-55152785 CCCACAAAGAAATTCCTTGTGGG + Intronic
1193179635 X:78439630-78439652 CCCACAAGGAAATTCCTTGTGGG + Intergenic
1193936315 X:87626602-87626624 CCCACAAGGAAATTCCTTGTGGG - Intronic
1195566412 X:106344610-106344632 CCCACATGGAAATTCCTTGTGGG - Intergenic
1195757063 X:108209578-108209600 TCCACACAGAAATTCCTTTTAGG - Intronic