ID: 905706109

View in Genome Browser
Species Human (GRCh38)
Location 1:40059903-40059925
Sequence CAACCAGTTAGTGGTGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905706109 Original CRISPR CAACCAGTTAGTGGTGATAC TGG Intronic
902660478 1:17897342-17897364 TAGCCAGTTGGTGGTGATGCTGG + Intergenic
905472629 1:38205176-38205198 CAACCATTAAGTAGTGAAACCGG + Intergenic
905706109 1:40059903-40059925 CAACCAGTTAGTGGTGATACTGG + Intronic
906699227 1:47845528-47845550 CAGCCAGTAAATGGTGAAACTGG + Intronic
907023045 1:51087204-51087226 CCACCAGACAGTGGTGGTACAGG + Intergenic
908944117 1:69473585-69473607 AAACTAGTTAATGGTGATAGAGG - Intergenic
911476132 1:98375115-98375137 TCACCTGTTTGTGGTGATACTGG - Intergenic
912167165 1:107055820-107055842 CAACTAATTAGTGGTCATACTGG + Intergenic
912954540 1:114145388-114145410 CAACTAGTGGGTGGTGAAACTGG + Intronic
916374691 1:164139753-164139775 CATGCTGTTAGTGGTGAAACTGG + Intergenic
917387181 1:174490558-174490580 TAACCTGGTAGTGGTTATACTGG - Intronic
921327424 1:213999995-214000017 GAACCAGGTAGTTGTGATAGTGG + Intronic
921825792 1:219670575-219670597 CAACCTGTAAGCGGTGACACTGG - Intergenic
921826025 1:219672869-219672891 CAACCTGTAAGTGGTGGCACTGG - Intergenic
923031695 1:230254193-230254215 CACCTAGTCAGTGGTGATAAGGG + Intronic
1065509885 10:26467950-26467972 CACTCAGTAAGTGGTGATAGCGG - Intronic
1070661319 10:78307677-78307699 CAAGCAGTGAGTTGTGTTACAGG - Intergenic
1073960913 10:108926525-108926547 CAGCTAGTTAGTGGTGTTGCTGG + Intergenic
1075591978 10:123698538-123698560 CAGCCAGTTAGTGGCAATGCTGG - Intergenic
1079622511 11:22571550-22571572 CAACCTGTTTGTGCTGATATAGG - Intergenic
1081782560 11:45723278-45723300 CAACCAGTAAGTGGGGTTAAAGG - Intergenic
1089065903 11:115661928-115661950 CAAGAAGGTAGTGGTGATAGTGG - Intergenic
1091545359 12:1498190-1498212 CAGCATGTTAGTGGTGAGACTGG + Intergenic
1093112084 12:15164531-15164553 AAACTTGCTAGTGGTGATACAGG - Intronic
1093184361 12:16002991-16003013 CACCCAGTTTGTGGTGATAAGGG - Intronic
1093679471 12:21984656-21984678 TGACCTGTTTGTGGTGATACTGG + Intergenic
1096582613 12:52597884-52597906 CAACTAGTTCATGGTGATTCAGG + Intronic
1097198375 12:57257576-57257598 AAGCTAGTTAGTGGTGAGACTGG + Intronic
1100240212 12:92703611-92703633 CAGCCAATTGGCGGTGATACTGG + Intronic
1101170073 12:102082619-102082641 CAGCTAGTAAGTGGTGAAACTGG + Intronic
1101229733 12:102727867-102727889 CAGCTAGCAAGTGGTGATACTGG - Intergenic
1102564473 12:113786442-113786464 CAGCAAGTTATTGGTTATACTGG + Intergenic
1103970588 12:124668498-124668520 CAGCCAGTGAGTGGTGAAGCTGG + Intergenic
1104305535 12:127607578-127607600 CCACCCATTAGTGGTGATAGAGG + Intergenic
1105521341 13:21133936-21133958 CAACCTTTTATTGGTGATACTGG - Intergenic
1109042075 13:57351843-57351865 CAACCAATGATTGTTGATACGGG + Intergenic
1109319013 13:60786771-60786793 CAACTAGTAAATGGTGATCCTGG - Intergenic
1110202747 13:72871948-72871970 CCATCTGTTAGTGGTGATACAGG - Intronic
1114214029 14:20642104-20642126 CAGCCAGTAAGTGGAGATGCAGG - Intergenic
1117923368 14:60748957-60748979 TCACCTGTTTGTGGTGATACTGG - Intronic
1117992159 14:61444695-61444717 CACCCAGTTGGTGATGAGACTGG - Intronic
1118791234 14:69094883-69094905 ACACCAGTTAATTGTGATACAGG + Intronic
1127112607 15:55690911-55690933 CAGCTAGTAAGTGGTGATACTGG + Intronic
1127915934 15:63455044-63455066 CAACCAGTTAGTAGAGGAACTGG + Intergenic
1128401713 15:67289327-67289349 CAACCAATTTGTGGTAATCCAGG + Intronic
1128792639 15:70444402-70444424 CAACCAGTTAGTGGCCAAACTGG - Intergenic
1130672410 15:85924251-85924273 CAACCAGGTAGTGGTGGAGCTGG + Intergenic
1131549511 15:93344951-93344973 TAAGCAGTCAGTGGTGATGCAGG - Intergenic
1133813505 16:9179009-9179031 CAGCTAGTTCGTGGTGATGCTGG - Intergenic
1137980610 16:53066126-53066148 CAACCAGTAAGTGATGGAACTGG - Intronic
1138134683 16:54511556-54511578 CAACCAGTGAGTGGTGATATGGG - Intergenic
1141444315 16:84048205-84048227 GAATTAGATAGTGGTGATACTGG - Intergenic
1142017274 16:87756555-87756577 CAGCCAGTTTGTGGTGACAGAGG - Intronic
1144216264 17:13058177-13058199 AAACCATTTAGTAGTGAGACAGG - Intergenic
1147122894 17:38346142-38346164 CAGCCAGTTAGTGGTATTGCTGG + Intergenic
1150507371 17:65713201-65713223 CTACCAGCTAGTGGTGGTCCGGG + Intronic
1151934905 17:77255569-77255591 CAACCAGCCAGTGGTGACTCAGG - Intergenic
1153456117 18:5283902-5283924 CAACCAGGTAGTGGTAGAACTGG + Intergenic
1154297371 18:13162479-13162501 CAACCAGTTAGTGGCAAAGCTGG - Intergenic
1155032331 18:21995596-21995618 CAAGTAGTAAGTGGTGAAACTGG - Intergenic
1155249300 18:23940024-23940046 CAGCCAGTAAGTGGTGAAGCAGG - Intronic
1156079011 18:33312884-33312906 CAACCACTTAGGGGTGACAAAGG + Intronic
1158936908 18:62373155-62373177 CAACCAGTTAGTGGGAATCCTGG + Intronic
1160135753 18:76270112-76270134 GAACCGGGTAGTGGTGATAATGG - Intergenic
926844930 2:17125887-17125909 AAGCTAGTAAGTGGTGATACGGG - Intergenic
927377930 2:22440175-22440197 CAACTAGTAAGTGGTGGTGCTGG + Intergenic
932004550 2:67915241-67915263 CATCAAGTTATTGGTGATAGGGG - Intergenic
935847693 2:107184707-107184729 CATCCTGTTATTGGTGATACAGG - Intergenic
939139694 2:138339731-138339753 CAACTAGTAAGTTGTGAAACTGG + Intergenic
944613158 2:201431806-201431828 CAACCAGTAAGTGGTGGGGCTGG - Intronic
946611731 2:221465760-221465782 CATCCAGTTGGTGGTGATGGGGG - Intronic
948684650 2:239662927-239662949 CAGCCAGTTAGTGGTGAAGCTGG + Intergenic
1169333542 20:4736090-4736112 CAACCAAGTATTGGTGAAACTGG + Intronic
1170388302 20:15844547-15844569 CAACTAGTAAGTGGTGACAGTGG + Intronic
1171277789 20:23873258-23873280 CAAACAGTTAGTGGAAAGACTGG + Intergenic
1172022199 20:31922745-31922767 CAGCCAGTTAGTGGTGTTGCTGG - Intronic
1172328719 20:34058717-34058739 CAACTAGTAAGTGCTGATCCTGG + Intronic
1172785164 20:37463967-37463989 CAACAAGTGAGTGGGGACACAGG - Intergenic
1172930742 20:38584578-38584600 CAGCCAGGGAGTGGTGCTACTGG - Intronic
1174473675 20:50780374-50780396 CAACCAGTTAGGGGACATAGTGG - Intergenic
1174775847 20:53342448-53342470 CAACCCTTTACTGGTTATACCGG - Intronic
1175288719 20:57857857-57857879 AAACTAGATAGTGGTGATAGTGG - Intergenic
1179149154 21:38795555-38795577 CAACCGGTGGGTGGTGGTACCGG + Intergenic
1181885182 22:26016542-26016564 TGACCAGTGAGTGGGGATACTGG + Intronic
1182963883 22:34503796-34503818 CCACAAGTTAGCAGTGATACAGG + Intergenic
960443786 3:117722222-117722244 CATCTAGTTAGTGGTGGTACTGG - Intergenic
964376949 3:156057269-156057291 CACCCAGTCAGAGGTGATGCAGG + Intronic
964868246 3:161285359-161285381 TAATCTGTTAGTGGTTATACGGG - Intergenic
965298328 3:166977414-166977436 CAACCACTTATTAGTGAGACTGG + Intergenic
966697917 3:182811868-182811890 CAACTAGATTGTGGTGAGACTGG + Intronic
971954004 4:33392579-33392601 CTACCAGTTATTGATGCTACAGG - Intergenic
974173989 4:58302431-58302453 AAGCCAGTTAGTGCTGATGCTGG + Intergenic
983128438 4:163983672-163983694 CAACTAGTTAGTGGTGAATTTGG - Intronic
985183211 4:187288113-187288135 CTATTAGTTAGTGGTAATACTGG - Intergenic
986798359 5:11234085-11234107 CAAACAGTGAGAAGTGATACAGG + Intronic
987525310 5:19041988-19042010 CAAACAGTTAATGGTCCTACAGG - Intergenic
997555802 5:134797545-134797567 CAGCCAGTTAAGGATGATACTGG + Intronic
998971264 5:147594988-147595010 CAACCATTTAATGGTGATGTGGG + Intronic
999701604 5:154233573-154233595 CAACAGGTTAGTGGTGGCACTGG + Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1004552092 6:16657950-16657972 CAAGCAGTTAGTGGATATTCAGG + Intronic
1005368680 6:25106955-25106977 CAACCAGTAAGTGGTGGGTCAGG - Intergenic
1005515066 6:26546661-26546683 GAACAATTTTGTGGTGATACTGG - Intergenic
1006401759 6:33821794-33821816 TAGCCAGTTAGTGGTCCTACAGG - Intergenic
1007479440 6:42140581-42140603 AAACCAGATGGTGGTGATAATGG + Intronic
1011067258 6:83340611-83340633 CCACTAGTAAGTGGTGAAACTGG + Intronic
1011386194 6:86801372-86801394 TAGCCAGTTAGTGGTTATAGTGG - Intergenic
1014757024 6:125312637-125312659 CAGCCAGTGAGTGGTGAAGCTGG + Intergenic
1014855469 6:126396019-126396041 TAGCCAGTTAGTGGTTACACTGG - Intergenic
1020834218 7:13128116-13128138 CAACCTGTTAGAGGTGTTAGGGG + Intergenic
1022462083 7:30619122-30619144 CAGCCAGTGAGTGGTGAGGCTGG + Intronic
1028953123 7:96658837-96658859 AATCCAGTTAGTGGTGCAACAGG + Intronic
1034130484 7:148711574-148711596 GAACCAGTTTGTAGTGAAACGGG + Intronic
1035781029 8:2228696-2228718 CAGCCAGTGAGTGGAGATTCAGG + Intergenic
1037980221 8:23247766-23247788 CAGCTAGTTAAAGGTGATACCGG + Intronic
1040386279 8:46916907-46916929 CACCCAGCTAGTGGTGACAGTGG - Intergenic
1040991770 8:53359471-53359493 TCACGAGTTAGTGGTGATGCTGG - Intergenic
1041048423 8:53909142-53909164 CATACAGGTAGTGGTGGTACTGG + Intronic
1041550349 8:59093210-59093232 CAACCAGTAAGTGATGAAGCTGG - Intronic
1047905396 8:129467719-129467741 CACCAAGGTAATGGTGATACTGG + Intergenic
1053513877 9:38712826-38712848 GAATCAGTCAGTGCTGATACTGG + Intergenic
1057213403 9:93213810-93213832 CAAAAAGTTAGTGGTTATGCTGG + Intronic
1061000085 9:127897939-127897961 CAGCCAGTAAGTGGTGAAACCGG - Exonic
1187322615 X:18254078-18254100 CAACCAGTGACTGATTATACAGG + Intronic
1187699265 X:21949088-21949110 GAGCTAGCTAGTGGTGATACTGG + Intronic
1188353523 X:29161229-29161251 CAATCAATTACTGGTGATGCAGG + Intronic
1188883115 X:35514643-35514665 CAACCTGTCAGTCGTGAGACAGG + Intergenic
1189854334 X:45208905-45208927 TAACCAGGTAGTGGTTATAGCGG - Intergenic
1194276593 X:91892271-91892293 CAACCTGTTAGTAGTGGAACAGG - Intronic
1194398544 X:93414991-93415013 TAACCAGTTAGTGGTTACAGTGG + Intergenic
1197144507 X:123156544-123156566 TAACCAGTGAGTGGAGATTCAGG - Intergenic
1197627563 X:128819788-128819810 CACCCAGTAAGTGGTGGAACTGG + Intergenic
1199474684 X:148232191-148232213 CAACCTTTTGGAGGTGATACTGG + Intergenic
1200593892 Y:5114050-5114072 CAACCTGTTAGTAGTGGAACAGG - Intronic
1202065559 Y:20935955-20935977 GTACCAGTTACTGGGGATACAGG - Intergenic