ID: 905713012

View in Genome Browser
Species Human (GRCh38)
Location 1:40123361-40123383
Sequence CAGTGTGCCCAAAGAGGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905713008_905713012 1 Left 905713008 1:40123337-40123359 CCTAGCCCAGGGTCTGAGCTCTG No data
Right 905713012 1:40123361-40123383 CAGTGTGCCCAAAGAGGATTAGG No data
905713010_905713012 -5 Left 905713010 1:40123343-40123365 CCAGGGTCTGAGCTCTGTCAGTG No data
Right 905713012 1:40123361-40123383 CAGTGTGCCCAAAGAGGATTAGG No data
905713005_905713012 15 Left 905713005 1:40123323-40123345 CCAAACAGGGACTTCCTAGCCCA No data
Right 905713012 1:40123361-40123383 CAGTGTGCCCAAAGAGGATTAGG No data
905713009_905713012 -4 Left 905713009 1:40123342-40123364 CCCAGGGTCTGAGCTCTGTCAGT No data
Right 905713012 1:40123361-40123383 CAGTGTGCCCAAAGAGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905713012 Original CRISPR CAGTGTGCCCAAAGAGGATT AGG Intergenic
No off target data available for this crispr