ID: 905714137

View in Genome Browser
Species Human (GRCh38)
Location 1:40133456-40133478
Sequence CTTGATGCCCAGTCCCGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905714137_905714146 9 Left 905714137 1:40133456-40133478 CCGCAGCGGGACTGGGCATCAAG No data
Right 905714146 1:40133488-40133510 CCGCCCCGGCGTCTGCCGGGTGG No data
905714137_905714147 10 Left 905714137 1:40133456-40133478 CCGCAGCGGGACTGGGCATCAAG No data
Right 905714147 1:40133489-40133511 CGCCCCGGCGTCTGCCGGGTGGG No data
905714137_905714143 5 Left 905714137 1:40133456-40133478 CCGCAGCGGGACTGGGCATCAAG No data
Right 905714143 1:40133484-40133506 GGGGCCGCCCCGGCGTCTGCCGG No data
905714137_905714152 23 Left 905714137 1:40133456-40133478 CCGCAGCGGGACTGGGCATCAAG No data
Right 905714152 1:40133502-40133524 GCCGGGTGGGTGCGAACGGTAGG No data
905714137_905714141 -5 Left 905714137 1:40133456-40133478 CCGCAGCGGGACTGGGCATCAAG No data
Right 905714141 1:40133474-40133496 TCAAGCTCCTGGGGCCGCCCCGG No data
905714137_905714151 19 Left 905714137 1:40133456-40133478 CCGCAGCGGGACTGGGCATCAAG No data
Right 905714151 1:40133498-40133520 GTCTGCCGGGTGGGTGCGAACGG No data
905714137_905714144 6 Left 905714137 1:40133456-40133478 CCGCAGCGGGACTGGGCATCAAG No data
Right 905714144 1:40133485-40133507 GGGCCGCCCCGGCGTCTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905714137 Original CRISPR CTTGATGCCCAGTCCCGCTG CGG (reversed) Intergenic
No off target data available for this crispr