ID: 905714154

View in Genome Browser
Species Human (GRCh38)
Location 1:40133520-40133542
Sequence GTAGGCTCGCTCATCTCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905714149_905714154 5 Left 905714149 1:40133492-40133514 CCCGGCGTCTGCCGGGTGGGTGC No data
Right 905714154 1:40133520-40133542 GTAGGCTCGCTCATCTCGCCTGG No data
905714148_905714154 6 Left 905714148 1:40133491-40133513 CCCCGGCGTCTGCCGGGTGGGTG No data
Right 905714154 1:40133520-40133542 GTAGGCTCGCTCATCTCGCCTGG No data
905714145_905714154 9 Left 905714145 1:40133488-40133510 CCGCCCCGGCGTCTGCCGGGTGG No data
Right 905714154 1:40133520-40133542 GTAGGCTCGCTCATCTCGCCTGG No data
905714150_905714154 4 Left 905714150 1:40133493-40133515 CCGGCGTCTGCCGGGTGGGTGCG No data
Right 905714154 1:40133520-40133542 GTAGGCTCGCTCATCTCGCCTGG No data
905714142_905714154 16 Left 905714142 1:40133481-40133503 CCTGGGGCCGCCCCGGCGTCTGC No data
Right 905714154 1:40133520-40133542 GTAGGCTCGCTCATCTCGCCTGG No data
905714153_905714154 -6 Left 905714153 1:40133503-40133525 CCGGGTGGGTGCGAACGGTAGGC No data
Right 905714154 1:40133520-40133542 GTAGGCTCGCTCATCTCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905714154 Original CRISPR GTAGGCTCGCTCATCTCGCC TGG Intergenic
No off target data available for this crispr