ID: 905717333

View in Genome Browser
Species Human (GRCh38)
Location 1:40162971-40162993
Sequence TTGATGAACTTACAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905717325_905717333 28 Left 905717325 1:40162920-40162942 CCAGGGACTTTACCAAGTGCTGG 0: 1
1: 0
2: 1
3: 35
4: 372
Right 905717333 1:40162971-40162993 TTGATGAACTTACAGTTGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 145
905717329_905717333 16 Left 905717329 1:40162932-40162954 CCAAGTGCTGGGGAAACATGAGT 0: 1
1: 0
2: 1
3: 37
4: 444
Right 905717333 1:40162971-40162993 TTGATGAACTTACAGTTGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905717333 Original CRISPR TTGATGAACTTACAGTTGGT GGG Intronic
904630239 1:31835863-31835885 TGCCTGAACTTACAGTTGATTGG - Intergenic
905717333 1:40162971-40162993 TTGATGAACTTACAGTTGGTGGG + Intronic
906266759 1:44437029-44437051 TTGAAAAACTGACAGTTGTTTGG + Intronic
908319868 1:62968715-62968737 TTGAACAACTAACCGTTGGTTGG + Intergenic
909461704 1:75923197-75923219 TTAATAAAATTAGAGTTGGTTGG + Intronic
910272952 1:85417094-85417116 TTGATCATTTTACAGTTGGTGGG - Intronic
912167873 1:107061417-107061439 TAGATGAACTCACAGGTGCTTGG + Intergenic
913520396 1:119640160-119640182 ATAAGGAACTTACAGTTGGGAGG - Intronic
915261625 1:154680922-154680944 ATGAGGAAATTAAAGTTGGTGGG + Intergenic
916157960 1:161876312-161876334 TTGATGAATTAACATATGGTTGG + Intronic
918192545 1:182189706-182189728 TTGATGAGCTTCCAGTAGGCAGG + Intergenic
918428447 1:184434491-184434513 TTTAGGAACTTAGATTTGGTTGG + Intronic
922082771 1:222313793-222313815 TTGACCAATTGACAGTTGGTGGG - Intergenic
924356255 1:243179296-243179318 TTGATGAACTTCCAGCTTATAGG - Intronic
1065110316 10:22434766-22434788 TTGATCAAGTTACAGATAGTTGG + Intronic
1068375130 10:56168103-56168125 TTAATGGACTTCCAGTTGGCTGG - Intergenic
1069230327 10:66001055-66001077 GTGATGAAGTCACTGTTGGTGGG - Intronic
1072473374 10:95734934-95734956 TGGAAGAAATTACAGTTGGGTGG + Intronic
1073028257 10:100504413-100504435 TTGATGTCCTTGCAGCTGGTCGG - Intronic
1073370476 10:102984067-102984089 TTTATGAGCCTACTGTTGGTTGG + Intronic
1076531586 10:131148823-131148845 TTGATTCTCTTACAGTTGGGAGG - Intronic
1079256574 11:18836223-18836245 TTGATGAATTTACATTGTGTGGG + Intergenic
1080357780 11:31471836-31471858 TTTATAATCTTACAGTTGATAGG + Intronic
1082198181 11:49328473-49328495 TTAATGAAATTCCAGTTGCTCGG - Intergenic
1085874320 11:80387697-80387719 TTGAAGAAATTACAGTTTATTGG + Intergenic
1086657632 11:89379674-89379696 TTAATGAAATTCCAGTTGCTCGG + Intronic
1089218538 11:116851284-116851306 TGGATGAACTGACTCTTGGTGGG + Intronic
1089388552 11:118084301-118084323 TTGCTGAAATTACATTTGCTAGG - Intronic
1093099676 12:15012738-15012760 TTGATGATGTTACAGATGGAAGG + Intergenic
1098516837 12:71387322-71387344 TTTATGATCTTAAAGTTCGTAGG - Intronic
1100022199 12:90083280-90083302 TTAAGGAACTTACAGCTGTTTGG - Intergenic
1100883375 12:99042501-99042523 TAGCTGAGCTTACAGTTTGTGGG - Intronic
1102144883 12:110647641-110647663 TTCATGAACTGACAGTAGTTGGG + Intronic
1102356382 12:112240003-112240025 TTGAAGAACTCACATGTGGTGGG - Exonic
1105785518 13:23745540-23745562 CTGATGAATTTACATTTGGAAGG - Intronic
1106713479 13:32363355-32363377 TTATTGAACTTACAGATGGGTGG + Exonic
1107045705 13:35989931-35989953 GTGATAAACTAAGAGTTGGTAGG + Intronic
1108136796 13:47372778-47372800 TTAATGAAGTCACATTTGGTGGG + Intergenic
1111707389 13:91767459-91767481 TTAATGAACTATCAGTTGATTGG + Intronic
1111803114 13:93004765-93004787 TTGCTGAAATTACAGATGTTAGG - Intergenic
1114222420 14:20708774-20708796 TTGATGTACTCACAGCTGCTGGG - Intergenic
1115823892 14:37242650-37242672 TTGATGAACAGACAGGTGGATGG - Intronic
1120811389 14:88807417-88807439 TCAAGGAACTTACAGCTGGTGGG - Intergenic
1126263958 15:46729974-46729996 TGGTTGAACTTTCTGTTGGTGGG + Intergenic
1127104765 15:55601420-55601442 TTGATGAATTTAGATATGGTCGG - Intergenic
1127193617 15:56560797-56560819 ATGAAGAAGTGACAGTTGGTTGG - Intergenic
1128470241 15:67945775-67945797 TTGAGGAAGTCACAGTAGGTAGG + Intergenic
1130030262 15:80307738-80307760 TGGATGAACTAACAGAAGGTGGG - Intergenic
1135574390 16:23574044-23574066 TTTCTGAAGTTACAGGTGGTTGG + Exonic
1135808762 16:25568629-25568651 TGGATGAACTTACAGTTACCAGG - Intergenic
1138869085 16:60859212-60859234 TTGGGGAAGTTACAGTTGGAAGG - Intergenic
1140975854 16:80059518-80059540 ATGATGAACATTCAGTTAGTTGG - Intergenic
1147960514 17:44164667-44164689 TTGATGACCTTACAGTTTTGGGG + Intergenic
1149647746 17:58252452-58252474 TTGATGAACTCACAGGGGCTTGG - Exonic
1152509150 17:80773490-80773512 TTGTTGGACTTAAAGTTTGTTGG + Intronic
1153269471 18:3305714-3305736 TAGATGAACTTAGAGTTGCCAGG + Intergenic
1154259290 18:12815586-12815608 TTGTTGAAGTTATAGTTGGCAGG + Intronic
1154316095 18:13304345-13304367 TTCCTGAGCTCACAGTTGGTTGG + Intronic
1161384125 19:3982020-3982042 TTGCTGAACTTGCCGTTGGCTGG + Exonic
1162217751 19:9150394-9150416 TTGATGAACTGACTCTTGGGAGG + Intronic
1164766245 19:30773994-30774016 TTCTTGAACTGATAGTTGGTAGG - Intergenic
1168493187 19:56828351-56828373 TTTATGTACTGACAGTTGTTGGG - Intronic
930307644 2:49695455-49695477 TTCATGAATTCACAGTTGATAGG - Intergenic
931082064 2:58784664-58784686 TTGATAAACTAATAGTAGGTTGG + Intergenic
931434132 2:62232466-62232488 TTGTTGGGCTTAAAGTTGGTGGG + Intergenic
932763290 2:74454714-74454736 TTGAGGAACTCACAGTTGGGTGG - Intergenic
933452096 2:82467545-82467567 TTGTTGATCTTAAAGTTGGAAGG + Intergenic
938970297 2:136425301-136425323 TTGCTGAAGTTACAGTTTGTAGG + Intergenic
939644433 2:144679304-144679326 TTGAAGAACATGGAGTTGGTGGG + Intergenic
940203630 2:151178171-151178193 TTTATGACTTTACAGTTGGACGG - Intergenic
941292606 2:163695739-163695761 TTGAGGAACTTACAGTCTGTTGG - Intronic
941960252 2:171246238-171246260 TTGAAGAACACCCAGTTGGTGGG + Intergenic
944365142 2:198910256-198910278 TTCATGAACCTACAGTTAGTAGG + Intergenic
945116236 2:206410615-206410637 TTGATGAACTTGCAGTCCTTTGG - Intergenic
945785829 2:214235622-214235644 TTGAAGAACTTACCACTGGTGGG + Intronic
1169526083 20:6427334-6427356 TTGAAGAACTGGTAGTTGGTTGG + Intergenic
1174546618 20:51330668-51330690 TTGATTACCTTACAGTTTCTGGG - Intergenic
1175685541 20:61025461-61025483 TGGATGAACTTACAATTTGGGGG + Intergenic
1177521216 21:22228770-22228792 ATGTTGAACTTACATTTGTTTGG - Intergenic
1178469660 21:32880976-32880998 TTGATGAACGTATTCTTGGTGGG + Intergenic
1179557066 21:42186252-42186274 TTAATGAACTTACATATGGCTGG - Intergenic
1182380246 22:29881950-29881972 TTGATTAACTAACAGCTGGCTGG - Intergenic
1182758729 22:32703762-32703784 TAGATGAAATTACATTGGGTGGG - Intronic
949860982 3:8504504-8504526 TTTATGACTTTCCAGTTGGTGGG - Intronic
956529362 3:70200828-70200850 TCTACGATCTTACAGTTGGTAGG - Intergenic
960572169 3:119196047-119196069 ATGATGAATTTGTAGTTGGTAGG - Intronic
961105059 3:124233672-124233694 TTCATGAACTCACACTTGGGCGG + Intronic
962297846 3:134208993-134209015 TTGTGGAACTTACAGTGAGTGGG + Intronic
963325824 3:143861869-143861891 ATGCTGAAATTACAGTTGGGTGG + Intergenic
963365820 3:144332901-144332923 TTCATGGACTTGCAGTGGGTTGG + Intergenic
966538538 3:181063136-181063158 ATGAGGAACTTACAGTGGGTTGG + Intergenic
969144366 4:5108339-5108361 TTGATGTACCTACAGTTTTTTGG + Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
970168432 4:13264205-13264227 TTGATGTATGTACAGTTGGGTGG - Intergenic
971105341 4:23518131-23518153 TTGATGAATTAATGGTTGGTAGG - Intergenic
971106818 4:23535071-23535093 TTGATGAAGTTACAGTTTTAAGG - Intergenic
974993731 4:69127095-69127117 TTGATAAACCCACAGTTTGTTGG - Intronic
976225805 4:82795095-82795117 TTGATGAACTAACAATTTGATGG + Intronic
976863367 4:89693008-89693030 TTAAAGAAATTACAGTTTGTTGG + Intergenic
979245561 4:118500335-118500357 TTGATGAACTTCCAGCTTATAGG + Intergenic
984673464 4:182518754-182518776 TTTATGATCTTACAGTTTGCAGG - Intronic
986857758 5:11890987-11891009 ATGATGAGCTCACAGTGGGTTGG + Intronic
986959347 5:13194241-13194263 ATGATGAACTTACACTATGTTGG - Intergenic
989267305 5:39490842-39490864 TTTATGAACTTAAGGTTAGTTGG - Intergenic
989352454 5:40501781-40501803 TTGATAAACTTATAGTAGGTAGG - Intergenic
990394362 5:55361115-55361137 TTGATGTACTTAAAGTAGATAGG + Intronic
991312215 5:65256599-65256621 TTGTAGAACTTACTATTGGTGGG - Intronic
994363300 5:98880874-98880896 TTTATGAAGTTACATTTAGTTGG - Intronic
994642505 5:102427541-102427563 TTGATGACCTTACAGTTTTTAGG - Intronic
997743082 5:136274956-136274978 TTGAGGAACCTGCAGTGGGTGGG + Intronic
998333907 5:141353321-141353343 TTGATGAACTTTAACTTGGGTGG - Intronic
998391767 5:141791561-141791583 TTGTGGAACTTACAATTAGTGGG + Intergenic
1000645751 5:163758437-163758459 TTGATGAACTAACATTTCATTGG - Intergenic
1000834134 5:166134293-166134315 TTGATGAAGGGACAGTGGGTCGG + Intergenic
1002821415 6:728627-728649 TTAAGGAACTAACAGGTGGTGGG + Intergenic
1003751508 6:9063482-9063504 TTAAGGAACTTAAACTTGGTTGG - Intergenic
1005287339 6:24342139-24342161 TTGCTGGACATACAGTTAGTGGG + Intronic
1008863924 6:56187130-56187152 GTGAGGACCTTACAGCTGGTGGG + Intronic
1010436917 6:75842159-75842181 TTGATCAACTTAGATGTGGTGGG + Intronic
1011470768 6:87705271-87705293 TTGTTGTACTTAAAGGTGGTGGG + Intergenic
1014101308 6:117514998-117515020 TTGCTTACCTTACAGTTTGTGGG + Intronic
1014485382 6:121993190-121993212 TTGAAGAACTTTCAGTAGATTGG - Intergenic
1018053701 6:160033687-160033709 TTAATGAGTTTACAGTTGATAGG + Intronic
1019043224 6:169123209-169123231 TTTAAGAACTTTCCGTTGGTTGG - Intergenic
1022284230 7:28939776-28939798 TTGATGAACTAATTTTTGGTGGG + Intergenic
1022739330 7:33106648-33106670 TTTAGGAATATACAGTTGGTGGG + Intronic
1024780360 7:52840925-52840947 TTGATGATCTTACAGAGGTTTGG - Intergenic
1028007418 7:85592529-85592551 TTGAAGAACTCAAAGTTTGTGGG + Intergenic
1028749308 7:94364675-94364697 TTAATGATCTTACAGTAGTTGGG + Intergenic
1030989201 7:116280046-116280068 ATGATGAGCTCACAGTTGTTGGG - Intergenic
1033003370 7:137532591-137532613 TTCATCAATCTACAGTTGGTGGG + Intronic
1039766380 8:40632720-40632742 TTGATTATCTCACAGTTTGTAGG - Intronic
1042866963 8:73365122-73365144 TTGATGAACTTGGGGTGGGTGGG + Intergenic
1044130061 8:88510984-88511006 TTGATTTACTTTCAGATGGTTGG - Intergenic
1046277471 8:111982441-111982463 TGGAGGAACATACAGGTGGTTGG - Intergenic
1046466611 8:114612309-114612331 TTTATGATCTTACAGTTTTTAGG - Intergenic
1047991381 8:130290285-130290307 TTGAAGGACTTAAAGTTGGAAGG - Intronic
1050419367 9:5447292-5447314 TTTATGAACTTATTGTGGGTGGG + Intergenic
1050910442 9:11062403-11062425 TTGAACAATTTACAGTTGTTAGG - Intergenic
1051412224 9:16801772-16801794 TTAATTAACTTACAGTTGAGAGG - Intronic
1051497952 9:17745777-17745799 TTGCTGAGCTTACTGTGGGTTGG + Intronic
1051660810 9:19424751-19424773 TTGATGAACTTGCAGTCCTTTGG + Exonic
1052050959 9:23849650-23849672 TTGATGCATTTAAAGTGGGTGGG - Intergenic
1057846397 9:98529512-98529534 ATGATGACCTTTCAGTGGGTAGG + Intronic
1058204826 9:102091286-102091308 TTGAAGAACATACAGTGGCTTGG - Intergenic
1060254594 9:122015961-122015983 TTGTGGAACTTACAGTAGGAGGG + Intronic
1061349118 9:130050040-130050062 TGCCTGAACTTACAGTTGATTGG + Intergenic
1187984844 X:24798957-24798979 TTGTTGAACTTACAGTAGAATGG + Intronic
1189400057 X:40659167-40659189 TTGAGGAGGTTAGAGTTGGTGGG - Intronic
1191590985 X:62884800-62884822 TTGATTCACTCACAGTTGGGTGG - Intergenic
1194042890 X:88963297-88963319 TTAATGAACTTACAGTTCCATGG - Intergenic
1195087524 X:101426323-101426345 TTGAGGAACTAACTGCTGGTAGG + Intronic
1198820766 X:140645810-140645832 GTGATGATTTTAAAGTTGGTGGG - Intergenic
1201422890 Y:13819483-13819505 TTGTTGAACTGAAGGTTGGTGGG + Intergenic