ID: 905721326

View in Genome Browser
Species Human (GRCh38)
Location 1:40205158-40205180
Sequence AGAGCTCTTCTTAGGTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905721320_905721326 22 Left 905721320 1:40205113-40205135 CCACCCCATTGGCATTTATGCTA 0: 1
1: 0
2: 1
3: 13
4: 121
Right 905721326 1:40205158-40205180 AGAGCTCTTCTTAGGTCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 107
905721321_905721326 19 Left 905721321 1:40205116-40205138 CCCCATTGGCATTTATGCTATTA 0: 1
1: 0
2: 0
3: 14
4: 201
Right 905721326 1:40205158-40205180 AGAGCTCTTCTTAGGTCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 107
905721322_905721326 18 Left 905721322 1:40205117-40205139 CCCATTGGCATTTATGCTATTAT 0: 1
1: 0
2: 1
3: 20
4: 267
Right 905721326 1:40205158-40205180 AGAGCTCTTCTTAGGTCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 107
905721323_905721326 17 Left 905721323 1:40205118-40205140 CCATTGGCATTTATGCTATTATT 0: 1
1: 0
2: 4
3: 47
4: 386
Right 905721326 1:40205158-40205180 AGAGCTCTTCTTAGGTCCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905721326 Original CRISPR AGAGCTCTTCTTAGGTCCAG AGG Intronic
901181064 1:7342213-7342235 GGAGCTCTTCTGAGGTCATGTGG - Intronic
902575909 1:17377365-17377387 AGAGCTCCTCTGAGCTCCAAAGG - Intronic
905721326 1:40205158-40205180 AGAGCTCTTCTTAGGTCCAGAGG + Intronic
907799811 1:57753330-57753352 ACAGTTCTCATTAGGTCCAGTGG - Intronic
911608266 1:99932713-99932735 AGAGCTCTTTTTATGTCCCCAGG - Intergenic
916573633 1:166048480-166048502 ACATCTCTTCTGAAGTCCAGGGG + Intergenic
922807199 1:228396512-228396534 AGTGCTCTTCTGAGTTCCATGGG + Intronic
924249987 1:242123033-242123055 AGATCTCATCTCAGATCCAGTGG + Intronic
1063480257 10:6369382-6369404 AGTGCTCTTCTTTTGGCCAGGGG - Intergenic
1064508306 10:16059440-16059462 AAAACTCCTCTCAGGTCCAGTGG + Intergenic
1065762404 10:28994438-28994460 AGAGCTCTTCTGCTGTCCACAGG + Intergenic
1068070786 10:52192277-52192299 ATGGCTGATCTTAGGTCCAGGGG - Intronic
1070653494 10:78254716-78254738 AGAGCCCTGTTTAGGTCCAAGGG - Intergenic
1074389874 10:113048095-113048117 AGAGCTCTTCCCAGGACGAGGGG + Intronic
1078739349 11:14052095-14052117 AGAGCTCTTCCTATAACCAGGGG + Intronic
1084489518 11:69470942-69470964 AGAGCTCGTCCTAGGACCTGGGG - Intergenic
1087046255 11:93846249-93846271 ATAGCTGTCCTTAGGTCCTGGGG + Intronic
1089310503 11:117555350-117555372 AGAACTCTTCTGACCTCCAGGGG + Intronic
1090453708 11:126828978-126829000 AGACCTCTTCAGAGGTCCAGAGG - Intronic
1090842183 11:130499882-130499904 ACAACTCTTCTTAGATCCATTGG - Intergenic
1092235204 12:6803088-6803110 ATAGCTATTATTAGGTCCAAGGG - Intronic
1095881584 12:47142306-47142328 AGACCTCTTGTTAGGTCCATGGG - Intronic
1097316978 12:58181903-58181925 AGAACTCTTTTTAGTTCCTGGGG + Intergenic
1097539915 12:60928040-60928062 AAAGCTCTACTTTTGTCCAGAGG + Intergenic
1102459621 12:113092465-113092487 AAAGCTCTTTTGAGGGCCAGAGG + Intronic
1104400417 12:128471485-128471507 AGAGCTATGCCTAGGGCCAGGGG - Intronic
1105276051 13:18927722-18927744 AGAGCTCCTCTTAGGGTTAGTGG - Intergenic
1106047036 13:26152352-26152374 AGAGGTCTTCCTTGGTCCATCGG + Intronic
1106909964 13:34453059-34453081 TGAGATCTTCCTAGTTCCAGAGG - Intergenic
1108374131 13:49797508-49797530 AAAGTTCTTCTGAGGTTCAGAGG - Intergenic
1108624811 13:52217573-52217595 AGGGCTCCTTTCAGGTCCAGGGG + Intergenic
1116064574 14:39966698-39966720 AGAGATCTTCTATGTTCCAGAGG + Intergenic
1118186657 14:63543640-63543662 AGAGCTCCTCTCAGGCCCAGCGG - Intergenic
1118892515 14:69921903-69921925 AGAGCACTTCAGGGGTCCAGGGG - Intronic
1119481601 14:74961654-74961676 AAAGCTCTTCTGAAATCCAGAGG + Intergenic
1122062743 14:99147565-99147587 AGAGCTGATCTTAGGACCGGGGG - Intergenic
1122436206 14:101702000-101702022 ATAACTCTTCTTAGGTCTTGAGG + Intergenic
1124472177 15:29997737-29997759 ACAGCTCATCTCAGCTCCAGTGG + Intergenic
1124811381 15:32942375-32942397 AGAATTCTTGTCAGGTCCAGTGG + Intronic
1126049628 15:44674208-44674230 AGAGCTCTGCTTAGCTCCCCTGG - Exonic
1128672978 15:69588070-69588092 AGAGCTCAGCTGAGGCCCAGAGG - Intergenic
1138458696 16:57135331-57135353 AGAAATCCTCTTAGGCCCAGGGG - Intronic
1140027142 16:71301010-71301032 AGAAATCTTCTTAAGTGCAGAGG - Intergenic
1143585309 17:7847794-7847816 AGAGCTCTTCTTTGGGACTGAGG + Exonic
1143907419 17:10220303-10220325 AGAGCAGTGCCTAGGTCCAGAGG + Intergenic
1145797396 17:27663847-27663869 GGAGCTCTTCTAAGGGCCTGAGG + Intergenic
1152664130 17:81557604-81557626 ACAGCTCATCTCAGGACCAGAGG + Exonic
1154467668 18:14665086-14665108 AGAGCTCCTCTTAGGGTTAGTGG - Intergenic
1166499710 19:43331527-43331549 GGAGCACTTCCTAGGGCCAGGGG + Intergenic
1166656841 19:44618465-44618487 TGGGCTCTTCTGAGGTCCAGTGG - Intronic
1168593604 19:57656079-57656101 AGAGCTTTTCTTAGTACCAAAGG + Intergenic
925047793 2:787814-787836 ACATCTCTTCTTTTGTCCAGTGG - Intergenic
925841586 2:7997079-7997101 AGAGCTCTTCTTAGGGACTTTGG - Intergenic
928460435 2:31467413-31467435 AAAGCCCTTCTTAGGCCAAGGGG + Intergenic
931934334 2:67179111-67179133 AGGGATCATCTAAGGTCCAGGGG + Intergenic
938873869 2:135511815-135511837 GGAACTCTTCTTATGTCCATGGG - Intronic
947121514 2:226820280-226820302 AGCACTTTTCTTAGGTCCTGTGG - Intergenic
948305620 2:236944852-236944874 AGGGCTCTTCTCAGGGCCAGGGG + Intergenic
1168954511 20:1825803-1825825 AGAGCCCTTCCTAGTTCCAGCGG + Intergenic
1170435200 20:16319480-16319502 ACAACTCTTTTTAGATCCAGTGG + Intronic
1171395249 20:24828984-24829006 TGGGCTCTTCTTGGGTCCTGGGG - Intergenic
1171447412 20:25214493-25214515 AGAGCCCTTCTAAGCCCCAGCGG + Intronic
1173823489 20:46032859-46032881 AGAGCTCTTCTGAGACCCTGGGG + Intronic
1173946172 20:46952609-46952631 AGAGCTCCTGTTTGGTCCAGAGG + Intronic
1175378137 20:58543208-58543230 TGGCCTCTTGTTAGGTCCAGGGG + Intergenic
1175970276 20:62682861-62682883 AGAGCTCTGCACAGGTGCAGCGG - Intronic
1176806843 21:13492591-13492613 AGAGCTCCTCTTAGGGTTAGCGG + Intergenic
1177379036 21:20314360-20314382 AGAGCTCTTCTTAGGTCATAGGG - Intergenic
1177838156 21:26208797-26208819 AGATTTCTTCTTAGGTACATGGG + Intergenic
1178027025 21:28479615-28479637 AGAGCCCTGCTTAGTTTCAGAGG - Intergenic
1183387869 22:37525425-37525447 GGAGCTCCTCTCAGGTGCAGGGG - Intergenic
1183865217 22:40698979-40699001 AGTTCTCTGCTTAGGTCCTGTGG - Intergenic
1184320207 22:43735899-43735921 AGAACCCTTCTTAGCTCCTGCGG + Exonic
1185011799 22:48318759-48318781 AGAGGCCTTCTTGGGACCAGGGG - Intergenic
950148067 3:10665871-10665893 AGAGCCCTTCTCTGGTCTAGTGG - Intronic
950320876 3:12051713-12051735 AGAGATCTTCTCTGGACCAGAGG + Intronic
952344775 3:32473188-32473210 AGGGCTCTTCAAAGGTTCAGGGG - Intronic
960071580 3:113437113-113437135 AGAGTCCTTCTAAGTTCCAGAGG + Intronic
960839985 3:121947772-121947794 AGAGCTCTACTGAGGTTTAGAGG - Intergenic
963543470 3:146624906-146624928 AGACCTCTTCTTGGGACCTGAGG - Intergenic
964212468 3:154243692-154243714 AGAGGTCTCCTTGGGTACAGAGG + Intronic
967488464 3:190061232-190061254 AATGCTCTCCTAAGGTCCAGAGG - Intronic
968972778 4:3804548-3804570 AGTCCTATTCTGAGGTCCAGAGG - Intergenic
969760560 4:9178262-9178284 ACAGCTCCTCTTAGGATCAGGGG - Intergenic
974280552 4:59786143-59786165 AGAGCTCCTCTTAGGGTTAGTGG + Intergenic
974502436 4:62724937-62724959 AGGGCTGTTCTGAGTTCCAGAGG + Intergenic
976094885 4:81498179-81498201 AGAGCACTTCAAAGGTACAGAGG + Intronic
976868595 4:89762405-89762427 GGAGATATTCTTAAGTCCAGGGG - Intronic
977795434 4:101159186-101159208 CGAGCTCTTCTTGGGCCCTGCGG - Intronic
984320227 4:178186394-178186416 AGAGAACTTCTTAGTTCCACAGG + Intergenic
990973416 5:61535058-61535080 CTAACCCTTCTTAGGTCCAGGGG + Intronic
997523576 5:134538632-134538654 AGTGCGCTTCTCAGTTCCAGAGG - Intronic
999464611 5:151790334-151790356 AGAACTCTTCTTATGTCCATGGG + Exonic
999716006 5:154360488-154360510 AGAGCTCTGCTTATGTCATGTGG - Intronic
1000054459 5:157592685-157592707 TCAGCTCTTCTCATGTCCAGTGG - Intergenic
1000500803 5:162047222-162047244 AGAGGTCTTGTAAGGGCCAGTGG - Intergenic
1004072943 6:12318813-12318835 AGATCTCTCCTGAGGTGCAGGGG - Intergenic
1007718324 6:43870112-43870134 AGACATCTTCTGAGGGCCAGTGG - Intergenic
1011299969 6:85863615-85863637 AGAAATCTTCTTAGGACTAGTGG - Intergenic
1012031802 6:94079183-94079205 AGTGCTCTTCTTAGGATTAGTGG + Intergenic
1013277782 6:108602420-108602442 AAAGATCTTCTTAGGCCAAGTGG - Intronic
1013836499 6:114342003-114342025 AGAGGTTTGCTTAGGACCAGAGG - Intronic
1016932795 6:149426686-149426708 CGAGCTGTTCGGAGGTCCAGCGG - Intergenic
1018720231 6:166566530-166566552 AGAGCTCTGCACAGGTGCAGGGG + Intronic
1026897313 7:74017313-74017335 AGAGCTTTTATTAATTCCAGGGG + Intergenic
1031356446 7:120792495-120792517 AGGGCTGTGCTTAGGTTCAGGGG + Intronic
1036120589 8:6013178-6013200 AAAGCTATTCTTAGGTAAAGTGG + Intergenic
1039602854 8:38856181-38856203 AGAGGGCTTGTTAGGTCCACAGG - Intergenic
1040516918 8:48143214-48143236 AAAGCCCTTCTTAGGCCCGGCGG + Intergenic
1042091102 8:65160776-65160798 AGAGCTCATCTTTGCTCTAGAGG + Intergenic
1044846249 8:96384844-96384866 AGACCTCTTATTACGTCCAGGGG + Intergenic
1056898810 9:90579409-90579431 AGAGCTCTCATGGGGTCCAGAGG + Intergenic
1059686245 9:116639538-116639560 GGAGCTCTTCTTAGGTCATTAGG - Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1191566042 X:62532700-62532722 AAAGCTCTCCTAATGTCCAGTGG - Intergenic
1193310826 X:80008469-80008491 AAATCTTTTCTTAGGTTCAGGGG + Intergenic
1194850189 X:98859797-98859819 TGAGGCCTTCTCAGGTCCAGAGG + Intergenic
1195548128 X:106136623-106136645 AGACTTCTTATTAGATCCAGTGG - Intergenic