ID: 905724276

View in Genome Browser
Species Human (GRCh38)
Location 1:40235789-40235811
Sequence CAGGCACAAGATGCTGGTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905724274_905724276 -10 Left 905724274 1:40235776-40235798 CCTCTTTTACTTACAGGCACAAG 0: 1
1: 0
2: 1
3: 8
4: 175
Right 905724276 1:40235789-40235811 CAGGCACAAGATGCTGGTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905724276 Original CRISPR CAGGCACAAGATGCTGGTCT TGG Exonic
901326278 1:8367357-8367379 CAGGCATAAGATGCAGCTGTGGG - Intronic
903472111 1:23594555-23594577 CAGGTACCAGATACTGGACTGGG - Intronic
904052783 1:27650246-27650268 CAGGGACAAGATGGTGGACATGG - Intergenic
904790332 1:33015611-33015633 CAGGCATAAGCTGCTGGGCCCGG - Intronic
904836536 1:33341209-33341231 CAGGCACAACACACTGGACTAGG + Intronic
904836885 1:33343618-33343640 CAGGCACAACACACTGGACTAGG + Intronic
904924794 1:34039087-34039109 CATGCAGAATAGGCTGGTCTGGG - Intronic
905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG + Intronic
905724276 1:40235789-40235811 CAGGCACAAGATGCTGGTCTTGG + Exonic
906346341 1:45017666-45017688 CAGGGAGAAGATGAAGGTCTGGG - Exonic
906692414 1:47801250-47801272 CTGGCTCAAGTTGCTGCTCTTGG + Intronic
906946137 1:50295909-50295931 CAGGCACGAGTAGCTGGGCTTGG + Intergenic
909341510 1:74537040-74537062 CTGGCTCCAGATGCTGTTCTAGG - Intronic
910238859 1:85064541-85064563 GAGGCCCAAGATGTTAGTCTTGG + Intronic
912379641 1:109240425-109240447 AGGGCCCAAGATGCAGGTCTGGG + Intergenic
912581468 1:110724666-110724688 CAGCCACAAGATGTTACTCTAGG - Intergenic
912581597 1:110725874-110725896 CAGCCACAAGATGTTGTTCTAGG - Intergenic
912938596 1:114025049-114025071 CAGACACAAGAAGCTGATTTAGG + Intergenic
915729939 1:158046155-158046177 CAGGCACAAGATGATAGCTTGGG + Intronic
916411324 1:164550031-164550053 CAGGTTTAAGCTGCTGGTCTGGG - Intergenic
918910526 1:190562811-190562833 CAGGCACAAGATGGGGGGATGGG - Intergenic
919806060 1:201381687-201381709 CAGCCCCAAGAGGCTGGGCTGGG + Exonic
920580182 1:207099144-207099166 CAGGCACTAGATTCTCATCTGGG + Intronic
920738813 1:208560581-208560603 CATGCTGAAGATGCTGGTCTGGG + Intergenic
922003548 1:221504795-221504817 CTGGCTCAGGATGCTGATCTAGG - Intergenic
922675519 1:227546851-227546873 CAGGCACTTGGGGCTGGTCTGGG + Intergenic
923296293 1:232597769-232597791 CAGGCAAGAGAGGCTGATCTTGG + Intergenic
1067465416 10:46494642-46494664 TGGGCACCAGATGCTGGACTGGG + Intergenic
1067621771 10:47889959-47889981 TGGGCACCAGATGCTGGACTGGG - Intergenic
1067941079 10:50658140-50658162 GAGGCCAAAGATGCTGCTCTAGG + Intergenic
1068639537 10:59387884-59387906 AAGGCACAAGAAGCCAGTCTGGG - Intergenic
1069415744 10:68199433-68199455 CTCCCACAAGATGCTGGTCAGGG + Exonic
1070163018 10:73877017-73877039 CAGGCACATGAGACTGGTCAGGG - Intergenic
1070440318 10:76436567-76436589 CAGTGACAAGATGCTGGCTTTGG + Intronic
1070862293 10:79683012-79683034 GAGGCCAAAGATGCTGCTCTAGG + Intergenic
1071562440 10:86654878-86654900 CAGGCTGGAGATGCTGCTCTGGG - Exonic
1078640536 11:13091581-13091603 TAGGCAGGAGAGGCTGGTCTGGG - Intergenic
1081669370 11:44934676-44934698 CAGGCTTGACATGCTGGTCTGGG - Exonic
1081671669 11:44945928-44945950 CAGGCAATAGATTCTGGGCTAGG - Intronic
1083694722 11:64434912-64434934 CAGGATTAACATGCTGGTCTGGG + Intergenic
1083810821 11:65105719-65105741 CAGGCACTAGCTGCAGGTCAGGG + Intronic
1086885390 11:92199793-92199815 CAGGGACAAGACACTGCTCTAGG + Intergenic
1087356209 11:97097797-97097819 GAAGCTCAAGCTGCTGGTCTAGG - Intergenic
1089116991 11:116103382-116103404 CCGGGACAAGCTGCTGCTCTGGG - Intergenic
1089405952 11:118197777-118197799 CAGGCAGCAGATCCTGGTATTGG - Intronic
1093848255 12:24001807-24001829 CAGACATAAGATGCAGGTATGGG + Intergenic
1095990010 12:48027979-48028001 CATGCATTAGATGCTGGGCTCGG + Intergenic
1096409795 12:51368935-51368957 CAGGTGCCAGATGCTGTTCTGGG + Intronic
1096672432 12:53208069-53208091 CAGGCACACTCGGCTGGTCTGGG + Intergenic
1098277294 12:68825812-68825834 CATGTACGAGATTCTGGTCTGGG - Intronic
1100316159 12:93446602-93446624 CAGCAAAAAGATGCTGGTCCAGG + Intergenic
1101074664 12:101116483-101116505 CAGGAACAAGTTGCTTGTTTTGG - Intronic
1102632378 12:114292463-114292485 CAGGGACAAGATACTGTTCTGGG + Intergenic
1103993571 12:124814972-124814994 CATGCCCAACATCCTGGTCTTGG - Exonic
1104977369 12:132558149-132558171 CAGGCCCAGGGTGCTGGCCTGGG - Intronic
1105210806 13:18255700-18255722 CAGGCAAGAGATGATGGCCTGGG + Intergenic
1106086398 13:26546202-26546224 CAGGCACAACAGGCTGCTGTGGG - Intergenic
1107868732 13:44728209-44728231 CAGGCACCAGTTGCAAGTCTGGG + Intergenic
1109269499 13:60238586-60238608 CTGGCACAAGAAGATGTTCTAGG + Intergenic
1113212164 13:107995735-107995757 CATCCACTAGATGTTGGTCTTGG - Intergenic
1120490576 14:85174008-85174030 AAGGCACATGATAATGGTCTAGG + Intergenic
1125724336 15:41860704-41860726 GAAGCACAAGATGCTGGAGTGGG - Exonic
1129735617 15:77960078-77960100 CAGTCAGAAGATTCTGTTCTTGG + Intergenic
1131223170 15:90601978-90602000 CAGGCCCAGGATTCTAGTCTAGG - Intronic
1131686466 15:94773283-94773305 CAGGCACCAGGTGCAGGGCTAGG - Intergenic
1133718423 16:8471330-8471352 CAGGCATAAGCTGCTGCTCCTGG - Intergenic
1133740000 16:8644211-8644233 CAGGCACCAGATTCTGTGCTGGG + Intronic
1136332264 16:29588001-29588023 CAGGCACAAGCTACTGCACTGGG - Intergenic
1136446959 16:30328070-30328092 CAGGCACAAGCTACTGCACTGGG - Intergenic
1137231239 16:46569557-46569579 CAGGCACCAGAAGCTGCGCTGGG - Intergenic
1138343343 16:56305212-56305234 CAGTTACAAGATGCTGCTCATGG - Intronic
1138415269 16:56867999-56868021 CAGACACAGGATCCTGGGCTTGG + Intronic
1139486352 16:67258753-67258775 CAGGCATAAGAGGCTGGGCACGG + Intronic
1142485413 17:244554-244576 CAGGAAGAAGATGCTGGCCCCGG + Intronic
1142814392 17:2413909-2413931 CCGGCACAAGATCCCAGTCTTGG + Intronic
1143167312 17:4903272-4903294 CAGGCAAAGGACGCTGGGCTGGG - Intergenic
1144312703 17:14027661-14027683 CAGGGAAAAGATGAAGGTCTGGG - Intergenic
1144332054 17:14233666-14233688 CAGGGAAAAGATGAAGGTCTGGG + Intergenic
1144498771 17:15767917-15767939 CAGGGAAAAGATGAAGGTCTGGG - Intergenic
1145162153 17:20582951-20582973 CAGGGAAAAGATGAAGGTCTGGG - Intergenic
1146659955 17:34659057-34659079 CAGGCCCAGGATGCTGGACCGGG + Intergenic
1146759533 17:35464502-35464524 CAGTGAGAAGATGCTGGACTTGG + Intronic
1148506984 17:48135317-48135339 TAGTGACAACATGCTGGTCTTGG + Intronic
1149031606 17:52089264-52089286 CAATGAAAAGATGCTGGTCTTGG + Intronic
1149460210 17:56822989-56823011 CAGGAACATGATGCTGACCTTGG - Intronic
1150347209 17:64413510-64413532 CAGTGACAAAATGCTGGTCCTGG - Intronic
1150932053 17:69595818-69595840 CAGGCACAAGATGGGGATCCTGG - Intergenic
1151605065 17:75130789-75130811 AAGGGACAAGACGGTGGTCTTGG - Exonic
1153406909 18:4751064-4751086 CAGCCAGAAGAGGCTGATCTGGG - Intergenic
1154030834 18:10752774-10752796 CATGCAAAAGATGCTGATCCTGG + Exonic
1155085249 18:22452140-22452162 GTGGCACAAGATGCTGCACTAGG + Intergenic
1156299897 18:35827092-35827114 CAGGCACAGGATTCAGGTCTGGG - Intergenic
1156399154 18:36725110-36725132 CAGGTACAGGATGCTAGACTAGG - Intronic
1161722477 19:5910893-5910915 CAGCCTCAAAATCCTGGTCTTGG + Intronic
1162641604 19:12014601-12014623 CTGGAACAAAATGGTGGTCTGGG - Intergenic
1166431502 19:42731975-42731997 CAGGCAAAAGCTGGTGGTTTTGG + Intronic
1166434624 19:42757188-42757210 CAGGCAAAAGCTGGTGGTTTTGG + Intronic
1166447473 19:42870954-42870976 CAGGCAAAAGCTGGTGGTTTTGG + Intronic
1166451940 19:42909766-42909788 CAGGCAGAAGCTGGTGGTTTTGG + Intronic
1166470336 19:43074547-43074569 CAGGCAAAAGCTGGTGGTTTTGG + Intronic
1166483935 19:43197188-43197210 CAGGCAAAAGCTGGTGGTTTTGG + Intronic
1166491052 19:43261053-43261075 CAGGCAAAAGCTGGTGGTTTTGG + Intronic
1167350295 19:48969908-48969930 CAGGCAGATGATGGGGGTCTTGG + Intronic
1167424360 19:49422479-49422501 CATGCACAAGCTGCTGGTGTTGG - Exonic
925845054 2:8027355-8027377 CAGTCACCAGAAGCTGGTCATGG - Intergenic
926006597 2:9377831-9377853 CAGGAAGAAGCTGCAGGTCTTGG - Intronic
926896464 2:17695173-17695195 CAGGCAGAACATGCTAGTCATGG - Exonic
928887904 2:36171018-36171040 GAGGCAGAAGATGTGGGTCTGGG + Intergenic
928939138 2:36709505-36709527 CAGAAACAAGATGCAGGTCCTGG - Intronic
929485374 2:42348626-42348648 CAGTCACAACATGCTGGGCACGG + Intronic
929493124 2:42415294-42415316 CAGAAATAAGATGCTTGTCTTGG - Intronic
930116457 2:47722460-47722482 CAGACACAAGCTGCTGTTCCTGG - Intronic
933258353 2:80105887-80105909 CAGGCAAAAGAAGATGGTCTGGG + Intronic
935202673 2:100871471-100871493 CAGGCACATGCTGCTGTGCTTGG + Intronic
936475558 2:112836737-112836759 AAGGCACAACAGGCTGCTCTGGG - Exonic
937354986 2:121192660-121192682 CAGGCACAGGGAGCTGGTCAGGG - Intergenic
943224069 2:185145525-185145547 CAGGCACCAGCAGCTGGACTAGG - Intergenic
944724902 2:202461119-202461141 CAGGCACAAGACGCTGCACTCGG + Intronic
947461147 2:230306021-230306043 CCTGCACCAGATGCTGGCCTGGG + Intronic
947624082 2:231608530-231608552 TATGCACCAGATGCTGTTCTGGG + Intergenic
947745288 2:232503991-232504013 CAGGAACAAGAGGCAGGGCTGGG - Intergenic
948436445 2:237956819-237956841 CAGACACCAGCTGCTGCTCTGGG - Intergenic
948455140 2:238101381-238101403 CAGGAACAGGATGCTGGGCCGGG - Intronic
1170819073 20:19740523-19740545 AAGGCACCTGATGCTGGTCCAGG - Intergenic
1171291946 20:23987389-23987411 CAGGCAAGAGATGATGGCCTGGG + Intronic
1172640094 20:36435686-36435708 CAGGCTCTGGATCCTGGTCTGGG + Intronic
1175795810 20:61770022-61770044 GAGGCACAGGCTACTGGTCTGGG + Intronic
1180765449 22:18343717-18343739 CAGGCAAGAGATGATGGCCTGGG - Intergenic
1180780865 22:18518675-18518697 CAGGCAAGAGATGATGGCCTGGG + Intergenic
1180813581 22:18775982-18776004 CAGGCAAGAGATGATGGCCTGGG + Intergenic
1180866068 22:19120604-19120626 CAGGCAGGAGATGCTGGGCCTGG + Intronic
1180906258 22:19414143-19414165 CAGGGACAACATTCTGATCTGGG - Intronic
1181050423 22:20235723-20235745 CACGCACAAGCTGCTGGACGTGG + Intergenic
1181199765 22:21210312-21210334 CAGGCAAGAGATGATGGCCTGGG + Intronic
1181399998 22:22645546-22645568 CAGGCAAGAGATGATGGCCTGGG - Intronic
1181649366 22:24250244-24250266 CAGGCAAGAGATGATGGCCTGGG + Intergenic
1181701973 22:24626644-24626666 CAGGCAAGAGATGATGGCCTGGG - Intronic
1183023239 22:35044106-35044128 CAGGCACAAGAGGATGGGCCAGG + Intergenic
1183964866 22:41435569-41435591 CAGGGCCATGATGATGGTCTGGG + Exonic
1184295234 22:43519334-43519356 CAGGCACCAGAAGATGTTCTAGG + Intergenic
1184504122 22:44890904-44890926 CAGGCACAAGAGGGTGGGCAAGG + Intronic
1184647832 22:45905816-45905838 CCGGCTCAAGCTGATGGTCTGGG + Intergenic
1203227070 22_KI270731v1_random:84607-84629 CAGGCAAGAGATGATGGCCTGGG - Intergenic
1203263681 22_KI270734v1_random:1664-1686 CAGGCAAGAGATGATGGCCTGGG + Intergenic
949943625 3:9173319-9173341 CAGGCCCCAGATGATGGTCTTGG + Intronic
950189761 3:10968512-10968534 CTGGCGGGAGATGCTGGTCTTGG + Intergenic
951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG + Intergenic
951157147 3:19369535-19369557 CAGGCTCAAGATACTGTTTTGGG - Intronic
951580109 3:24153653-24153675 CAGACACAAGATGCTGATTCAGG + Intronic
952272205 3:31844090-31844112 TAGGTACAAGATGCTGAACTAGG + Intronic
955026025 3:55168281-55168303 CAGGCAAAAGATGATGGTGGAGG + Intergenic
955035758 3:55265708-55265730 CAGGAAAAGGAGGCTGGTCTGGG + Intergenic
961331962 3:126147719-126147741 GAGGCATGAGATGCTGGTCCAGG + Intronic
962668977 3:137685696-137685718 CACGCCCATGAAGCTGGTCTTGG + Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966769868 3:183494171-183494193 GAGGCATAAGATGGTGGTGTTGG - Exonic
968786597 4:2626524-2626546 CAGGCACCAGAGACTGGTCCTGG - Exonic
969467325 4:7365440-7365462 CTGGGACAAGAGCCTGGTCTGGG + Intronic
972270080 4:37502502-37502524 CAGGCACAGGGTGCTGGTGGGGG + Intronic
973222394 4:47743594-47743616 CAGGCACAAGAGGCTGGGAACGG + Intronic
975340162 4:73231149-73231171 CAGACACAAAATGGAGGTCTAGG + Intronic
975592069 4:76010816-76010838 CAGGGAAATGATGCTGGCCTGGG - Intergenic
975791766 4:77960757-77960779 CAGGCACAAGCTCCGGGGCTTGG + Intergenic
979063296 4:116095902-116095924 GAAGCACAAGATGCTGGTCTTGG - Intergenic
981057611 4:140381485-140381507 GAGGCACAAGATGGTGGACAGGG - Exonic
984366404 4:178804890-178804912 CAGGCAGGAGATACTGGTATGGG + Intergenic
985508226 5:296975-296997 CACGCACACCGTGCTGGTCTGGG + Intronic
985532178 5:440381-440403 CAGGCCCGAGAAGCTGGTGTGGG - Intergenic
985739812 5:1608696-1608718 CACGCACACCGTGCTGGTCTGGG - Intergenic
987400286 5:17468392-17468414 CTGGCAGGAGATGCTGGTATTGG + Intergenic
991130990 5:63122153-63122175 CAGGCATCAGAAGCTGGCCTGGG + Intergenic
991463089 5:66879788-66879810 CAGGCATGAGACACTGGTCTGGG + Intronic
992447556 5:76847725-76847747 CAAGCACAAGACTGTGGTCTAGG - Intergenic
994422093 5:99534678-99534700 CTGGGACAGGATGCTGATCTCGG - Intergenic
995337010 5:111011273-111011295 GAGGCTGAAGAAGCTGGTCTTGG - Intergenic
996838620 5:127822096-127822118 CAGGGACAACATTCTGGGCTTGG + Intergenic
999177256 5:149640133-149640155 AGGGCAGAAGCTGCTGGTCTTGG + Intergenic
999733836 5:154497807-154497829 CAGGGACAAGCTGCTTGTCCAGG - Intergenic
1002370852 5:178753042-178753064 CAGGGATAAGATGCTGGACCAGG + Intergenic
1003094105 6:3129131-3129153 CATCCACAAGATGGTGATCTGGG + Exonic
1005966748 6:30731881-30731903 GATACACAAGAAGCTGGTCTTGG - Intronic
1007041934 6:38730345-38730367 CAGGCACAAGATGCTGAGATAGG - Intronic
1007284674 6:40738973-40738995 CTGCCATAAGATGCTGGCCTAGG - Intergenic
1007596141 6:43052536-43052558 CTGCCACAAGATGCTGGGCGAGG - Exonic
1010641201 6:78330337-78330359 TAGGCAAAACATGCTGGGCTTGG - Intergenic
1010865216 6:80967939-80967961 CAGGCTCATGATGCTGGTGATGG - Intergenic
1011394051 6:86887502-86887524 CAGACACATCATGGTGGTCTTGG + Intergenic
1013754114 6:113441019-113441041 CAAAAACAAGATGCTGGTCTGGG + Intergenic
1016220843 6:141668437-141668459 GAGGCACCAGCTGCTGATCTAGG - Intergenic
1018781112 6:167066464-167066486 CAGGCACCAGTCGCAGGTCTGGG - Intergenic
1019788921 7:2997646-2997668 CGGGGACAGGATGGTGGTCTGGG + Intronic
1023534093 7:41189840-41189862 CATGCAAAAGATGGTGGTGTGGG - Intergenic
1023831310 7:44040331-44040353 CAGGCACAGGAAGCTGGTGACGG + Intergenic
1025082081 7:55992610-55992632 AAGGCACAAGATGCTTGAGTTGG - Intronic
1029741640 7:102494637-102494659 CAGGCACAGGAAGCTGGTGACGG + Exonic
1029759631 7:102593806-102593828 CAGGCACAGGAAGCTGGTGACGG + Exonic
1029776999 7:102689716-102689738 CAGGCACAGGAAGCTGGTGACGG + Intergenic
1032261038 7:130337544-130337566 CAGGCCCAAGGGGCTGGCCTTGG + Intergenic
1032464602 7:132136125-132136147 CAGGCACAAGGTGCTGGCTAGGG - Intronic
1035253472 7:157612125-157612147 CAGGCACCAGGTGCTGCTCAGGG - Intronic
1037684813 8:21129747-21129769 CAGGCACTAGCTGCTAATCTGGG + Intergenic
1039545612 8:38408847-38408869 CAGGCCCAAGATGGAGGTGTCGG - Intronic
1039648053 8:39308356-39308378 CAGACACAAGAAGCAGGTTTAGG - Intergenic
1040481796 8:47833499-47833521 CAGGCACCAGGACCTGGTCTTGG - Intronic
1044320166 8:90792161-90792183 AAGCCACAAGCTGCAGGTCTGGG - Intronic
1044426801 8:92061697-92061719 CAGGCAGAAGAGGCTGTGCTTGG - Intronic
1046700945 8:117400702-117400724 CAAGCACCAGAAGCTGGACTGGG + Intergenic
1047524561 8:125621741-125621763 TAGACACAAGATCCTGGCCTGGG + Intergenic
1048205427 8:132411708-132411730 AAGGAACTAGAAGCTGGTCTGGG + Intronic
1048339569 8:133528265-133528287 CAGGCACAAAATGCTGGCAAGGG - Intronic
1048876826 8:138843192-138843214 CAGGCACAAGATGCAGATGCTGG + Intronic
1049523399 8:143107071-143107093 CTGGAACAAGATGGTGGTCATGG - Intergenic
1049975360 9:856350-856372 CAGTCACAAGAATCTGGTTTTGG + Intronic
1056507075 9:87267794-87267816 CGGGCACCAGATGCTGGGCTGGG - Intergenic
1057080494 9:92171300-92171322 CAGGCCAAAGTTGCTGCTCTAGG + Intergenic
1060393648 9:123300508-123300530 CAGTGAGAAGATGCTGGTCTGGG + Intergenic
1060802659 9:126554459-126554481 CAGGCACAAGGGGCTGGTCCAGG - Intergenic
1061890485 9:133616724-133616746 CAGCCACCAGGTGCTGGTCTTGG + Intergenic
1187669773 X:21656934-21656956 CACCAACAAGATGCGGGTCTGGG + Exonic
1189512729 X:41679806-41679828 CAGTCACAAGATGATGTTCCAGG + Intronic
1190220923 X:48511867-48511889 GAGGAAAAAGGTGCTGGTCTTGG - Intronic
1191864193 X:65690689-65690711 CAGGCACAAGACACACGTCTTGG - Intronic
1192551939 X:72061520-72061542 CAGGCAAAAGATGATGGGCCAGG - Intergenic
1193021361 X:76797087-76797109 CAGGCACAAGCTGCATGCCTGGG + Intergenic
1195528192 X:105919271-105919293 CAGGCTCAAAATTCAGGTCTGGG - Intronic
1197462993 X:126766250-126766272 CAGGCACTAGATGCTAAGCTGGG - Intergenic
1197669433 X:129259919-129259941 CAGGCACTGTGTGCTGGTCTAGG - Intergenic
1198021242 X:132660205-132660227 TAGGTACAAGATGCTACTCTAGG - Intronic
1199685940 X:150265710-150265732 CAGGCACAACATACAGGACTAGG + Intergenic
1202575217 Y:26316987-26317009 CAGGCACAGGAAGTTGATCTGGG - Intergenic