ID: 905730172

View in Genome Browser
Species Human (GRCh38)
Location 1:40292569-40292591
Sequence TGGGATTCCCTGTTTCTGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905730172 Original CRISPR TGGGATTCCCTGTTTCTGAC TGG Exonic
900933444 1:5750915-5750937 TGGGCTGCCCTTTTTCTGAGGGG - Intergenic
905000681 1:34666259-34666281 TTGGCTTCAGTGTTTCTGACTGG - Intergenic
905730172 1:40292569-40292591 TGGGATTCCCTGTTTCTGACTGG + Exonic
909278374 1:73718184-73718206 TGTGCTGCCCAGTTTCTGACAGG - Intergenic
909833079 1:80218335-80218357 TGGTATTCACTGTCTCTCACTGG + Intergenic
910342089 1:86199936-86199958 TGGGATTTCCTATTGCTGCCTGG + Intergenic
910875301 1:91872946-91872968 TGGTTTTCCCTTTTTTTGACGGG + Intronic
917704615 1:177619608-177619630 TGGCCTTCCCAGTATCTGACCGG - Intergenic
920341307 1:205276688-205276710 TGGGAGGCCCTGTGTCTGGCGGG - Intergenic
920563097 1:206953112-206953134 TTTGATTCTCTGTTTCTGAGAGG + Intergenic
922880533 1:228977161-228977183 TGGTGTTCCCTGTTTCCGACAGG + Intergenic
924455649 1:244217035-244217057 TGGGCCTTCCTGTTGCTGACTGG + Intergenic
924659774 1:246005715-246005737 TAGGATTCTCTGTTTGTGAGAGG - Intronic
1065182770 10:23143714-23143736 TGGCCTTCCTTGTTTTTGACTGG - Intergenic
1065700486 10:28420627-28420649 TGGGACTCCCTGACTCTGATTGG + Intergenic
1065819427 10:29511365-29511387 TGGGACTCCCAGTTCCTGATGGG + Intronic
1065886134 10:30079028-30079050 TGGGTTTCCCTGCTGTTGACTGG - Intronic
1065953420 10:30673049-30673071 TGGGACTCCCAGTTCCTGATGGG - Intergenic
1068946303 10:62732985-62733007 TGGGATTACCTGCTTTTGAAGGG + Intergenic
1071790809 10:88952194-88952216 TGGGTTTCCCTGGCTCTAACTGG - Intronic
1074605189 10:114956179-114956201 TGGGACTCACAGTTTCTCACTGG - Intronic
1078023699 11:7674493-7674515 TGGGCTTCTCTGTTTCACACAGG - Intronic
1078886550 11:15506159-15506181 TGGGATGGGCTGTTTCTGAGTGG - Intergenic
1081001619 11:37680312-37680334 TGGGATTCCCAGTTTTTGTGGGG - Intergenic
1088233262 11:107695657-107695679 TGTCATTCCTTTTTTCTGACTGG - Intergenic
1088523921 11:110730788-110730810 TGGGATTCTCTGCTTCTGGTTGG - Intergenic
1089755227 11:120681386-120681408 TGGGATTCCATGTTCCTGTGCGG + Intronic
1090095014 11:123734164-123734186 TGGGCTGTCCTGTTCCTGACAGG + Intronic
1090654981 11:128836175-128836197 TGGAATTTCCTCTTTCTGTCCGG - Intergenic
1092780509 12:11982010-11982032 TGGAATTTCTTGTTTCTGAATGG - Intergenic
1094203346 12:27815676-27815698 TGGGATTCTATGTTCCTGAAGGG + Intergenic
1094278240 12:28704641-28704663 TGGGATTTTCTGTTTTTGAGAGG + Intergenic
1096842030 12:54385534-54385556 TGGGAACCCCTGTTGCTGTCAGG - Intronic
1099245526 12:80189181-80189203 TAGGATTCCATTTTTCTGATGGG + Intergenic
1100235058 12:92652726-92652748 TGGGATTCCCTGGTCCTGGAGGG - Intergenic
1110356968 13:74577913-74577935 TGGGATTTCCTGCTTCTGGTTGG + Intergenic
1111883428 13:93988132-93988154 TGTGATTCAATGTTTCTGGCAGG - Intronic
1114809084 14:25874672-25874694 TGGGACTCTGTGTTACTGACTGG - Intergenic
1115058541 14:29162112-29162134 TGGTATTTCCTGTTTATGATAGG - Intergenic
1116443750 14:44984973-44984995 TGGTTTTCTCTGTGTCTGACAGG - Intronic
1117449585 14:55837892-55837914 TAGCATTCCCTGGTTCTGCCAGG + Intergenic
1119937593 14:78607003-78607025 TTGAATTCCCTGATTCTGGCTGG + Intronic
1120407771 14:84110255-84110277 GGGAATTCACTATTTCTGACAGG - Intergenic
1122894205 14:104747889-104747911 TAGGATTCCCTGTCTTTGAAAGG - Intergenic
1124053999 15:26224886-26224908 AGGGATAACCTGTTTCTGAAGGG - Intergenic
1124361444 15:29039400-29039422 TAGGATTCACAGTTTCTGATGGG - Intronic
1125085118 15:35721034-35721056 TGGAATTTCCTGTTTCAGACAGG + Intergenic
1125294875 15:38191625-38191647 TGTGATTCTCTGTATCTGCCTGG + Intergenic
1128412548 15:67414064-67414086 TGGGATTCCCTGCCTCTGAAGGG - Intronic
1128746015 15:70114583-70114605 TGGGTCTCCCTGTTCCTAACAGG - Intergenic
1129240394 15:74248473-74248495 TGGGAATCCCTGTCTCAGCCTGG + Intronic
1130006591 15:80105003-80105025 TGGGATTCCCTGTTGCTTGTGGG + Intronic
1131993214 15:98110046-98110068 TGGGGATCCCTGTTTCTTACTGG + Intergenic
1132663019 16:1069929-1069951 AGGGTCTCCCTGTTTCTGTCTGG + Intergenic
1135993284 16:27230324-27230346 TGGGAAGCCCTGTGTCTGAGAGG + Intronic
1137769610 16:51005375-51005397 TGGGGATCCATGTGTCTGACAGG - Intergenic
1139893334 16:70268679-70268701 TGGGAATCTCTCTTACTGACAGG - Intronic
1141547565 16:84781445-84781467 TGGGCTTCCCTGTCTGTGGCTGG - Intergenic
1141602988 16:85137469-85137491 TGGAGTTCCCTGCTGCTGACAGG + Intergenic
1141806212 16:86343325-86343347 TGGCTTTCCGTGTTTCTGATGGG - Intergenic
1143591803 17:7889473-7889495 TGGGATGCTCTGGTTCTGAATGG - Intronic
1150916374 17:69441858-69441880 AGGGACTCCCTGTTACTGATAGG + Intronic
1151836752 17:76586876-76586898 TGCGATGCCCTGTTCCTAACAGG + Intronic
1152260075 17:79262088-79262110 TGAGATTCCCTTTCTCTGCCTGG + Intronic
1153626517 18:7026573-7026595 TGGGAGTCCCAGTGTCTGTCTGG - Intronic
1160303833 18:77712709-77712731 TGGCCTTCACTGTTTCTGACAGG - Intergenic
1161226802 19:3150678-3150700 TGGGGTTCCCTGTTCCTGCGAGG + Intronic
1162704080 19:12542356-12542378 TGGGATTCCATGTGTGTGCCTGG - Intronic
1164795007 19:31019262-31019284 TGGGAGTCCCTGTTTCTGCCTGG + Intergenic
1166756360 19:45194737-45194759 TGGTTTTGCCTGGTTCTGACTGG - Intronic
925808781 2:7677661-7677683 TTGGATTGCCTGTTTCTGATGGG + Intergenic
926167540 2:10530873-10530895 TGGGGTGCCCTGCTACTGACAGG + Intergenic
928815935 2:35294375-35294397 CGGCATTCCCTGTTCCTGAAGGG - Intergenic
933007106 2:77008842-77008864 TAGGATTCACTGTTTCTGACTGG + Intronic
933924181 2:87076739-87076761 TGGGATTCCCCGCTTCTGGGCGG - Intergenic
934571357 2:95375015-95375037 TTGGAGTCCCTGTTTCCCACGGG - Intronic
943539728 2:189197510-189197532 TGCTATTCCCTGTTTCTGGGTGG + Intergenic
945177976 2:207062772-207062794 TGGGATTCTCTGCTTCTGTCAGG - Intergenic
947822389 2:233081177-233081199 TGGGAATGTCTGTCTCTGACAGG + Intronic
948638343 2:239355667-239355689 TGGGATACCCTTTTTTTGACAGG + Intronic
1168906978 20:1413189-1413211 TGGCATTCCCTGTTTCTTTGTGG - Intergenic
1174731777 20:52925158-52925180 TGGGATTCCCTGTTCTTGGATGG + Intergenic
1175198784 20:57264582-57264604 TGGGGGTCCCGGTTTCCGACTGG - Intronic
1176058699 20:63162331-63162353 TGGGATTCCCCTTTTCAGGCCGG - Intergenic
1185222254 22:49634967-49634989 TGGGATTCTGTGTCTCTGAGTGG - Intronic
1185222262 22:49635011-49635033 TGGGATTCTTTGTCTCTGAGTGG - Intronic
953014747 3:39062955-39062977 TGGGATTTTCTGTTTCAGATTGG + Intronic
953914317 3:46908917-46908939 TTGGATTCCCGGCTTCTGGCTGG + Intergenic
956634583 3:71351129-71351151 GGCGATTCCCTGTTTGTGGCAGG - Intronic
957804322 3:85127477-85127499 TGGCTTTGCCCGTTTCTGACAGG + Intronic
961528201 3:127521740-127521762 TGGGATAGCCTGTTGCTCACAGG - Intergenic
963851019 3:150210663-150210685 TGGGAATCCCTGCTTCCTACAGG - Intergenic
967312131 3:188116257-188116279 TGGGTTTCCATGTGTCTGAAGGG + Intergenic
967494521 3:190127943-190127965 TGGCCTGCCCTGCTTCTGACAGG + Intergenic
967970178 3:194993825-194993847 GGGGTTTCCCTATTTCTCACAGG + Intergenic
969431750 4:7159205-7159227 TGTCATCCCCTGTTTCTCACTGG + Intergenic
973292245 4:48482540-48482562 TGAGATTCCCTGCTTGAGACAGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974604213 4:64129119-64129141 TGTTATTCCTTGTATCTGACTGG + Intergenic
978143688 4:105347352-105347374 TGAGATTCTGTATTTCTGACAGG - Intergenic
982294046 4:153808515-153808537 TTTGATTCTCTCTTTCTGACTGG - Intergenic
982438854 4:155410736-155410758 TGGAAATATCTGTTTCTGACTGG + Intergenic
983858996 4:172680992-172681014 AAGGATTCCATGTTACTGACAGG + Intronic
986015335 5:3752545-3752567 TGCCATTTTCTGTTTCTGACTGG - Intergenic
987357309 5:17075490-17075512 TGGAATTTCCTGTTTCTGTTTGG + Intronic
990950213 5:61291243-61291265 TGGGGTTCACTGTATCTTACTGG + Intergenic
994518202 5:100796008-100796030 TAGGTTTCCCTGTTTCTTTCTGG + Intergenic
995015265 5:107302501-107302523 TGGGATTCCCTGAAGCTGATGGG + Intergenic
1000010719 5:157229341-157229363 TTGGATTGACTGTTTCAGACGGG - Intronic
1003452467 6:6248341-6248363 TGGGATTCCCTCTTCCAGAGAGG + Exonic
1004329096 6:14705222-14705244 TTGGGTTGCCTGTTTCTGTCTGG - Intergenic
1005840605 6:29742541-29742563 TGGGATGCCCTGCTCCTGCCTGG + Intergenic
1008462268 6:51789134-51789156 TGAGATTCCCTCTTTCTTATTGG - Intronic
1008626840 6:53325563-53325585 TGTGACTCTCTGTCTCTGACTGG - Intronic
1009840483 6:69066920-69066942 TAGGATCCCTTGTGTCTGACAGG + Intronic
1010257982 6:73782090-73782112 CTGAATTCCCTGTTTCTGTCAGG + Intronic
1011844300 6:91544068-91544090 TGGGTTGCCCTCTTGCTGACAGG + Intergenic
1014989385 6:128054933-128054955 TAGGATTCCATGTTTCTAAAAGG + Intronic
1017438830 6:154443333-154443355 TGGGGGTCCCTGTGTCTTACAGG + Intronic
1020756488 7:12210426-12210448 TAGAATTCCCTGATTCTAACAGG + Intergenic
1023292895 7:38686459-38686481 TTGGATTCCCCGTGTCTGCCAGG + Exonic
1024951307 7:54863330-54863352 TGTGATTCTCTGTATCTGCCTGG + Intergenic
1026513435 7:71046594-71046616 TGTGAGCCCCTGTTTCAGACTGG + Intergenic
1028095068 7:86749876-86749898 TCTGATTCCCAGTTTTTGACTGG - Intronic
1029144761 7:98437955-98437977 AGGAATTCCCTGTTTCTTGCAGG + Intergenic
1031595824 7:123648467-123648489 TGGGATTACCTGTTTCAAATAGG - Intergenic
1032255832 7:130296388-130296410 TGGGACACCGTGTCTCTGACTGG - Intronic
1034587622 7:152109350-152109372 TGGCATTCACCGTTTCAGACAGG + Intronic
1038696583 8:29812150-29812172 TTGGAATTCCTATTTCTGACGGG + Intergenic
1039413846 8:37377184-37377206 TGGGAGTCCCTGATTTAGACCGG - Intergenic
1039880168 8:41620772-41620794 CGGGGTACCCTGTTTCTGGCAGG + Intronic
1043564475 8:81533111-81533133 TGTTTTTCCCTGTTGCTGACAGG + Intergenic
1047066155 8:121285599-121285621 TTGGGTTCCATGTTTCTGAATGG + Intergenic
1048302080 8:133259265-133259287 TTGGATTACCCGTTTCTGTCCGG - Intronic
1051401287 9:16685699-16685721 TGGGATTTCCTCTCTCTGCCTGG - Intronic
1052877369 9:33576934-33576956 TGTGAGTCCATGTTTCTCACCGG - Intergenic
1053498636 9:38567459-38567481 TGTGAGTCCATGTTTCTCACTGG + Intronic
1057317005 9:93975959-93975981 TCGGTTTCCCTGTCTGTGACAGG + Intergenic
1061571914 9:131483124-131483146 TGATCTTCCCTGTTTCTGTCAGG + Intronic
1062711969 9:137979978-137980000 TGGGATTCATTGTTACAGACAGG + Intronic
1062713388 9:137988930-137988952 TGGGAGCCCCTGCTTCTGAATGG + Intronic
1188063514 X:25629555-25629577 TGGGAGACCCTGGTTCTGGCTGG + Intergenic
1196267773 X:113672156-113672178 TGAGATTGGCTGTTTCTCACAGG + Intergenic
1199976714 X:152898574-152898596 TGAGATTCCCTGATTCTTAAAGG - Intergenic
1201428392 Y:13879820-13879842 TGGGATGTACTGTTTCTGATGGG + Intergenic