ID: 905733613

View in Genome Browser
Species Human (GRCh38)
Location 1:40312112-40312134
Sequence CCTGGGGAGCAGAGAGTTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 436}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905733600_905733613 14 Left 905733600 1:40312075-40312097 CCAATCTCACCAGGGAGGCCAAC 0: 1
1: 0
2: 12
3: 133
4: 4281
Right 905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG 0: 1
1: 0
2: 3
3: 49
4: 436
905733605_905733613 -4 Left 905733605 1:40312093-40312115 CCAACAGGTCCAGGAGGCCCCTG 0: 1
1: 0
2: 4
3: 33
4: 313
Right 905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG 0: 1
1: 0
2: 3
3: 49
4: 436
905733596_905733613 23 Left 905733596 1:40312066-40312088 CCTCGGATTCCAATCTCACCAGG 0: 1
1: 0
2: 1
3: 5
4: 83
Right 905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG 0: 1
1: 0
2: 3
3: 49
4: 436
905733602_905733613 5 Left 905733602 1:40312084-40312106 CCAGGGAGGCCAACAGGTCCAGG 0: 1
1: 0
2: 2
3: 35
4: 339
Right 905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG 0: 1
1: 0
2: 3
3: 49
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905733613 Original CRISPR CCTGGGGAGCAGAGAGTTGA TGG Exonic
900348600 1:2224225-2224247 CCTGAGGAGGAGAGAGTGGGTGG + Intergenic
900474208 1:2868695-2868717 CCTGTGGGGCGGAAAGTTGAGGG + Intergenic
900603172 1:3511855-3511877 CTTGGTGAGCAGAGGGTCGAGGG - Intronic
900739622 1:4322780-4322802 CCTGGGGAGCAGGGAGCTTGTGG + Intergenic
900794376 1:4699113-4699135 CCTGGGGCCCAGTGAGGTGAAGG + Intronic
900865570 1:5266470-5266492 CTTGGGGAGCAGGGAGTTGGGGG - Intergenic
901254464 1:7809928-7809950 CCTGGGGAGCAGCGGGTCGCAGG + Exonic
903012043 1:20338116-20338138 CTGGGGGAGGAGAGAGTTTAGGG + Intronic
903118156 1:21195270-21195292 CCTGGGATGCAGACAGCTGAAGG - Intergenic
903860379 1:26361001-26361023 CCTGGGGAGCTGAGGCCTGATGG - Intergenic
903891420 1:26572859-26572881 ACTGAGGCTCAGAGAGTTGAAGG + Intronic
904581404 1:31546836-31546858 TCTGAGGAGAAGAGACTTGAAGG + Intergenic
905665536 1:39761100-39761122 CCTGGGGAGTGGAGAGGTGCGGG - Intronic
905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG + Exonic
906180107 1:43810738-43810760 CCTTGGGAGCAGAGGGGCGAGGG + Intronic
906300778 1:44680097-44680119 CCTGGGGAGTTGAGAGTGCAAGG + Intronic
906510183 1:46406222-46406244 ACTGTGGGGCAGAGAGGTGAGGG - Exonic
906632210 1:47380946-47380968 CCTGTTGTGCAGAGAGCTGATGG + Intergenic
906786981 1:48624651-48624673 CCAGGGCAGCAGGGAGGTGAAGG + Intronic
907317735 1:53583271-53583293 CCTGGGCTGCAGAGTTTTGATGG - Intronic
908457283 1:64316047-64316069 CCAGGGTAGCACAGAGATGAGGG - Intergenic
908679821 1:66648225-66648247 CCTGAGGTGCTGACAGTTGAAGG + Intronic
908720129 1:67116680-67116702 CATGTGGAGCTGAGAGGTGAAGG - Intronic
909170076 1:72283285-72283307 GCTGGGGTGAAGAGAGCTGAGGG + Intergenic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
912532737 1:110338455-110338477 CCCGCGGGGCAGAGAGTTCACGG - Intergenic
912623565 1:111189787-111189809 TCTAGAGAGCAGGGAGTTGAAGG - Intronic
912723733 1:112041393-112041415 CCTGAGGGGCAGTGAGTTGGAGG - Intergenic
912947379 1:114096287-114096309 CTGGGGGAGCTGAGAGATGAGGG + Intronic
913081484 1:115391570-115391592 CCTGAGGACCAGAGAGTAGTGGG - Intergenic
914844856 1:151277213-151277235 CATGATGAGGAGAGAGTTGATGG - Intergenic
915383757 1:155470119-155470141 TTTGGGGAGCAGAGAAGTGAGGG - Intronic
916140293 1:161691498-161691520 CATGGTGAGCTGAGAGTTGAAGG + Intergenic
916168995 1:161986653-161986675 CCCTGGCAGCAGAGATTTGATGG + Intronic
916929369 1:169559356-169559378 CCTGGATAGCAAAGAGTTTAGGG + Intronic
918126092 1:181585276-181585298 CATGGAGAGGAGAGAGTAGAGGG + Intronic
919200979 1:194355191-194355213 CCTGGGGAGCAGATGTGTGATGG + Intergenic
919761647 1:201101959-201101981 CCTTTGGGGCAGAGAGGTGAGGG - Intronic
919860520 1:201736919-201736941 CCTGGGGTGCAGGGAGTGGGGGG - Intronic
919879137 1:201890641-201890663 AATGGGCAGCAGAGAGTTCATGG + Intronic
920455510 1:206098152-206098174 CCTGCTGAGCAGGTAGTTGATGG - Exonic
921194218 1:212738103-212738125 ACAAGGGAGCTGAGAGTTGATGG + Exonic
922358394 1:224798145-224798167 CCTGGTAAGCAGATAGTTGGAGG + Intergenic
922546765 1:226463926-226463948 ACTGGGGAGCAGATGGTAGAAGG + Intergenic
923846135 1:237734743-237734765 CCTGGGGTGAAGAGAGAAGAAGG + Intronic
924055581 1:240121264-240121286 CCTGGGGAGAACAGAATTGCTGG - Intronic
1062836867 10:641378-641400 CCTCGGGAGCAGAGATGTGCGGG - Intronic
1062871020 10:904476-904498 CCTGGGGGGCGGAGGGTTGGGGG + Intronic
1063058510 10:2526762-2526784 CCTGGGCAGGAGACAGATGAGGG + Intergenic
1063267908 10:4474767-4474789 CCTGCTGAGGAGAGACTTGAGGG + Intergenic
1063922654 10:10947705-10947727 CCTTGAAAGCAGAAAGTTGAAGG - Intergenic
1064728590 10:18306265-18306287 CTTGAGGAGAAGTGAGTTGAGGG + Intronic
1065917550 10:30365826-30365848 CCTGGAGAGCAGGGAGGTCATGG - Intronic
1066467997 10:35670349-35670371 GCTGGGGAGTAGAGAGTGGGAGG + Intergenic
1067834661 10:49631057-49631079 CCTGAGGAGCTGAGCGTTGGTGG - Intronic
1068905617 10:62318294-62318316 CATGGGGAGGAGAGAGTTGGAGG - Intergenic
1069285368 10:66708155-66708177 CCTGGGGAGCATAGTGTACAAGG + Intronic
1069625078 10:69862774-69862796 CCTGAGGCCCAGAGAGTTTATGG - Intronic
1070610173 10:77927110-77927132 CCTGGGGAGGGGAGAGAGGAGGG - Intergenic
1070703731 10:78622228-78622250 CCTGGGGAGCACATAGTTAGAGG + Intergenic
1070774694 10:79102794-79102816 CCTGGCTGGCAGGGAGTTGAGGG + Intronic
1071328444 10:84539091-84539113 GCTGGAAAGCAGAGAGATGAGGG + Intergenic
1072019380 10:91383143-91383165 CTAGGGAAGCAGAGAGTAGAAGG - Intergenic
1072530065 10:96310526-96310548 TCTGGGAAGCAGAGAGGTAAAGG - Intronic
1072632375 10:97155263-97155285 CCTGGGAAGCAGAAAGTCAAGGG - Intronic
1073293410 10:102424432-102424454 TCTGGGGAGCAGGCAGTTGGGGG + Intronic
1073512123 10:104049227-104049249 TCTGGGGATCAGAGAGCTGCAGG - Intronic
1074497294 10:113991351-113991373 CCTGGGGCCCAGAGAGATCAAGG - Intergenic
1076070000 10:127481828-127481850 CATGGGGTACAGAGAGTGGAAGG - Intergenic
1076314567 10:129531494-129531516 CCGGGCGAGCAGAGAGGTGGGGG - Intronic
1076931989 10:133537429-133537451 CCTGGTGACCAGAGAGGTGGAGG + Intronic
1077109074 11:854202-854224 CCTGGGGAGCAGCGTCTGGAAGG - Intronic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077308532 11:1878419-1878441 CCTCGGGGGCCGGGAGTTGAAGG + Intronic
1077846859 11:6034427-6034449 CTTGGGAAGCAGAGACTTGGAGG + Intergenic
1078480631 11:11672348-11672370 CATGGGGAGCAGAGAAATGGAGG - Intergenic
1078495290 11:11811310-11811332 CCCGAGGAGCAGAGAATGGAAGG - Intergenic
1078586138 11:12591081-12591103 ACTGGGCAGAGGAGAGTTGAAGG - Intergenic
1078601529 11:12735689-12735711 CATGGGGAGCAGAGTGGTGGTGG - Intronic
1078798401 11:14617183-14617205 TCTGGGAAGGAAAGAGTTGAGGG + Intronic
1079381880 11:19945398-19945420 CCTGGGTAACAGAGAGTGAAGGG - Intronic
1079747279 11:24149441-24149463 TCTGGGGTGCAGTGAGTTGTAGG + Intergenic
1080357958 11:31473379-31473401 ACTGAGGAGCAGAGAGATGAAGG + Intronic
1080562892 11:33480234-33480256 CCTGGGGCTGAGAGAGTTGGAGG - Intergenic
1081760539 11:45573838-45573860 CCTGAGAATCAGAGAGGTGAAGG + Intergenic
1081786365 11:45750562-45750584 CCAGGGGAGCAGAGCGTGGGGGG + Intergenic
1081909935 11:46694295-46694317 CCTGGGGAGCTGGGAGTTGGTGG - Intronic
1082952162 11:58829007-58829029 ACTGAGGCTCAGAGAGTTGAAGG + Intergenic
1084035985 11:66510691-66510713 CCTGCGGAGCTGAGAGGTGAAGG + Exonic
1084210177 11:67617168-67617190 ACTGGGGAGAAGAGAGGAGAGGG - Intergenic
1084553504 11:69862952-69862974 CCAGGGGACCAGGGAGTTGCTGG - Intergenic
1085302546 11:75467010-75467032 CCTAGGGGTCAGAGAGTTGGAGG - Intronic
1085416769 11:76323696-76323718 ATTGGGGAGCAGAGTTTTGAAGG - Intergenic
1085519764 11:77131028-77131050 CTTGGGGAGCAGTGACTGGAGGG + Intronic
1085526090 11:77165170-77165192 CCTGGGGAGGGGCGAGTTGCAGG - Intronic
1085812021 11:79691775-79691797 CCTGAGGTTCAGAGAGTTTAGGG + Intergenic
1088475636 11:110235885-110235907 CTGGGGGACCAGAGAGTTGTCGG - Intronic
1088622921 11:111705071-111705093 CCAGTGGAGCAGAGACTTGATGG + Exonic
1088729961 11:112671698-112671720 CTTGGGGAGCAGGGGGTTAAGGG - Intergenic
1088986613 11:114914746-114914768 CTTGGGAAGCAGAGAGATGAAGG - Intergenic
1089209761 11:116791994-116792016 GCTGGGGAGCACAGAGCTGTTGG + Intronic
1089354307 11:117839918-117839940 CTGGGGGAGCAAAGAGGTGACGG + Intronic
1089364763 11:117914900-117914922 CCTGCGGAGCACAGAGAAGATGG - Intronic
1089389789 11:118092976-118092998 CCTGGAGCTCAGAGAGGTGAAGG + Intronic
1089395609 11:118134948-118134970 CCTGGGGAGGAAAGAGAGGATGG + Exonic
1089588851 11:119527256-119527278 CCTGGGGAGAAGGGAGCTGCAGG + Intergenic
1089868765 11:121654422-121654444 TGTGGGCAGCAGAGAGCTGAGGG + Intergenic
1089984904 11:122803767-122803789 GGTGGGGAGCAGAGAGTATATGG + Intronic
1090240690 11:125179491-125179513 CAGGGGGAGCATAGAGTTGAAGG + Intronic
1090416497 11:126544032-126544054 CCTGGGGAGCAGACAGGAGTGGG - Intronic
1090569713 11:128032829-128032851 CATGGGGCACAGAGAGGTGACGG + Intergenic
1091258909 11:134218210-134218232 CCTGGTGAGCAGATGGTTTAGGG - Intronic
1091963628 12:4720106-4720128 CCAGGGGACCAGAGCGTTGGAGG + Intronic
1093392524 12:18639727-18639749 GCTGAGGAGGAGAGAGTTTAAGG + Intronic
1094061880 12:26322932-26322954 CCTGGAAAACAGAGAGTAGAAGG - Intergenic
1096397256 12:51275624-51275646 CCTGGAGAGAAAAGGGTTGAGGG + Intergenic
1099133274 12:78863513-78863535 CCTGTGGAGCAGATAATGGACGG + Intergenic
1100260993 12:92931971-92931993 CCTGTGCAGCAGAGAGTAGGTGG - Intergenic
1100527330 12:95432083-95432105 GCTGGGGAGCAGGGAGTGGAAGG + Intergenic
1101001013 12:100357183-100357205 GGTGGGGAGCAGAGAGAGGAGGG + Exonic
1101799530 12:108008739-108008761 TCTGGGGAGGAGAGAGGGGAGGG - Intergenic
1103139832 12:118538876-118538898 ACTGGGGATCAAAGAGGTGAAGG - Intergenic
1103244748 12:119447031-119447053 CCTGGGGATCAGGCAGTTAAGGG + Intronic
1103742463 12:123100089-123100111 ACTGAGGTGCAGTGAGTTGAGGG + Intronic
1103750447 12:123155389-123155411 CCTGGGGACCAGCCAGGTGAAGG + Exonic
1105652563 13:22395835-22395857 CCTGGGGTGCACAGCTTTGAGGG + Intergenic
1108030987 13:46229591-46229613 CTTGGCGAGGAGAGAATTGAAGG + Intronic
1108407980 13:50124218-50124240 CCTCGGGAGCGCAGAGTTGCGGG + Intronic
1111420178 13:88000715-88000737 CATAGGGAGCAGAGAGATGAAGG - Intergenic
1111906020 13:94257163-94257185 CCTGGCCTGCAGAGAGTTTAGGG + Intronic
1113601919 13:111575620-111575642 TCTGGGGACCAGAGAGAAGATGG - Intergenic
1114409807 14:22490036-22490058 CCTCAGGAGCAGAGAATGGAGGG + Intergenic
1114465942 14:22922772-22922794 GCTGGGGTGCAGAGAGCTGGTGG + Exonic
1118480584 14:66161114-66161136 CCTAGGGAGCAGGGAGTTGTTGG + Intergenic
1118524533 14:66624059-66624081 TCTGGGGAGCAGAGAGTACTGGG - Intronic
1119395487 14:74323249-74323271 TCTGGGGAGTAGAGGTTTGAAGG + Intronic
1119587284 14:75848198-75848220 CCTGGGGAAAAGAGAAGTGAAGG + Intronic
1120638831 14:86984883-86984905 GCTGAGGACCAGACAGTTGATGG + Intergenic
1121110530 14:91309751-91309773 CCTCGGCAGTAGAGAGTTCATGG + Intronic
1121743029 14:96267260-96267282 CCTGGGGAGGAGAGAGTCCGTGG + Intronic
1121942347 14:98083104-98083126 CCTGAGAACCAGAGAGTTGATGG - Intergenic
1122852943 14:104546630-104546652 CCTGGGGATGAGGGAGTTCAGGG + Intronic
1124377592 15:29138339-29138361 TCTGGGCAGCAGAGATGTGAAGG - Intronic
1124844326 15:33275723-33275745 CCTGGGGAGAGGAGAGGAGAAGG - Intergenic
1125121015 15:36158745-36158767 CCTGGGGAGGAGGGAGATGAGGG + Intergenic
1125769977 15:42158804-42158826 TGTGGAGGGCAGAGAGTTGAGGG + Exonic
1126362427 15:47860161-47860183 CCTGAGGTTCAGAGAGCTGATGG - Intergenic
1126838350 15:52691057-52691079 CAGGGGGAGTGGAGAGTTGAGGG + Intronic
1126903478 15:53338699-53338721 GCTGGGGAGCAGAGAGGTCTGGG - Intergenic
1128162858 15:65435836-65435858 CCTGGGGAGAAGATAGATGCTGG - Intergenic
1128332307 15:66763641-66763663 CCTGGAGAGGACAGAGGTGAGGG - Intronic
1129584511 15:76849127-76849149 GTTGGGGAGCAGGGAGTTGAAGG - Intronic
1129634700 15:77302924-77302946 ACTTGGGAGCAAGGAGTTGATGG - Intronic
1131687224 15:94781178-94781200 CCAGGGCAGCAGAGACTTAAAGG + Intergenic
1132221278 15:100107432-100107454 CCTGTGGAGGACACAGTTGAGGG + Intronic
1132810275 16:1793835-1793857 CCTGGGGTGCAGACAGTGCAGGG + Intronic
1133121607 16:3611923-3611945 CCTGTGGAGCGGAGAGTGGACGG + Intronic
1134656244 16:15949996-15950018 CCTGCGGAGCAGAGCGTGGGGGG + Intronic
1135109258 16:19677973-19677995 ACTGGGGTGCAGAAAGATGAAGG + Intronic
1135424368 16:22324987-22325009 CCTGGGGACCAGAGGGGTGTTGG + Intronic
1135574205 16:23572656-23572678 CTTGGGGAGCGGGGAGATGATGG - Exonic
1135968947 16:27058353-27058375 CCTGGGGGGCCCAGAGTTGTGGG - Intergenic
1136296701 16:29308053-29308075 CCTGGGGAGGACAGAGGTGGTGG + Intergenic
1137568305 16:49548049-49548071 CCTGGGGAGTTGAGAGAGGAGGG + Intronic
1139379581 16:66522051-66522073 CCTGAGGATCAGAGAAGTGAAGG + Intronic
1139845109 16:69915317-69915339 CGAGGGGAGGAGATAGTTGAGGG + Intronic
1139974744 16:70800738-70800760 CCTGGGGAGCAGAGCAGTCAGGG + Intronic
1140739470 16:77928233-77928255 CCTGGTGACCAGAGAGATGTTGG - Intronic
1140889169 16:79270506-79270528 TCAGAGGAGCAGAGAGATGATGG - Intergenic
1141357824 16:83365183-83365205 CCTGAGAACCAGAGAGCTGATGG + Intronic
1141625859 16:85260758-85260780 ACAGGGAAGCAGAGAGTAGATGG - Intergenic
1141784711 16:86191430-86191452 CCTGGGCAGGAGGGAGCTGAAGG - Intergenic
1141826880 16:86486761-86486783 ACTGGGGAGGAGTGAGTTGGGGG + Intergenic
1141919773 16:87127940-87127962 CCTGGCCAGCTGAGCGTTGACGG + Intronic
1142096489 16:88242684-88242706 CCTAGGCAGCAGCGGGTTGAGGG + Intergenic
1142122071 16:88391430-88391452 CCTGGGGAACAGCGAATTCAGGG + Intergenic
1142489064 17:266272-266294 ACTGGGGAGCACAGGGATGATGG - Intronic
1142641279 17:1287237-1287259 GCCAGGGAGGAGAGAGTTGAGGG + Intronic
1142913830 17:3117298-3117320 CCTGAGGAACAGAGACATGAGGG + Intergenic
1142942859 17:3397516-3397538 CCTGAGGAACAGAGACATGAAGG - Exonic
1142946390 17:3432920-3432942 CCTGAGGAACAGAGACATGAAGG - Exonic
1143115803 17:4581398-4581420 CCTGGGGTGCAGAGGGCTGGAGG + Intergenic
1143410099 17:6703488-6703510 CTATGGGAGCAGAGAGTGGAAGG + Intronic
1143526614 17:7476838-7476860 ACTGGGGAGAAGAGTGTTGGAGG + Intronic
1144404933 17:14942963-14942985 CCTGGTGGGCAGGGAGTTGTAGG + Intergenic
1144640728 17:16935194-16935216 GACGGGGAGCAGAGAATTGAGGG + Intronic
1145988876 17:29066084-29066106 GCTGGGGAGGGGAGAGTTGGAGG + Intergenic
1146146368 17:30421183-30421205 CCTATGGAGCAGAGAGCTGGGGG - Intronic
1146255611 17:31390359-31390381 CCTGGAGATCAGGGACTTGAAGG + Intergenic
1146514968 17:33482035-33482057 CCAGAGCAGCAGAGAGCTGAGGG - Intronic
1146936838 17:36817328-36817350 CCTGGGGCCCAGGGAGGTGAGGG + Intergenic
1147592812 17:41695859-41695881 ACTAAGGAGCAGAGAGCTGAGGG - Intergenic
1147882783 17:43664857-43664879 CCTGGGAAGCAGAGAGGTTGCGG + Intergenic
1147894401 17:43741114-43741136 CTTGGGGAGCACAGAGGAGAGGG + Intergenic
1147959144 17:44155491-44155513 CCTGGGGAGCAGAGGTCTGAAGG + Intronic
1147996322 17:44362228-44362250 CCTGAGGTGCAGGGACTTGAGGG + Intronic
1148053357 17:44779868-44779890 CCTGCGGAGCCAGGAGTTGAAGG - Exonic
1148961999 17:51401200-51401222 ACTGAGGAGCAGAGAGGTTAAGG - Intergenic
1148972608 17:51497670-51497692 CCAGGGGAAAAAAGAGTTGAAGG - Intergenic
1149304707 17:55336271-55336293 CCTGGGGAGCAGGGGGTGGCTGG - Intergenic
1150439467 17:65179526-65179548 CCTGGGGAGGAGAGAGAGGGTGG + Intronic
1150465838 17:65391929-65391951 TCTGGAGAGAAGAGAGTGGAGGG + Intergenic
1150550311 17:66203861-66203883 CCTGGGGAGAGGAGAGAGGAGGG + Intergenic
1151304133 17:73252087-73252109 CCTGGGGAGCAGAAAGGAGTGGG + Intronic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151361404 17:73591397-73591419 CCGGGGGAGCAGAGAGCTCAGGG - Intronic
1151460728 17:74252641-74252663 CCTGGTGAGAAGAGAGGAGAAGG - Intronic
1151521461 17:74633385-74633407 TCTGGGGAGCAGGGAGCTGGGGG - Intergenic
1152007017 17:77688644-77688666 TCTAGGGAGCAGAGAGCAGAGGG - Intergenic
1152867386 17:82732357-82732379 CCAGGGGAGCCGAGAGGAGATGG + Intergenic
1152983626 18:302574-302596 CCTGGGGCTCAGAGTGTTAATGG - Intergenic
1153348623 18:4055001-4055023 CTTTGGGAGCAGAAAGTTGATGG + Intronic
1153648076 18:7213094-7213116 CATGGGGAGTTGAGAATTGATGG - Intergenic
1154033346 18:10773516-10773538 CCTGGGGAGGAGAAGCTTGAGGG - Exonic
1155962986 18:32010417-32010439 CCTGGGGAGCAGAATTTTTAAGG + Intergenic
1156162345 18:34374433-34374455 GATGGGGAGCAGAGAGGTGAAGG + Intergenic
1157339375 18:46765751-46765773 CTTGGTGAGCAGAGAGTGTAGGG - Intergenic
1157518371 18:48327469-48327491 GCTGGGGATCAGTGAGTTCACGG - Intronic
1157589161 18:48825742-48825764 GATGGGGAGCAGAGATTTGCTGG + Intronic
1157626494 18:49055304-49055326 CCTGGGAAGCCTAGAGTCGAGGG + Intronic
1158048626 18:53188195-53188217 CCTGGGGACCAGAGCTTTTAAGG + Intronic
1160223736 18:76996694-76996716 GCTGGGGGGCAGGGAGTGGAGGG + Intronic
1161021641 19:2014105-2014127 CCCCGGGAGTAGAGAGTGGAAGG + Intronic
1161149609 19:2701167-2701189 CCTGGGGAACAGTGAGTTGAAGG - Intronic
1161162003 19:2767030-2767052 CCTGGGGCCCAGGGAGCTGAGGG - Intronic
1163196714 19:15726951-15726973 CTTGGGGAGCAGAGTTTTTAAGG + Intergenic
1163267911 19:16232750-16232772 CCTGGGGAGCAGAGACTGTGGGG + Intronic
1163703788 19:18800674-18800696 CTTGGAGAGCTGAGAGGTGAGGG - Intergenic
1163730479 19:18946538-18946560 CTTGGGGAGGAGAGCATTGAAGG - Intergenic
1164557674 19:29266204-29266226 CGGGAGGAGCAGCGAGTTGACGG - Intergenic
1165203576 19:34165179-34165201 CCTGGGAAGCAGGGAGCTGCAGG - Intergenic
1166088708 19:40494069-40494091 CCTGCAGGGCAGAGAGTTGGGGG - Intronic
1166354420 19:42218435-42218457 CCTGGAGGGCAGAGATTGGAAGG - Intronic
1166356368 19:42229881-42229903 ACTGGGGATCAGAGAGGGGAAGG - Intergenic
1166746550 19:45144622-45144644 CCTGGGGAGCTGGGAGTGGACGG + Intronic
1167054696 19:47102484-47102506 ACTGGGGTGCAGAGTGTTTAAGG - Intronic
1167145026 19:47676258-47676280 CCTGGAGAGCAGAGGGCTGGGGG + Intronic
1168470103 19:56632933-56632955 GCTGGGGAGGAGGGAGTAGATGG - Intergenic
925045580 2:770980-771002 CCAAGGGAGCAGAGTGTGGAGGG - Intergenic
925646917 2:6045085-6045107 GCTGGGGAGCAGGGGGTTGAGGG - Intergenic
926889562 2:17627501-17627523 CCTGGGGATCAGAGTTTTTAAGG + Intronic
927505793 2:23613791-23613813 CCTGGTGAGCTGAGAGTGGTGGG - Intronic
927718327 2:25367048-25367070 TCTGGGGAGCACAGATTTGTGGG - Intergenic
930056559 2:47256852-47256874 CCTGGGTCACAGAGAGATGAGGG + Intergenic
930522599 2:52486330-52486352 GGAGGGGAGTAGAGAGTTGAGGG - Intergenic
931695049 2:64865194-64865216 CCCGGGGAGCAGAGAGGCGGAGG - Intergenic
932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG + Intergenic
933672070 2:85017733-85017755 GCTAGGGAATAGAGAGTTGATGG - Intronic
933759483 2:85663990-85664012 ACTGGGGATCAGAGAGTCCAGGG + Intronic
933823456 2:86136676-86136698 CCTGGATAGTAGGGAGTTGACGG - Intronic
933946003 2:87286674-87286696 CCAGGGGAGGAGACAGTAGAGGG + Intergenic
935146977 2:100402267-100402289 CCTGGGGAGCCGAGAGTATTGGG - Intronic
935466670 2:103406371-103406393 GCTGGGGAGCAGAGGCATGAGGG - Intergenic
936042732 2:109161930-109161952 CCTGGGGAGGGGAGGGTTGGGGG + Intronic
936334208 2:111574912-111574934 CCAGGGGAGGAGACAGTAGAGGG - Intergenic
937302059 2:120848587-120848609 CCTGGGGAGGGAAGAGTTGGAGG + Intronic
937977618 2:127591341-127591363 CCTTGGGAGCTGGGAGTTGCAGG + Intronic
938912629 2:135899156-135899178 CCTGGGGAAAGGAGGGTTGAAGG + Intergenic
939274304 2:139980390-139980412 ACTGAGGAGGAGAGAGATGAGGG + Intergenic
939377285 2:141384965-141384987 CCAGGGGACCAGAGCGTTGGAGG - Intronic
939628761 2:144510366-144510388 CCAGCGGACCAGAGAGGTGAGGG - Intronic
939957468 2:148539064-148539086 TCTGGGGAGCACAGGGCTGACGG + Intergenic
940860113 2:158762534-158762556 CCTGGGCAGCGGAGACTTGTAGG + Intergenic
940992144 2:160108520-160108542 CCTGGGGCTCAGAGAGGTCAAGG - Intronic
941062415 2:160862786-160862808 TCTGTGGAGCAGTGAGTTCATGG + Intergenic
944405367 2:199377922-199377944 CCATGAGAGCAGAGAGTGGAAGG + Intronic
945139366 2:206667392-206667414 CCTTGAGAGCAAAGACTTGAAGG - Intronic
945560155 2:211329889-211329911 CCTAAGCAGCAGAGAGTTGTTGG - Intergenic
946057870 2:216917396-216917418 TGTGGGGACTAGAGAGTTGAAGG + Intergenic
947386701 2:229598008-229598030 CATGGGTAGCAGAGAATTTAAGG - Intronic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
948349038 2:237323105-237323127 CTTGCGGAGCAGAGAGCTGTGGG - Intergenic
948537208 2:238655093-238655115 CCTGGGGACCAGTTAATTGAGGG + Intergenic
948583943 2:239006812-239006834 ACAGTGGAGCAGAGAGTGGAAGG - Intergenic
948615355 2:239194989-239195011 CCTGAGGAGCAGGGAGGCGAGGG + Intronic
1169076539 20:2763304-2763326 CCTGGGGACCAGAGAGCTTCTGG + Intergenic
1169136943 20:3203323-3203345 CCTGAGGAGCCGAGAGCTGGAGG - Exonic
1169323709 20:4657445-4657467 AGTGAGGACCAGAGAGTTGAGGG - Intergenic
1170237777 20:14126853-14126875 GCTGGGGATCAGCCAGTTGATGG - Intronic
1170881280 20:20298552-20298574 GCTGGGGAGCAGAGAGTCACAGG + Intronic
1170899951 20:20452911-20452933 GGTGGGGAGCCGTGAGTTGATGG + Intronic
1170973746 20:21141226-21141248 CCTGGAGAACAGGGATTTGACGG + Intronic
1172306213 20:33882561-33882583 GGTGGGGAGCAGAGCGTTGGAGG - Intergenic
1172957591 20:38771947-38771969 CCTGGGGAGAACAAAGTTAAGGG + Exonic
1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG + Intergenic
1173517309 20:43673908-43673930 CATGGGGAAGAGAGGGTTGATGG + Intronic
1174110521 20:48194949-48194971 GCTGGGGAGCAGCGAGTCAAGGG + Intergenic
1174173507 20:48631041-48631063 CCTGGGGAGCAGAGGGCTGGGGG - Intronic
1174426467 20:50435158-50435180 CCTGGGGCACAGAGAGGTTAAGG - Intergenic
1174863487 20:54114208-54114230 CCTGGTGGGCACAGAGTTGGAGG + Intergenic
1175368686 20:58472087-58472109 CCTGGGGCACAGAGAGTTTGGGG - Intronic
1176073353 20:63237881-63237903 CCTGGGGTGCGGAGAGATGCTGG - Exonic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176238607 20:64065622-64065644 CTTGGGGAGCACTGAGTTGCCGG + Intronic
1177723483 21:24937765-24937787 CCTGAGGGACAGAGAGCTGATGG + Intergenic
1179069773 21:38060589-38060611 GCTGGGGAGAGGAGAGTTGGGGG - Intronic
1179099773 21:38346422-38346444 TCAGGGGAGCAGAGAGCAGAAGG + Intergenic
1180098820 21:45574832-45574854 CCCAGGGAGCACAGAGTTCAGGG - Intergenic
1180708545 22:17824332-17824354 GCTGGGGAGCAGGGAACTGATGG + Intronic
1181447481 22:22988797-22988819 CCTGGGCAGCAGAGAGATCTTGG - Intergenic
1181568089 22:23751683-23751705 CCTGGGATGCAGAGAGTTGGGGG - Intergenic
1181632621 22:24159223-24159245 CCTGGGGAGCCCAGAGTCCAGGG + Intronic
1182042821 22:27251480-27251502 CTTGTGGAACAGAGAGATGAGGG - Intergenic
1182265648 22:29112997-29113019 CGTGGTGAACAGAGTGTTGAGGG + Intronic
1182307419 22:29380275-29380297 CCTGGGGCACACAGTGTTGAAGG - Intronic
1182994607 22:34800943-34800965 ACTGAGGAGCAGAGAGCTCAAGG + Intergenic
1184027072 22:41865722-41865744 CCTGGGAAGCACGGAGTTCAGGG + Intronic
1184097634 22:42325218-42325240 CCAGGGGAGCACAGAGGTGGTGG - Intronic
1184333791 22:43841548-43841570 CCTGGGGGGCACAGGGCTGAGGG - Intronic
1184456742 22:44615210-44615232 CTGGGGCAGCAGGGAGTTGATGG - Intergenic
1184534508 22:45077502-45077524 CCTGCGGAGGAAAGAGCTGACGG + Intergenic
1185173710 22:49307459-49307481 TCTGGGGAGCAGGGAGTTGCTGG + Intergenic
1185311772 22:50160067-50160089 GCTGAGGAGCAGAGAGTGGGAGG + Intronic
952210869 3:31227999-31228021 TCTGGGGAGCTGAGGGTAGAAGG + Intergenic
952586444 3:34898579-34898601 CCTGGGGGGCAGGGTGGTGAGGG - Intergenic
953099489 3:39810449-39810471 CCTGGGGAGGGGAGAGCTGTTGG + Intronic
953658298 3:44871497-44871519 CTTGGAGAGCAGAGAGCAGAGGG + Intronic
953794025 3:45969341-45969363 CCTGTGGATGAGAGAGCTGAAGG + Intronic
953821205 3:46208887-46208909 CTTGGGGAGCAGAGAGCAGAGGG - Intronic
954106252 3:48411294-48411316 CCTGGGGATCTGAGTGATGAGGG - Intronic
954155183 3:48681475-48681497 CCTGGGGACCACAGAGGAGAAGG - Exonic
954715019 3:52522664-52522686 GCTGGGCAGCAGAGAGCTGAGGG - Exonic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955400593 3:58588421-58588443 TCTGGGGAGCAGAGAGGTACAGG - Intronic
955449211 3:59049651-59049673 CTTGGGGGGCACAGAGTTCAGGG + Intronic
956721248 3:72119731-72119753 CCCGAGAACCAGAGAGTTGATGG - Intergenic
956739741 3:72266547-72266569 CCTGGGGAGAAGATAGGGGAAGG - Intergenic
960609571 3:119543095-119543117 TCTGGGGAGCAGAGTTTTTAAGG - Intronic
961167820 3:124775861-124775883 TCTGGGCACCAGAGAGTGGACGG - Intronic
961748468 3:129081320-129081342 TCTGTGGAGCGGAGAGTGGATGG + Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961947703 3:130711437-130711459 TCTGTGGAGCAGAGAAATGAAGG + Intronic
962312193 3:134334488-134334510 CCTGGTGAGCAGAAAGGTGGTGG + Intergenic
965683494 3:171276357-171276379 CCTAGGGAGCAGAAAGATGGAGG + Intronic
965848497 3:172992645-172992667 CCTGGGTAGAAGGGAGTTGATGG + Intronic
966500496 3:180634092-180634114 GCTGGGGAGCAAGGAGTTAAGGG - Intronic
966571793 3:181452133-181452155 TCTGGGGAGCAGAGGCCTGATGG + Intergenic
966934842 3:184699398-184699420 CCTGGGGAGCAGAGTTTTTAAGG + Intergenic
967386481 3:188916593-188916615 CCTGGGGAGCAGGCAGTGGGGGG + Intergenic
968025812 3:195442283-195442305 CCCGGGGAGGAGAGAGTAGGGGG - Intronic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
969138312 4:5048909-5048931 GATGGGGAGCAGAGAAGTGAAGG + Intergenic
969281317 4:6172507-6172529 CCTGGGGAGGAGAGAGGACACGG + Intronic
969584736 4:8085190-8085212 CCTGGGGAGGGGAGAGTGGCTGG - Intronic
969865745 4:10076110-10076132 CCTGGGGAGCAGAGAGCTGGTGG - Intronic
970658120 4:18254380-18254402 CCTGGAGAGGATAGATTTGAAGG + Intergenic
970835402 4:20399407-20399429 ACTGAGGATCAGAGAGTTTATGG - Intronic
971022174 4:22548037-22548059 CCTGGGCAGCACAGGGATGATGG - Intergenic
974109570 4:57511035-57511057 GTTGGGGAGCAGGGGGTTGAGGG + Intergenic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
976768219 4:88620860-88620882 CCATGGGAGCAGAGACCTGAAGG - Intronic
978770661 4:112453003-112453025 CCTGGGGAGATGACACTTGAAGG - Intergenic
979994240 4:127411308-127411330 CCTGGGAACCAGGGAGCTGATGG - Intergenic
981520741 4:145659958-145659980 ACTGGGGAGGGGAGAGTGGAAGG - Exonic
981630709 4:146815331-146815353 CCGGGGGAGAGGAGAATTGAAGG + Intronic
982326312 4:154132564-154132586 GCTGTGGAGGAGAGAGTTGGGGG + Intergenic
982753767 4:159194176-159194198 GCTGGGACGCAGAGAGGTGACGG + Intronic
982977968 4:162090960-162090982 CATGAGGAGCAGAAAGGTGATGG - Intronic
984684905 4:182656431-182656453 CCTGGGGCACAGGGAGTGGACGG + Intronic
986007029 5:3677018-3677040 CCTGGGAAGCAGAGTTTTAAAGG - Intergenic
986660735 5:10057638-10057660 CCTGGGAAGATGAGAGTTGGGGG - Intergenic
988861733 5:35288088-35288110 CCTGGGAACCAGGGAGTTGGGGG + Intergenic
990687492 5:58322642-58322664 ACTGGCCAGCAAAGAGTTGAGGG - Intergenic
993633651 5:90318031-90318053 TCTGGGGAGGAGAGAGAAGATGG - Intergenic
993776239 5:92001111-92001133 TCTGGGGAAGAGAGGGTTGATGG - Intergenic
993814326 5:92522510-92522532 CCTGGGGACCAGAGAGTAGAAGG + Intergenic
995572533 5:113495403-113495425 ACTGGGGAGAAGGGAGGTGAAGG + Intergenic
996039535 5:118794605-118794627 CTTAGGGAGCAGAAAGTGGAGGG + Intergenic
997178393 5:131802397-131802419 GATGGGGAGCAGAGAGGAGATGG + Intergenic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
998133414 5:139662310-139662332 CCTGGGGTGCTGAGAGCTGAGGG + Intronic
998340172 5:141410236-141410258 CCTGGGGGTCAGAGAGTACAGGG - Exonic
999284464 5:150386002-150386024 ACTGAGGATCAGAAAGTTGAGGG + Intronic
999718963 5:154384589-154384611 CCTGGGTAGCACAGGGTTAATGG + Intronic
1000249383 5:159479629-159479651 CCAGGAGAGGGGAGAGTTGAAGG - Intergenic
1001536931 5:172504612-172504634 CCTGTGGCTCAGAGGGTTGAGGG - Intergenic
1002349897 5:178576677-178576699 CGTGGGGAGGAGAGAGTTCGAGG - Intronic
1003100027 6:3170001-3170023 GCTGGGGAGCAGAAAGTATATGG - Intergenic
1006081952 6:31572905-31572927 CTAGGGGAGAACAGAGTTGAGGG - Intronic
1006329005 6:33375996-33376018 CCTGGGGAGCAGAGTTTTTAAGG + Intergenic
1006457379 6:34139634-34139656 CGTGGGGAACATAGAGATGAGGG - Intronic
1007050552 6:38824259-38824281 TCTGGGCAGCATGGAGTTGAAGG + Intronic
1007222780 6:40292214-40292236 CTTGGGGAGCAGGGAGGTGATGG + Intergenic
1007425368 6:41743009-41743031 CCTGGGGAGCTCAGAGAAGAAGG - Intronic
1007651217 6:43423806-43423828 CCTGGGAAGCAGAGGTTTCAGGG - Intergenic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007937586 6:45747070-45747092 ACTGGGGTGCAGAGAGTTTGGGG + Intergenic
1008294169 6:49756394-49756416 GTTGGGGAGCAGGGGGTTGATGG + Intergenic
1008496139 6:52136304-52136326 CCTGAGGAACAGAGAGGAGAGGG + Intergenic
1008545026 6:52576766-52576788 CCTGGGGAGGAGGGAGCTGGAGG - Intronic
1011141550 6:84163668-84163690 CCTGGCCAGCAGAGAGTTTTTGG - Intronic
1011558160 6:88589937-88589959 CCTGAGTACCAGAGAGGTGAAGG + Intergenic
1012022848 6:93947112-93947134 TCTGGGGAGAAGAGTGTAGAAGG + Intergenic
1014693292 6:124588290-124588312 TCTTGAGAGCAGAGAGATGATGG - Intronic
1014730448 6:125025622-125025644 AGTGGGGAACAGAAAGTTGAAGG + Intronic
1014730465 6:125025709-125025731 AGTGGGGAACAGAAAGTTGAAGG + Intronic
1014730493 6:125025824-125025846 AGTGGGGAACAGAAAGTTGAAGG + Intronic
1015554980 6:134451786-134451808 GTTGGGGAGCAGAGAGTGGAGGG + Intergenic
1016411516 6:143788170-143788192 AATGGGGAGGGGAGAGTTGATGG - Intronic
1016698964 6:147032408-147032430 CCTTGGGAGCACAGAGTTGGAGG - Intergenic
1018152609 6:160954538-160954560 CCTGGGAAGGTGAAAGTTGAGGG - Intergenic
1018321752 6:162617977-162617999 CCTGAGGTGCAGAGATTTGAAGG + Intronic
1019736559 7:2652787-2652809 CCTGCAGAGCAGAGCCTTGATGG + Intronic
1023800796 7:43832674-43832696 CCTGGGGAGCAGAGTTTTTAAGG - Intergenic
1023968220 7:44974445-44974467 ACTGGGGAGCTGAGAGTTGGTGG + Intronic
1024116958 7:46203715-46203737 TCTGAGGAGCAGAGACTAGAAGG - Intergenic
1024246394 7:47473321-47473343 CCTGGAGATCAGAGAGATTAAGG + Intronic
1026088824 7:67283582-67283604 CCTGAAGAGCTGAGAGTAGAGGG - Intergenic
1027118416 7:75498900-75498922 CCTGAAGAGCTGAGAGTAGAGGG - Intergenic
1028905753 7:96152327-96152349 CCTAGGGAGCAGAGGGGAGAGGG + Intronic
1029152147 7:98488240-98488262 CCTGGGGAGCAGGATGTTGAAGG + Intergenic
1029188374 7:98755251-98755273 CCTGGCGTGCAGAGCATTGAGGG + Intergenic
1029612435 7:101634241-101634263 CCTGGCAATGAGAGAGTTGATGG - Intergenic
1030096810 7:105907828-105907850 CTTGGGCAGCAGTGAGTTTAAGG + Intronic
1032356138 7:131212485-131212507 TCTAAGGAGCAGAGAGTTGCTGG - Intronic
1032631184 7:133653877-133653899 CCAGGGCAGCAGAGAATTCAGGG + Intronic
1034990772 7:155546859-155546881 CCTGGGGAGAAGGGATTTTAGGG - Intergenic
1035150008 7:156861981-156862003 ACTGGGGAACAGAGAGTGGTTGG - Intronic
1036795277 8:11751463-11751485 CCTGGGGAGAAGGGATTGGAAGG + Intronic
1037415367 8:18643984-18644006 TGTGGGGAGCAGAGAACTGAGGG + Intronic
1037804132 8:22049842-22049864 TCTAGGGAGCAGAGAGGAGAAGG - Intronic
1038193221 8:25343072-25343094 CCTGGGAAGCAGAGGTTAGAGGG - Intronic
1038372103 8:27004513-27004535 CCTGGAGAGCAGAAAGTAGCAGG - Intergenic
1038561970 8:28588635-28588657 CCTGGAGGCCAGAGAGGTGAGGG + Intergenic
1039193514 8:35003805-35003827 GCTGGGGAGAAGGGAGATGAGGG - Intergenic
1039200905 8:35092554-35092576 CCTGGAGGGCAGAGAGTGGCAGG + Intergenic
1039663068 8:39488113-39488135 CCTGGGGAGTCAAGAGTAGAAGG + Intergenic
1040098804 8:43477977-43477999 CATGAGGAGCAGTGAGGTGAGGG + Intergenic
1040356776 8:46625976-46625998 ACTGGAGTCCAGAGAGTTGAGGG + Intergenic
1040514509 8:48123895-48123917 CCTTGGGAGCAGAGAGATCACGG - Intergenic
1041211320 8:55554217-55554239 ACTGGGGAGCAGAGAATTCTTGG - Intergenic
1042096978 8:65227080-65227102 CTAGGGGAGCTGAAAGTTGATGG - Intergenic
1042372223 8:68005111-68005133 CCTGGGGAGGACAGGGTTGAAGG - Intronic
1043992841 8:86777392-86777414 CTTGGGCAGTAGATAGTTGAAGG - Intergenic
1044092300 8:88016829-88016851 CCTGGGCAGCAGAATCTTGATGG - Intergenic
1045352234 8:101352502-101352524 CCTGGTGAGCAGGGAGGTGGCGG - Intergenic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1047551833 8:125882030-125882052 CCTGGGAAATAGAGACTTGAAGG + Intergenic
1049067535 8:140329161-140329183 CCTGGGGAACACAGAGGTGAGGG + Intronic
1049245109 8:141558214-141558236 CCAGGGGAGCTGAGAGTGTAAGG + Intergenic
1049796910 8:144501107-144501129 CCTGGGGAGGAGAGAGGAGAGGG - Exonic
1049958314 9:713348-713370 GCTGATGAGCTGAGAGTTGAGGG - Exonic
1049973856 9:843073-843095 CCTTGGGAGCAGAGGGTTTCGGG + Intronic
1051217414 9:14813510-14813532 CCTGGGTGGCAGGAAGTTGAGGG - Intronic
1051254131 9:15194865-15194887 CCTGAGGAGGAGAGAGATGGAGG - Intronic
1052077217 9:24158109-24158131 CTTGGATGGCAGAGAGTTGAAGG - Intergenic
1052946846 9:34175521-34175543 CCTGAGGAGTAGAGAGGAGAGGG - Intergenic
1053730351 9:41049131-41049153 CCTGGGGTGTAGGGAGTGGAGGG - Intergenic
1054698151 9:68382930-68382952 CCTGGGGTGTAGGGAGTGGAGGG + Intronic
1056444732 9:86654920-86654942 ACTGGGGAGGAGAGATTGGAGGG - Intergenic
1056814554 9:89791988-89792010 CCAGGGTAGCAAAGAGTAGAGGG - Intergenic
1058091473 9:100810914-100810936 TCTGTGGAGCAGAGGGCTGATGG - Intergenic
1058453461 9:105117696-105117718 ACTGGTGAGCAGACAGGTGAGGG + Intergenic
1058531143 9:105905596-105905618 CCGGGGGAGGAGAGAGCGGAGGG - Intergenic
1058995143 9:110292244-110292266 CCTGGGGAGCAGGCAGTGGATGG - Intergenic
1059615632 9:115948002-115948024 CCTAGGGAGCATAGAATTGTGGG + Intergenic
1060062766 9:120475833-120475855 CCTGGGGAGCAGAGACAGTAAGG + Intronic
1060300305 9:122371164-122371186 CCTGCAGAGGAGAGAGATGAGGG - Exonic
1060877666 9:127094899-127094921 CCTGGGGAGGGCAGAGTTGATGG - Intronic
1061665839 9:132160904-132160926 CCTGGGGATCAGAGAGCCCAGGG + Intergenic
1061927738 9:133814302-133814324 CCTGGCGGGCAGAGAGGTGGGGG - Intronic
1061951189 9:133936781-133936803 CATGGGGAGCTGGGAGTAGACGG - Intronic
1062102809 9:134737374-134737396 CGTGGGGAGCAGACACTTGAGGG + Intronic
1203787176 EBV:134493-134515 CCCGGGGAAAAGAGAGCTGATGG - Intergenic
1203653561 Un_KI270752v1:1921-1943 CTTGGGGAGCAAACATTTGAGGG - Intergenic
1185631528 X:1519022-1519044 ACTGGGGACCAGAGAGATTAGGG - Intronic
1186115554 X:6301746-6301768 ACTGGGGAGCAGAGTTTTTAAGG + Intergenic
1189235230 X:39481992-39482014 CCTGGGGCACAGCGACTTGATGG + Intergenic
1189344781 X:40232697-40232719 ACTGGAGAGCAGAAAGTTGCAGG - Intergenic
1189359834 X:40341401-40341423 CCTGCAGAGCTGAGAGTTGCAGG + Intergenic
1189784824 X:44550008-44550030 CCTGGGAAGCAGAGTTTTTAAGG - Intergenic
1191147138 X:57178716-57178738 CATGGGAAGCAGAGAGTAGCAGG + Intergenic
1192338723 X:70243851-70243873 ACTGGGGAGCAGAGTTTTTAAGG - Intergenic
1192733323 X:73823473-73823495 CCTGAGGATAAGAGAGATGAGGG - Intergenic
1192956460 X:76075932-76075954 GTTGGGGAGCAGAAAGTTGAGGG - Intergenic
1196016233 X:110943673-110943695 CTTGGGGATCAGAGGGTTGAAGG - Intergenic
1196755774 X:119156027-119156049 CCTGAGGACCAGAGAGCTGGAGG - Intergenic
1196784164 X:119407692-119407714 CCTAGGGAGCATGGAGGTGAAGG - Intronic
1198757403 X:139995837-139995859 CCTGAGGAGGAGATAGCTGAGGG + Intergenic
1199195834 X:145029259-145029281 CCAGAGGCTCAGAGAGTTGAAGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1199978704 X:152909155-152909177 CCCGGAGAGCGGAGAGCTGAGGG + Intergenic
1200909429 Y:8517097-8517119 CTTGCACAGCAGAGAGTTGAAGG - Intergenic
1200961528 Y:9000667-9000689 CCAGGGGAACAGAGAATTGGAGG - Intergenic
1200982962 Y:9278891-9278913 CCAGGGGACCAGAGAATTGGAGG + Intergenic
1201299189 Y:12491179-12491201 CCTGGAGAGGAGAGAGGTCAGGG - Intergenic
1202127416 Y:21580818-21580840 CCAGGGGACCAGAGAATTGGAGG - Intergenic
1202151253 Y:21845568-21845590 CCAGGGGACCAGAGAATTGGAGG + Intergenic