ID: 905738891

View in Genome Browser
Species Human (GRCh38)
Location 1:40352186-40352208
Sequence CTGGGTCCACAGATGGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905738891_905738902 21 Left 905738891 1:40352186-40352208 CCAAAGTCCATCTGTGGACCCAG 0: 1
1: 0
2: 2
3: 25
4: 231
Right 905738902 1:40352230-40352252 TAATGATATTAGGAACAGGGTGG 0: 1
1: 0
2: 0
3: 17
4: 174
905738891_905738901 18 Left 905738891 1:40352186-40352208 CCAAAGTCCATCTGTGGACCCAG 0: 1
1: 0
2: 2
3: 25
4: 231
Right 905738901 1:40352227-40352249 CTTTAATGATATTAGGAACAGGG 0: 1
1: 0
2: 1
3: 18
4: 224
905738891_905738898 11 Left 905738891 1:40352186-40352208 CCAAAGTCCATCTGTGGACCCAG 0: 1
1: 0
2: 2
3: 25
4: 231
Right 905738898 1:40352220-40352242 CTCCAAGCTTTAATGATATTAGG 0: 1
1: 0
2: 2
3: 8
4: 124
905738891_905738900 17 Left 905738891 1:40352186-40352208 CCAAAGTCCATCTGTGGACCCAG 0: 1
1: 0
2: 2
3: 25
4: 231
Right 905738900 1:40352226-40352248 GCTTTAATGATATTAGGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905738891 Original CRISPR CTGGGTCCACAGATGGACTT TGG (reversed) Intronic
902810482 1:18885352-18885374 CTGGGTCCCCAAAAGGGCTTAGG + Exonic
903669541 1:25027338-25027360 CAGGTTCCACAGATACACTTGGG + Intergenic
903703469 1:25267849-25267871 CTGGGTTCACAGCTGGACGTCGG - Intronic
903712736 1:25338178-25338200 CTGGGTTCACAGCTGGACGTCGG - Exonic
904398786 1:30241952-30241974 CTGGGACCAGGGAAGGACTTGGG + Intergenic
905633393 1:39531640-39531662 GTGGGCCCACAGCTGCACTTGGG + Intergenic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
906274511 1:44506223-44506245 CTGGGTATGCAGAAGGACTTGGG + Intronic
906333367 1:44906899-44906921 CTGGATCCCCAAATGAACTTCGG + Intronic
906641935 1:47446125-47446147 CTGGGACCAAAGCTGGCCTTAGG - Intergenic
907147751 1:52251699-52251721 CTGGCTTCACAGAAGGAGTTAGG + Intronic
907248207 1:53121341-53121363 CTTGGTCCCCGGATGGGCTTAGG + Intronic
907761711 1:57367943-57367965 CTGGGTCCACAGCTGTGGTTTGG - Intronic
913462965 1:119108189-119108211 CTGGGTTCACAGAATGAGTTTGG + Intronic
915751212 1:158212764-158212786 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
917199461 1:172499729-172499751 CAGGATCAACAGAGGGACTTAGG - Intergenic
917257276 1:173129166-173129188 CTGGGTCCACAGTTCCAATTGGG - Intergenic
917746637 1:178015225-178015247 CTGGTTTCACAGAATGACTTAGG + Intergenic
918060131 1:181053791-181053813 CTGGGATCACAGAAGGACCTGGG + Intronic
918730869 1:187994501-187994523 CAGGGGCCTCAGAAGGACTTTGG + Intergenic
919410176 1:197232956-197232978 CTGGTTCCAAAGATATACTTCGG + Intergenic
919552187 1:199005170-199005192 CTGGGCCAAGAAATGGACTTTGG + Intergenic
920291402 1:204925824-204925846 GTGGGTCCTCAGATGGACAATGG + Intronic
923795262 1:237148109-237148131 ATGGGCCTGCAGATGGACTTCGG + Intronic
1063999243 10:11649622-11649644 CTCAGTCCAGAGATGGAGTTGGG - Intergenic
1067465495 10:46495221-46495243 ATGGGTCTCAAGATGGACTTGGG + Intergenic
1067621692 10:47889380-47889402 ATGGGTCTCAAGATGGACTTGGG - Intergenic
1067662831 10:48249396-48249418 CTTGGGCCACAGATGAATTTAGG - Intronic
1068875230 10:61988696-61988718 CTGGGTCCGAAGAGGCACTTGGG - Intronic
1069778072 10:70938304-70938326 CTGGATCCTCAGATCGATTTGGG - Intergenic
1070260241 10:74847814-74847836 CGGGATCCACAAATGAACTTGGG + Intronic
1075787803 10:125061732-125061754 CTGGGTTCTCAGATGCACCTCGG + Intronic
1076429679 10:130393028-130393050 CTGGCTACACAGATGTACTTGGG - Intergenic
1076501913 10:130943855-130943877 CTGGGTACTCAGATGGTCCTGGG + Intergenic
1077929599 11:6717239-6717261 CTGTGGACACAGAAGGACTTCGG - Intergenic
1078384545 11:10877208-10877230 CTGGCTTCACAGAATGACTTAGG + Intergenic
1078455387 11:11470830-11470852 CTGGGGCCACAGATGGTCAGAGG - Intronic
1078715579 11:13836150-13836172 CGGGGTACAGAGATGGACCTGGG + Intergenic
1080216939 11:29854448-29854470 CTGGCTCCACAGAATGAGTTAGG - Intergenic
1080499580 11:32856963-32856985 CTGGGACCACAGGTGCACCTCGG + Exonic
1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG + Intronic
1082644227 11:55701943-55701965 CTGGGTCCACAGGTTGGTTTTGG - Intergenic
1083353963 11:62051545-62051567 CTGGGTCCATAGATGGGGGTAGG + Intergenic
1084660666 11:70544631-70544653 CTGGACCAGCAGATGGACTTGGG + Intronic
1084790016 11:71469043-71469065 CTGAATCCACAGATCAACTTAGG - Intronic
1084815240 11:71641921-71641943 CTTGGTCCACAGAGGGAAATGGG + Intergenic
1085308078 11:75499729-75499751 CTGGGCCCAGAGATGGGGTTGGG + Intronic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1086744482 11:90408001-90408023 CTGATTCCACAGCTGGACCTGGG + Intergenic
1089688795 11:120173302-120173324 CTGGTTCTCCAGATGGCCTTGGG - Intronic
1091611839 12:2017014-2017036 CTGGGACCACGTTTGGACTTTGG + Intronic
1096310720 12:50518197-50518219 TTGGGTTCACATATGGTCTTGGG + Intronic
1097735596 12:63177830-63177852 CTTGGTTCACACATGGTCTTTGG - Intergenic
1099046065 12:77721082-77721104 CTGGGTCCAGATATGGACTGTGG - Intergenic
1100735855 12:97530073-97530095 CTGATTCCACAGGTTGACTTGGG + Intergenic
1102606234 12:114069641-114069663 CTGAGTCCACTGATGTAGTTGGG - Intergenic
1104710567 12:130982839-130982861 CTGGGGACACAGAAGGACTCAGG + Intronic
1105759020 13:23496080-23496102 CTGGGCACACAGCTGGTCTTGGG - Intergenic
1105967861 13:25400846-25400868 GTGGGACCACAGAAGGCCTTGGG + Intronic
1106572180 13:30936703-30936725 CTGGGTCCACGGGAGGGCTTGGG + Intronic
1107502252 13:40992289-40992311 GTGTGTTCACAGATGCACTTAGG - Intronic
1107967856 13:45613705-45613727 CTGGTTCCACATTTGGAGTTTGG + Intronic
1108118699 13:47160182-47160204 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1109238660 13:59855661-59855683 CTGGTTCTACAGATAGACTGTGG - Intronic
1109426127 13:62168009-62168031 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
1110817202 13:79875280-79875302 CTGAGGGCACAGATAGACTTGGG - Intergenic
1111064346 13:83071689-83071711 CTGAGTCCACAGATTGCTTTGGG + Intergenic
1111132554 13:83996298-83996320 CTGGGTTCACAGATGGTTTGAGG - Intergenic
1113522825 13:110952876-110952898 CTGTGTGTACAGATGGCCTTAGG - Intergenic
1113702549 13:112397961-112397983 CTGTGTGTACAGATGGCCTTAGG + Intronic
1114349667 14:21836083-21836105 CTCGGTCCACAGCTGCAGTTTGG + Intergenic
1115963305 14:38860325-38860347 CTGGCTCCACAGAATGAGTTAGG + Intergenic
1117478828 14:56122668-56122690 TAGGGTCCACAGATGGAGTTCGG + Intronic
1118477186 14:66128508-66128530 CTGGGTCCACAGATGGGTGGGGG - Intergenic
1120786458 14:88541946-88541968 CTAGGCCCATGGATGGACTTGGG + Intronic
1120964859 14:90158270-90158292 CAGGGACCACAGATAGACTGTGG + Intronic
1121211434 14:92210572-92210594 CTGGGGCCAGCGAAGGACTTTGG + Intergenic
1122282951 14:100635016-100635038 TTGGGTCAACAGATGGCCCTGGG + Intergenic
1122799197 14:104221391-104221413 CAGGGTACACAGATGGCCTGCGG - Intergenic
1125718006 15:41830630-41830652 CTGGGTCCACAGCTGCAGCTTGG - Intronic
1127467311 15:59256851-59256873 CTGGGGCCTCAGAGGGAATTAGG + Intronic
1128847769 15:70916868-70916890 CTGGGTCCACAGCTGCAGTTTGG - Intronic
1129227565 15:74178971-74178993 CTGGGTCCACTGAGGGGCTGGGG - Intergenic
1132720538 16:1313601-1313623 CTGGGGCCCCAGATGGATGTGGG - Intronic
1134078513 16:11308886-11308908 CTGGGTCCACAGCTGCAATTTGG + Intronic
1138033642 16:53580558-53580580 CCTGGTCCACAGCTGGACTTAGG + Intergenic
1138475867 16:57270366-57270388 CAGGGGCCATGGATGGACTTGGG - Intronic
1138878241 16:60979232-60979254 CTGGGTCCCCAGCTGCAGTTTGG - Intergenic
1139183024 16:64770275-64770297 CTGGGTCCACAGGTGCAGTTTGG - Intergenic
1139268546 16:65661452-65661474 CTAGGTCCAGAGCTGGAGTTTGG + Intergenic
1142140849 16:88472098-88472120 CTGGGTCCACAGATGGGGTGGGG - Intronic
1142319522 16:89372056-89372078 GTGGGTCCCCAGGTGGACTGAGG + Intronic
1142404363 16:89879115-89879137 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404378 16:89879199-89879221 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404385 16:89879241-89879263 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404402 16:89879367-89879389 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404407 16:89879409-89879431 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404414 16:89879451-89879473 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404421 16:89879493-89879515 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404428 16:89879535-89879557 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404435 16:89879577-89879599 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404442 16:89879619-89879641 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404449 16:89879661-89879683 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404456 16:89879703-89879725 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404463 16:89879745-89879767 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404470 16:89879787-89879809 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404477 16:89879829-89879851 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404484 16:89879871-89879893 CCGTGTGCACAGATGGGCTTCGG + Intronic
1144650021 17:17001591-17001613 CTGGGACCACATAAGGTCTTGGG + Intergenic
1146235674 17:31159157-31159179 CTTGGTCCACATCTGTACTTTGG - Intronic
1146257635 17:31400792-31400814 CTGGCTCCACAGCTGCACTCAGG - Intronic
1148680537 17:49470985-49471007 CTGGGTCCAGGGATGGGCTGAGG + Intronic
1148741381 17:49895009-49895031 CTGAGTCCACAGCAGGCCTTGGG - Intergenic
1151018658 17:70586772-70586794 CTTGGTCCACAGAGTGACTGTGG - Intergenic
1151537227 17:74745773-74745795 CAGGGGACACAGATGCACTTTGG + Exonic
1151772032 17:76170008-76170030 CTGAGTGCACAGCAGGACTTGGG + Intronic
1152189597 17:78880303-78880325 CTGTGTCCACAGAAGTACTATGG + Intronic
1153444112 18:5153026-5153048 CTTGAAACACAGATGGACTTTGG + Intronic
1154070891 18:11149988-11150010 CTGGGTCCACAGGTGCACACTGG + Intergenic
1156298963 18:35818393-35818415 CCGGGTCCACAGCTGGGGTTTGG + Intergenic
1157626381 18:49054689-49054711 CTGGCGACACAGAGGGACTTGGG + Intronic
1161017762 19:1991666-1991688 CTGGGTCCTCCAATGGGCTTTGG - Intronic
1161073391 19:2273537-2273559 CTGGGACCACAGAGGGCCCTGGG + Intronic
1164907140 19:31976727-31976749 CTGGGTTCTCACATGGATTTGGG - Intergenic
1165906227 19:39196506-39196528 CTGGGTCCTCAGCTGGCCCTGGG + Intergenic
1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG + Intergenic
1166862950 19:45820153-45820175 CTGGGTCCACAAATGGCCTTGGG + Intronic
1167323104 19:48808175-48808197 GTGGGTCCCCAGATTGCCTTTGG + Intronic
927098251 2:19764444-19764466 CTGGAGCCCCAGATGGACATGGG + Intergenic
927173359 2:20388616-20388638 CTGGGCTCAGAGCTGGACTTGGG + Intergenic
927712236 2:25333014-25333036 CTGGGTCCCCACATGGACAGGGG + Intronic
928723746 2:34148122-34148144 CTGGGTCCACGGCTGGGCTTGGG + Intergenic
929568957 2:43007733-43007755 CATGGTCCCCAGATGGACTTAGG + Intergenic
929947058 2:46379750-46379772 GAGAGTCCACAGATGGACCTGGG + Intronic
930208162 2:48609007-48609029 CTGGGATCAGAGATGGCCTTGGG + Intronic
930689046 2:54340172-54340194 CTGGGTCCAAAGTTTGAGTTAGG + Intronic
930887006 2:56337563-56337585 GTGGAGCCACAGATGGACCTGGG - Intronic
931197770 2:60069104-60069126 GTGTCTCCACAGATAGACTTGGG + Intergenic
931956742 2:67435484-67435506 CTGGTTTCACAAATGGGCTTAGG + Intergenic
933126546 2:78615305-78615327 CTGTGTCCAGAGATGCTCTTTGG + Intergenic
934699767 2:96430203-96430225 CTAGGTCCACAGGTGTAGTTTGG - Intergenic
936633221 2:114227090-114227112 CTGGGTCCCCACCTGGACTCAGG - Intergenic
937243897 2:120479973-120479995 CTGGGACCACAGAGGGACTTGGG - Intergenic
942915074 2:181295046-181295068 CTGGGTCCAGAGGTGCTCTTTGG - Intergenic
944483717 2:200182061-200182083 CTGGGTCTACAGCTGCAGTTTGG - Intergenic
946942196 2:224781027-224781049 CTTGGTAAACAGATGGCCTTTGG + Intronic
949039560 2:241841524-241841546 CAGGGTCCACAGCTCGAATTGGG - Intergenic
1170300427 20:14877978-14878000 CTGGCTCCATAGAAGGAGTTAGG + Intronic
1170470733 20:16665412-16665434 CTGGGTCAACTGTTGGAATTCGG - Intergenic
1170550861 20:17474845-17474867 CTGAGCCCACAGATGGAATGAGG + Intronic
1175199552 20:57267866-57267888 GTGGGTCCCCAGAGGGCCTTTGG + Intergenic
1175857926 20:62132766-62132788 CTGGGTGCACAGTTGGATGTGGG + Intronic
1179547726 21:42123974-42123996 CTGTGTGCACAGATGGGCTCTGG + Intronic
1180864028 22:19105596-19105618 CCGGGGCCCCAGAGGGACTTCGG + Intronic
1181786361 22:25230090-25230112 GGGGGTCCACAGATGAGCTTTGG + Intronic
1181818532 22:25457913-25457935 GGGGGTCCACAGATGAGCTTTGG + Intergenic
1183025061 22:35058676-35058698 CTGGGTCCACAGCCGCAGTTTGG + Intergenic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
950240717 3:11367599-11367621 CTGGGTCCACAGGCAGAATTTGG + Intronic
950251409 3:11468703-11468725 GTGGGACCACAGGTGGGCTTGGG + Intronic
952211391 3:31232166-31232188 CTGGGTCTGCAGAAGAACTTCGG - Intergenic
952889713 3:38031727-38031749 CTGGGCCCACAGACGGCCCTGGG - Intergenic
954428656 3:50457537-50457559 CTGGGGCCAGGGATGGACTGCGG - Intronic
955760043 3:62270302-62270324 CTGGGATCACAGATGGGCTTTGG - Intronic
957072467 3:75577815-75577837 CTTGGTCCACAGAGGGAAATGGG - Intergenic
957414963 3:79890010-79890032 CTGGGGCCACATATGAACCTAGG + Intergenic
959581086 3:107983341-107983363 CTGGGACCAAAGATGGAATTAGG - Intergenic
959911365 3:111767249-111767271 CTTGGTACACAGAAGGATTTGGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962105343 3:132383366-132383388 CTGGGTCCACAGCTGTGGTTTGG + Intergenic
962252363 3:133843646-133843668 CTGGGTGTGCAGATGGACTCAGG + Intronic
962378803 3:134880337-134880359 CTGGGTCAACAAAGGGGCTTTGG + Intronic
962861901 3:139411212-139411234 CTGGCTTCACAGAATGACTTAGG + Intergenic
963906313 3:150776202-150776224 CAGGGTCCACAGATTGCATTTGG + Intergenic
964179472 3:153865857-153865879 CTGGGTCCAGAGATGCTGTTGGG - Intergenic
965559284 3:170046182-170046204 CTGGGTTCCCACATGGCCTTAGG + Intronic
967958412 3:194897680-194897702 CTGGCTTCATAGAAGGACTTAGG + Intergenic
968734469 4:2288267-2288289 CTGGGGCCACAGGGGGGCTTAGG - Intronic
969257684 4:6013710-6013732 CTGGGTCCAAAGATGGAGGCGGG + Intergenic
969737891 4:9003219-9003241 CTTGGTCCACAGAGGGAAATGGG + Intergenic
973329654 4:48900088-48900110 CTGGGAACACTGATGGACTTAGG + Intronic
980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG + Intergenic
980874360 4:138645996-138646018 CTGGCCCCACAGACAGACTTTGG + Intergenic
982957600 4:161792019-161792041 CTGGGTCCACAGCTGCAGCTGGG - Intronic
983277780 4:165639208-165639230 CTGGGTTCATAGAATGACTTAGG - Intergenic
983491788 4:168398080-168398102 CTGGGTCCACAGTTGCAGCTTGG - Intronic
984273306 4:177574775-177574797 CTGGGTCCCCAGATAAACGTGGG - Intergenic
984279334 4:177650141-177650163 CAGGGTTCACAGATGGACATAGG - Intergenic
984817060 4:183848872-183848894 CTGGGCCCCAACATGGACTTCGG - Intergenic
986211165 5:5674014-5674036 GTGGGACCACAGGTGGACTCTGG - Intergenic
986378227 5:7155493-7155515 CTGGCTCCACAGAGTGAATTAGG + Intergenic
987079713 5:14415760-14415782 CTGGGCCTAAAGAGGGACTTGGG + Intronic
991155358 5:63428058-63428080 CTGGCTTCACAGAATGACTTGGG + Intergenic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
995686753 5:114780339-114780361 CTGGGTCCTGGGTTGGACTTGGG - Intergenic
997204834 5:132041371-132041393 CTGGGTGCATATATGTACTTAGG + Intergenic
997418179 5:133745228-133745250 CTGGGTCCATAGAAGGCCCTTGG - Intergenic
997444616 5:133932285-133932307 CTGGGCTCATGGATGGACTTGGG - Intergenic
998896370 5:146804405-146804427 CTTTGTACACAGATGGCCTTGGG - Intronic
999382431 5:151131003-151131025 ATGAGTCAACAGATGAACTTAGG - Intronic
1002163627 5:177331816-177331838 CTGTGTCTACAGATGGGCTGTGG - Exonic
1002544787 5:179933106-179933128 CAAGATCCACAGAAGGACTTGGG + Intronic
1003274955 6:4642239-4642261 CTGGTTCCACTGATGGATGTGGG - Intergenic
1003810002 6:9768557-9768579 CAGAGTCCAGAGATGGAATTAGG - Intronic
1004870183 6:19896496-19896518 CTGGGTGGACAGCTGGACTGGGG - Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006745943 6:36342086-36342108 CTGGGTCCTAAGGTGGACATTGG + Intergenic
1006893870 6:37453457-37453479 CTGGGACCACAGAAGCACTGTGG - Intronic
1007649840 6:43412649-43412671 CTGGGTCCACAGCTGGGGTTGGG - Intergenic
1008791752 6:55243402-55243424 CTGTGTCCTCTGATGAACTTTGG - Intronic
1010862780 6:80934284-80934306 CTGGTTTCACAGATTGATTTAGG + Intergenic
1013366446 6:109441283-109441305 CTGGGGCCAGATGTGGACTTTGG - Intronic
1017054393 6:150424490-150424512 CTGGGTCTGCAGATTGATTTGGG - Intergenic
1018162101 6:161054896-161054918 CTGGGTCCACAAATGGATATGGG - Intronic
1021336913 7:19414621-19414643 TTGGATCCACAGATTGAATTAGG + Intergenic
1022505817 7:30908174-30908196 CTGGGTCCTCCCATGGACTCGGG - Intergenic
1023514715 7:40990078-40990100 TTGGTTCCACTGATGGATTTGGG - Intergenic
1023891484 7:44394981-44395003 CTGTGTCCACAAGTGTACTTTGG + Intronic
1024726185 7:52198584-52198606 CTGGTTCCATAGATTGAGTTAGG + Intergenic
1025098747 7:56117531-56117553 CTGGGGCCACAGGTGGACACAGG - Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1026718085 7:72807430-72807452 CAGGGGCCCCAGAAGGACTTTGG - Intronic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1029899200 7:104022035-104022057 CTGGGTCCACAGTTGTGGTTTGG - Intergenic
1029973875 7:104814957-104814979 CTGGGTCCATAGCTGCAGTTTGG + Intronic
1032499972 7:132392914-132392936 CTGGGTGCTCAGATGGACACAGG - Intronic
1032565829 7:132941807-132941829 CAGATTCCACAGGTGGACTTGGG - Intronic
1040456343 8:47601813-47601835 CTGTGTACAAAGATGAACTTTGG + Intronic
1049412298 8:142478680-142478702 CAGGGTGCACAGTGGGACTTGGG + Intronic
1049412315 8:142478740-142478762 CGGGGTGCACAGTGGGACTTGGG + Intronic
1049412380 8:142478996-142479018 CGGGGTGCACAGTGGGACTTGGG + Intronic
1050828751 9:9984550-9984572 ATGGGTACACAGAGTGACTTTGG + Intronic
1050891247 9:10827295-10827317 CTGGCTTCACAGAAGGATTTGGG + Intergenic
1052955842 9:34252730-34252752 CTTGGTCCACAGACGGAGCTGGG - Exonic
1053122768 9:35558884-35558906 GTGGGTCCCAAGGTGGACTTAGG - Intronic
1053619240 9:39798993-39799015 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053877396 9:42558342-42558364 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1054234299 9:62543380-62543402 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054264917 9:62908436-62908458 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1056424621 9:86464580-86464602 CTGGGTCCAGAGATGCTCTCTGG + Intergenic
1057510928 9:95678897-95678919 CTGGGTCCACAGCCTGACTTGGG + Intergenic
1059585004 9:115596452-115596474 CTGGGTTCAGAGATGGAACTTGG + Intergenic
1062044421 9:134418466-134418488 CTGGGCCCACAGAGGGACAGAGG - Intronic
1187005038 X:15224469-15224491 CAGTGTCCACAGAGGGACTGTGG + Intergenic
1187499996 X:19831826-19831848 ATGTGTCCCCAGATGGAATTGGG - Intronic
1190465081 X:50718107-50718129 CTGGGTCCAGAGCTTGGCTTTGG + Intronic
1191712840 X:64170438-64170460 CTGGTTCCAAGGAAGGACTTTGG + Intergenic
1192120691 X:68452640-68452662 CTAGGACCACAGATGCACTTAGG - Intergenic
1194423699 X:93709482-93709504 TTGGGCCCACAGATTGAGTTGGG - Exonic
1195514086 X:105752537-105752559 CTGGTTCCTCAGATGAGCTTAGG + Intronic
1195860876 X:109381459-109381481 CTGGGTCAACCGGTGGTCTTTGG + Intronic
1196224877 X:113154730-113154752 CTGGCTTCACAGAATGACTTAGG + Intergenic
1198815895 X:140589840-140589862 GTGGTTCCAAACATGGACTTTGG + Intergenic
1199473995 X:148226137-148226159 CTGGTTCCTCAGATGGAGTTAGG + Intergenic
1199507430 X:148580114-148580136 CTAGTTCCACAGATGCACCTTGG - Intronic
1199866972 X:151860664-151860686 CTGTGTCCACAGAAGGGCTCAGG + Intergenic
1202112957 Y:21443706-21443728 CTAGGTCCACATTTGGACTATGG - Intergenic
1202113021 Y:21444361-21444383 CTGGGTCCACAGTGGCACTGTGG - Intergenic