ID: 905739816

View in Genome Browser
Species Human (GRCh38)
Location 1:40360692-40360714
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 4, 1: 34, 2: 84, 3: 158, 4: 457}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905739806_905739816 30 Left 905739806 1:40360639-40360661 CCCATTCCATAGCAACAGCTGTG 0: 1
1: 0
2: 2
3: 18
4: 155
Right 905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG 0: 4
1: 34
2: 84
3: 158
4: 457
905739811_905739816 3 Left 905739811 1:40360666-40360688 CCAGAGAGAATCAGTGTGCTTGG 0: 1
1: 0
2: 0
3: 16
4: 131
Right 905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG 0: 4
1: 34
2: 84
3: 158
4: 457
905739809_905739816 24 Left 905739809 1:40360645-40360667 CCATAGCAACAGCTGTGTGGCCC 0: 1
1: 1
2: 0
3: 15
4: 177
Right 905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG 0: 4
1: 34
2: 84
3: 158
4: 457
905739810_905739816 4 Left 905739810 1:40360665-40360687 CCCAGAGAGAATCAGTGTGCTTG 0: 1
1: 3
2: 3
3: 22
4: 174
Right 905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG 0: 4
1: 34
2: 84
3: 158
4: 457
905739807_905739816 29 Left 905739807 1:40360640-40360662 CCATTCCATAGCAACAGCTGTGT 0: 1
1: 0
2: 0
3: 18
4: 203
Right 905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG 0: 4
1: 34
2: 84
3: 158
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901681041 1:10913007-10913029 AATGAGAGCTCAGGGAATGTGGG + Intergenic
901955878 1:12785167-12785189 CAGGAGAGCAGGGTGATAGTGGG + Intergenic
901979251 1:13021215-13021237 CAGGAGAGCAGGGTGATAGTGGG + Intronic
902002831 1:13207723-13207745 CAGGAGAGCAGGGTGATAGTGGG - Intergenic
902022059 1:13353487-13353509 CAGGAGAGCAGGGTGATAGTGGG - Intergenic
902157696 1:14502950-14502972 CAGGAGAGAAGAATGATTGTGGG - Intergenic
904121335 1:28199940-28199962 AAGTAGAGCACAGTGATGAGTGG - Intronic
904875914 1:33654468-33654490 AGGGAGAGCACAGTTGTTGCAGG + Intronic
905380766 1:37559890-37559912 CAGGAGAGCAGGGTGATAGTGGG + Intronic
905410656 1:37765763-37765785 AAGGAGAGCAAAGTGAGGGACGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907911904 1:58834346-58834368 GAGGGAAGCACAGGGATTGTGGG + Intergenic
908022732 1:59915127-59915149 CAGGAGAGCAGAGTGATAGTGGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
911280722 1:95924724-95924746 TAGGTGACCACAGTGAGTGTAGG - Intergenic
912230564 1:107787950-107787972 AAGGAGAGGAGTGGGATTGTGGG - Intronic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916185774 1:162131459-162131481 AAGGGGAGCACAGAGATATTAGG + Intronic
916345630 1:163788149-163788171 GAGGAGAGCACAGTCAATGCAGG - Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918402634 1:184178720-184178742 AAGGAGATCAGAGGGATTGTTGG - Intergenic
918683205 1:187381572-187381594 AAGAAGACCACAGTTATTGATGG + Intergenic
919098785 1:193068186-193068208 AAGGAGAGCACCATGATTATTGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922015099 1:221637303-221637325 AAGGAAAGCACAGTAAGTTTTGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923018826 1:230147400-230147422 AAGGACAGCAAAGTGAATATAGG - Intronic
923575486 1:235154909-235154931 AATGAGAGAACTGTGTTTGTTGG - Exonic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1062831604 10:609209-609231 AAGGAGAGCAGAGGTATTGGTGG - Intronic
1063969944 10:11374616-11374638 AAGAGGAGCACAGTGGTTCTTGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065711969 10:28527033-28527055 AAGGAAAGCTCTGTGATTGAAGG - Intergenic
1066209575 10:33223816-33223838 AAGGAGAGCACCATCATTGGCGG - Intronic
1066228368 10:33407190-33407212 AAGGAGAACTGAGTGAGTGTGGG + Intergenic
1066531933 10:36350471-36350493 AAGGTGTCCACAGTGAGTGTGGG + Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1067380576 10:45769504-45769526 AAGGAGAACCCAGGGATTCTGGG + Exonic
1067888274 10:50110156-50110178 AAGGAGAACCCAGGGATTCTGGG + Exonic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1068556038 10:58460089-58460111 AAGGAGAGCACAGAGACAGAAGG - Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069729679 10:70602620-70602642 AAGGAGAGAGCAGGGATTGGGGG - Intronic
1069734889 10:70647569-70647591 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1071185544 10:83039883-83039905 AAAGAGAGCAAATAGATTGTAGG + Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1072482682 10:95824763-95824785 AAGGAGACCACTGTGAATGAGGG - Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073870918 10:107863245-107863267 ACAGAGACCACAGTGAGTGTGGG + Intergenic
1074292795 10:112152962-112152984 AAGGACAGCACAGTGATACCTGG + Exonic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075262560 10:120975937-120975959 AAGAGGAGCACAGTGAATGAAGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075662895 10:124210429-124210451 AACCAGAGCCCATTGATTGTAGG + Intergenic
1075903307 10:126060802-126060824 CAGGAGTGCACAGGGACTGTGGG + Intronic
1075904743 10:126071486-126071508 AAGGAGAGGAGTGTGACTGTGGG - Exonic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1077703219 11:4460685-4460707 CAGGAGAGCAGGGTGATAGTGGG + Intergenic
1077753756 11:5003257-5003279 AAGGAGGGCACTGTGCATGTGGG - Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080396810 11:31897809-31897831 GAGGAGAGCTCAGTTAGTGTGGG - Intronic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1080649758 11:34212696-34212718 AAGGAAAGCACAGTGCTGATGGG - Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081282497 11:41226975-41226997 AAGCAGAGGACTGTGGTTGTGGG - Intronic
1082250692 11:49976819-49976841 AAGGTGAGAGCAGTGCTTGTAGG + Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1083375467 11:62216701-62216723 TAGGAGAGCAGGGTGATAGTGGG - Intergenic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084110266 11:67009752-67009774 AAGGAGAGTCCAGCTATTGTGGG + Intronic
1084624991 11:70299638-70299660 AAGGAGAGCACAGTTCTGGCAGG - Intronic
1084799762 11:71535455-71535477 CAGGAGAGCAGGGTGATAGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087032136 11:93716282-93716304 AAGGAGAGCTCAGCCATTCTGGG - Intronic
1087102734 11:94380843-94380865 AAGGAGAGGCCAGTGCTTCTTGG - Intronic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088803960 11:113333798-113333820 AAAGAGAGAACAATAATTGTTGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089149158 11:116351391-116351413 AAGGTGAGCACACTGAGTGCAGG + Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090292298 11:125555928-125555950 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1091660824 12:2381949-2381971 AAGGAGGGCCCTCTGATTGTTGG - Intronic
1092229791 12:6770044-6770066 AAGGAGAGCAGAGTCAGGGTGGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1094795742 12:33970272-33970294 AAGGAAAACAAAGTGATTGAGGG - Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095196362 12:39323266-39323288 CAGGAGAGCACAGTAAATGTTGG - Intronic
1095625001 12:44304194-44304216 GAGGAGAGCACAGTGACTATGGG + Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1095874798 12:47068623-47068645 GATGAGAGCACAGGGAGTGTGGG + Intergenic
1096550783 12:52370305-52370327 AATGAGGGCACAGTGAATGAGGG - Intergenic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098100201 12:67007127-67007149 GAGGAGAGCACAGTGGTGATGGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099278893 12:80617067-80617089 CAGCAGAGCACAGTGATTAAAGG + Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100388637 12:94127733-94127755 AAGGAGAACACAGTTTCTGTGGG - Intergenic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1104387235 12:128361554-128361576 AAAGAGTACACAGTGATTGCTGG + Intronic
1106796101 13:33207726-33207748 AATGAAAGCACATGGATTGTTGG + Intronic
1107215324 13:37911090-37911112 AAAGAGAGCACAGTGTTACTTGG + Intergenic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108808303 13:54187023-54187045 AAGGAGGGCACTGTGCATGTGGG + Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109359967 13:61282844-61282866 AAGGAGGGCACTGTGCATGTGGG - Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110710691 13:78647553-78647575 TAGGAGAGCAGGGTGATAGTGGG - Intronic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111296012 13:86278664-86278686 AAGGAGATTAGAGTGATTATAGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111351813 13:87041235-87041257 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111868937 13:93805991-93806013 AAGGAGAGCACAGTGACCTAAGG - Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1114303037 14:21395306-21395328 GAGGAGATCTCAGTGATTGATGG - Exonic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116481341 14:45394335-45394357 CAGGAGAACAGAGTGATGGTGGG - Intergenic
1116541806 14:46109268-46109290 CTGAAGAGCACAATGATTGTGGG + Intergenic
1116583586 14:46674299-46674321 GAGGGAAGCACAGTGATTGAAGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117976066 14:61298078-61298100 AAGGGGAACAAAGAGATTGTTGG - Intronic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1120344522 14:83268772-83268794 AAAGAAAGAACAGTGAGTGTGGG - Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1121351443 14:93176490-93176512 AAAGAGAGCACAGATTTTGTAGG + Intergenic
1121509069 14:94498941-94498963 AAGGAGAGGAGAGTGATAGAGGG + Intronic
1121555092 14:94830422-94830444 AAGGAGAGCAGAGAGACTGGGGG - Intergenic
1122997656 14:105274235-105274257 CAGGAGAGCAGGGTGATAGTGGG - Intronic
1123985279 15:25640427-25640449 AAGGGGGGAACAGTGATTATAGG + Intergenic
1125920124 15:43520419-43520441 AAGGAGAGGACAGCCAGTGTGGG + Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127140270 15:55969129-55969151 ACGAAGGGCAAAGTGATTGTGGG + Intronic
1128789397 15:70422141-70422163 AAGGAGGGCAGAGTGGATGTTGG + Intergenic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129426771 15:75469134-75469156 AAGGAGGTCACAGGGAGTGTTGG + Intronic
1129642266 15:77392965-77392987 AAAGAGAGCACACCGCTTGTGGG + Intronic
1130275806 15:82475842-82475864 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1130468165 15:84203234-84203256 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130496099 15:84470308-84470330 AAGGAGACCACAGTGCTTGCTGG - Intergenic
1130590458 15:85207832-85207854 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1135423243 16:22318440-22318462 GAGCAGAGCACAGTGATTGAGGG + Intronic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1137329850 16:47482324-47482346 AAGGACAGTACAGAGTTTGTAGG - Intronic
1137442023 16:48505952-48505974 CAGGAGAGCACAGGGAAGGTAGG + Intergenic
1138748312 16:59389413-59389435 AAGGAGGGCACAGTGCATGTGGG - Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140188813 16:72797078-72797100 AAGGAGGGCAGAGTGACTCTGGG + Exonic
1140875550 16:79149497-79149519 AAGGAAAGCATACTGTTTGTTGG + Intronic
1142149322 16:88505766-88505788 AAGGAGACCACCGTGCTGGTGGG + Intronic
1142405619 16:89887545-89887567 AAGGAGAGAACACGGATTTTTGG - Intronic
1142768142 17:2077246-2077268 AAGGAGTGCACAGACAATGTGGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144517612 17:15929506-15929528 GAGGAGAGCACAGTGCTCCTTGG - Intergenic
1145067807 17:19773936-19773958 AAGGAGGGGACAGGGACTGTGGG + Exonic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145722168 17:27083384-27083406 GAGGAGACCCCAGTCATTGTAGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1153326559 18:3826629-3826651 AAGGTGAGGACAGTGATTTGGGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156159689 18:34344582-34344604 AAGGTGAACAGAGTGACTGTGGG - Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1157991723 18:52504516-52504538 AAGTAAAGCACAGTGGCTGTGGG + Intronic
1159339797 18:67119809-67119831 ACGGAAAGCTCAGTGATTGGGGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159566193 18:70053304-70053326 AAGGAGTGAACATTGATTCTGGG - Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1159891275 18:73955432-73955454 AAGGAGGGCACTGTGCCTGTGGG + Intergenic
1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG + Intronic
1166390641 19:42407175-42407197 AAGGAGGGCGCAGTGCTTGATGG + Exonic
1168523898 19:57073698-57073720 AAGGAGCACACAGTGTTGGTGGG - Intergenic
925119992 2:1410903-1410925 ATGGAGAGCAGAGAGATTGCAGG - Intronic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928574055 2:32636919-32636941 GAGGACAGCATAGTGTTTGTGGG + Intronic
928726328 2:34178034-34178056 AAGGAGACCACAGCTATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
928982085 2:37146481-37146503 AAAGAGATGAAAGTGATTGTAGG - Intronic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930072169 2:47375432-47375454 AAGAATAGCACAGAGATTCTGGG + Intronic
930207368 2:48601683-48601705 AAAGAGATCAGAGAGATTGTGGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931180475 2:59895279-59895301 AAGGAGCACACACTGTTTGTGGG - Intergenic
932101144 2:68900382-68900404 AAGGACAGCAAGGTGATTGTAGG + Intergenic
934927654 2:98392681-98392703 AAGGAGAGCTCAGTCAATCTTGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935132413 2:100270577-100270599 CAGGAGAGCAGGGTGATAGTGGG - Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937678428 2:124617801-124617823 AAGGTGTGCATAGTGCTTGTTGG + Intronic
938120102 2:128627069-128627091 AAGAAGAGACCAGTGATTCTTGG - Intergenic
940358290 2:152769295-152769317 CAGGAGAGCAGGGTGATAGTTGG + Intergenic
940468568 2:154064074-154064096 ATGGAGAGGCCAGTGATTATAGG + Intronic
940595085 2:155781099-155781121 AAGGAGACCACAATAATAGTGGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942399361 2:175585047-175585069 AAGGAGAGTACAGATATTGAGGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943329465 2:186541932-186541954 AAGGATAGCTCAGTGTTTGAGGG + Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944753546 2:202736316-202736338 GATGAGAGGACAGTGATTGCTGG + Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944928906 2:204495822-204495844 AAGGAAAAAAGAGTGATTGTGGG - Intergenic
946204776 2:218096287-218096309 TAGGAGAGCAGGGTGATAGTGGG - Intergenic
946897721 2:224341345-224341367 CATGAGAACACAGAGATTGTGGG - Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947684738 2:232072886-232072908 AAGGACTGCACAGGGATTTTGGG + Intronic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169379845 20:5096849-5096871 AAGCCTAGCACAGTGCTTGTGGG - Intronic
1169459957 20:5785941-5785963 AAGGAGAGCACAGTGAAGAGTGG - Intronic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170062648 20:12275854-12275876 AAGAAGAGTACAATTATTGTAGG + Intergenic
1170293795 20:14801837-14801859 AAGGAAAGTACAGTGATGCTCGG - Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170397810 20:15946883-15946905 CAGGAGAGCAGGGTGATAGTGGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171433928 20:25104625-25104647 CAGGAGAGCACAGGCAATGTGGG + Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1171959355 20:31482718-31482740 CAGGATAGCACAGAGACTGTAGG - Intronic
1173097465 20:40049756-40049778 AAGGAAAGCACTAGGATTGTTGG - Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1179101825 21:38361054-38361076 AAGCAGAGGACAGTGACTGAGGG - Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1182399155 22:30061191-30061213 AAGAAGAGAACAGTCCTTGTGGG - Intergenic
1185053776 22:48567479-48567501 AAGGAGAGCAGGGTGATCGTGGG + Intronic
1185219960 22:49624261-49624283 AGGGAGGGCACAGTGATGCTCGG + Intronic
1185219995 22:49624415-49624437 GGGGAGAGCACAGTGATGCTCGG + Exonic
949216829 3:1580968-1580990 TAGCAGAGCTCAGTTATTGTGGG - Intergenic
949251471 3:1989554-1989576 ATGGAAAGCACATGGATTGTTGG - Intergenic
949701301 3:6762195-6762217 AAGGAGAGAACAGGGATAGCAGG + Intergenic
949978377 3:9481605-9481627 GAGGAGAGCATAGTCATTGAAGG + Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951398612 3:22202749-22202771 AAAGACAGCACATTGAATGTGGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
954137361 3:48588193-48588215 TAGGCGAGGACAGTGATGGTGGG - Intronic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957046004 3:75375174-75375196 AAGGACAGTTCAGTGAGTGTAGG - Intergenic
957219061 3:77358905-77358927 AAGATGAGCACAGTCATTGTAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957729230 3:84110976-84110998 CAGGACAGCACAGTGATGGGGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958435393 3:94089615-94089637 AAGGAGGGCACTGTGCATGTGGG + Intronic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959791539 3:110367811-110367833 CAGGAGAACAGAGTGATAGTGGG - Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960052124 3:113249088-113249110 GAGGAGAGCAGGGTGATTGCAGG + Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
962638917 3:137362309-137362331 AAGCAGAGTAAAGTAATTGTGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963145018 3:141984562-141984584 AAGTAGAACAGAGGGATTGTGGG + Intronic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963393435 3:144699793-144699815 AAGGAGAGCACAGTCAAGGGAGG - Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964179222 3:153864281-153864303 AAGGAAAGCACAGTGATTTAGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964494919 3:157278405-157278427 AAAGAGAGCAGAGGGAATGTGGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966771854 3:183511141-183511163 TAGGAGAGCAGGGTGATAGTGGG + Intronic
966782480 3:183595610-183595632 AAGGAGGGCACTGTGCATGTGGG + Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968096043 3:195931515-195931537 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096053 3:195931577-195931599 AGGCAGAGCACAGTGATGATGGG + Intergenic
968096064 3:195931639-195931661 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096075 3:195931701-195931723 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096083 3:195931763-195931785 AGGCAGAGCACAGTGATGATAGG + Intergenic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
969348460 4:6583849-6583871 AAGGAGGGCACTGTGAGTGCGGG - Intronic
969435088 4:7184651-7184673 AATGAGCTCACAGTGATGGTTGG - Intergenic
969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969790292 4:9489671-9489693 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969825051 4:9751036-9751058 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
970363688 4:15336788-15336810 GAGGAGAGGACATTGATTCTTGG - Intergenic
971616800 4:28800915-28800937 TTGGAGATCACAGTGATAGTAGG - Intergenic
971840662 4:31847917-31847939 AAGGAGGGCACTGTGTATGTGGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972380264 4:38512823-38512845 GAGGAAAGCACAGTGAGTTTGGG - Intergenic
973069852 4:45844747-45844769 AATGGTAGCACAGTGTTTGTGGG - Intergenic
973169468 4:47121265-47121287 AAGAAAAGCACAGCAATTGTGGG - Intronic
973255816 4:48112152-48112174 AATGAGAGAACAGTGATTTCAGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974655887 4:64821452-64821474 AAGGGAAGCACAGTGATTAAAGG - Intergenic
974877136 4:67714582-67714604 ATGGTGGGGACAGTGATTGTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
976762888 4:88569267-88569289 AAGGAGAGTGCCGGGATTGTGGG - Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977632137 4:99254897-99254919 AAGGAGAGTAGAATGAGTGTGGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977992748 4:103464610-103464632 AATGAGAGGACAGTGAGTGATGG + Intergenic
978055793 4:104264375-104264397 CAGAAGAGCACAGTGAATGAGGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979015644 4:115430006-115430028 TAGGAGAGAACAGTAATTGAAGG - Intergenic
979111271 4:116761152-116761174 AGGGGAAGCACGGTGATTGTGGG + Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982098049 4:151941486-151941508 AAGGAGAGAACAAATATTGTTGG + Intergenic
982208200 4:153013157-153013179 AAGGAAAGCACAGTGATATCTGG - Intergenic
982339723 4:154284589-154284611 AGGGTGAGCATGGTGATTGTGGG + Intronic
982690019 4:158538051-158538073 CAAGAGAGAACAGTGTTTGTAGG + Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983665697 4:170179861-170179883 ACAGAGAGCAAAGTGAATGTTGG - Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
983959017 4:173730028-173730050 AATGATAGCACAGTGATGGAAGG + Intergenic
984802749 4:183729755-183729777 AAGGAGAGCAGGGTGAGTGGGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986677052 5:10195156-10195178 AAGCACAGCTCAGTGATTGGTGG + Intergenic
986751613 5:10792768-10792790 AAGGGGAGCACTGTGTATGTGGG + Intergenic
986811476 5:11364567-11364589 AAGCAGGTCACAGTGCTTGTGGG + Intronic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988249789 5:28741872-28741894 AAGAATAGCACAGTGATGATAGG - Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG + Intergenic
990026953 5:51203880-51203902 AATGAGAGCTCAGTAAATGTTGG + Intergenic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
991700969 5:69316139-69316161 AAGGAGGGCAGAGTGACTCTGGG + Intronic
991948416 5:71924474-71924496 AAGGAGAGCAGAGTGAGATTTGG - Intergenic
991959096 5:72023759-72023781 AAGGAAAGCATATTGATTTTTGG + Intergenic
992402554 5:76424988-76425010 AAGGAGAGCACGGTGCATGGAGG + Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993833687 5:92789992-92790014 AAGGAGATCACATTCTTTGTGGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994009767 5:94887905-94887927 AAGAAGTGCACAGTGATTTCAGG + Intronic
994534111 5:101006409-101006431 CAGGAGAGCAGGGTGATAGTGGG + Intergenic
994995581 5:107058259-107058281 AAGGTGGGCACAGTGGGTGTGGG + Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995264709 5:110144686-110144708 AAGGAGAAGACAGTGATTAGGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997762549 5:136463484-136463506 ATGCTGAGCACAGTGATTGGAGG - Intergenic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1001327693 5:170741277-170741299 AAAGAGACCACAGTGATTCAAGG + Intergenic
1002276122 5:178105279-178105301 AAGGAGAGAGCGGTGCTTGTGGG + Intergenic
1003527358 6:6909479-6909501 AAGGAGAGCACAGGGCTTTGGGG - Intergenic
1005075591 6:21903480-21903502 AAGAAGATCCCAGTGATTATAGG + Intergenic
1005252556 6:23964155-23964177 AAGGAGGGCAGTGTGATTGCAGG - Intergenic
1005430210 6:25748702-25748724 TAGGAGAGCAGGGTGATAGTGGG + Intergenic
1005571897 6:27153347-27153369 AAGAAGAGGACAGTGAATCTAGG + Intergenic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011029163 6:82902581-82902603 AAGGACAGAGCAGTGATTGCAGG + Intronic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1011811042 6:91132711-91132733 AAGCAGAGCAAAGTCTTTGTTGG + Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013265006 6:108487807-108487829 AATGAGAGCAGAGTGCATGTTGG + Intronic
1013595950 6:111661419-111661441 AAGGAAAGCACTAGGATTGTTGG + Exonic
1013654021 6:112226584-112226606 AAGGAGTTCACAGTGATTTCAGG - Intronic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1013996967 6:116320481-116320503 AAGGAGAGAACAGTGCAGGTTGG + Intronic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015969143 6:138726827-138726849 AAGGCAAGCACAGTGAGTGATGG + Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016354084 6:143198892-143198914 AAGGAGAAAAGAGAGATTGTGGG + Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1020882392 7:13778449-13778471 AAGTAGAGAACAATGATTATAGG + Intergenic
1021211673 7:17861705-17861727 AAGGAGGGCACCGTGCATGTGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021640864 7:22735055-22735077 AAGGAGAACACATCAATTGTGGG + Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1024981315 7:55159596-55159618 GTGAAGAGCACAGTGAGTGTGGG - Intronic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025908835 7:65811118-65811140 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1025980033 7:66397810-66397832 CAGGAGAGTACTGTGAATGTGGG - Intronic
1026043502 7:66888322-66888344 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1027204909 7:76090149-76090171 CAGGAGAGTACTGTGAATGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028284715 7:88981787-88981809 GAGGAGAGCACAGTGATCTTGGG - Intronic
1028360831 7:89964504-89964526 AAGGAGGGCACTGTGCATGTGGG + Intergenic
1028568623 7:92260985-92261007 AAGGAAAGCAGAGTAAATGTTGG - Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029790610 7:102839267-102839289 TAGGAGAGCAGGGTGATGGTGGG - Intronic
1030107246 7:105997468-105997490 AAGGAGAGCTCAGTGCCTTTGGG + Intronic
1030431723 7:109456350-109456372 AAGAACAGCACAGTGATTATCGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1031886223 7:127248851-127248873 ATGGAGAGCACAGAGCTTGAAGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035517275 8:246127-246149 AAGGACAGAAGAGTGATTGAAGG - Exonic
1036011990 8:4736345-4736367 AAGGAGATCACAATGGTTGGAGG + Intronic
1036814934 8:11895015-11895037 AAGGAGAGCACAGCAATCGCGGG - Intergenic
1038067273 8:23975996-23976018 CTGGAGAGGACAGTGTTTGTGGG + Intergenic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1038730037 8:30118741-30118763 CAGGAGAGCAGGGTGATAGTGGG + Intronic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039414228 8:37379812-37379834 CAGGAGAACACAGGGATTCTAGG + Intergenic
1040290280 8:46120655-46120677 AATGAGACCACAGCGATTGTTGG - Intergenic
1040317758 8:46273974-46273996 GATGAGACCACAGTGATTGCTGG + Intergenic
1040745520 8:50636566-50636588 AAGGAGAGCATAGTGACTTTGGG - Intronic
1040962707 8:53051862-53051884 TAGGAGAGCATGGTGAGTGTTGG + Intergenic
1041222581 8:55666123-55666145 AAGGAAAGCACAGTGACACTGGG + Intergenic
1041639625 8:60182552-60182574 AATGTGAGCACAGTTCTTGTGGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1042383667 8:68149227-68149249 AAGGAGGGCACAGTAGTTGATGG + Intronic
1043144398 8:76634230-76634252 AATGAGAGCAGAGTGAAGGTGGG - Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1043585233 8:81760899-81760921 AAAGAGAGCAAAGTGGTGGTGGG + Intergenic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044422826 8:92017816-92017838 AAGGACAGCACAGGGATGGCAGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1045952100 8:107864169-107864191 AAGGAGTGCAGAGTGAAGGTTGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047076989 8:121415393-121415415 AAGGAGAGCACAGTCTGGGTAGG + Intergenic
1047778918 8:128096142-128096164 AAGGAGTCCACTGTGTTTGTGGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048449910 8:134524126-134524148 AAGGAGAGCAGGGGGATGGTTGG - Intronic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1049658195 8:143808121-143808143 CAGGAGAGCCCAGTGATCTTGGG + Intronic
1049790010 8:144468170-144468192 CAGGAGAGCAGAGGGACTGTGGG + Intronic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1050385183 9:5082250-5082272 CAGGAGAGCAGGGTGATAGTGGG + Intronic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052072048 9:24093429-24093451 AAGGCCAGCCCAGTGAGTGTGGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052547631 9:29900613-29900635 AAGGAGAACACTGTGCATGTAGG - Intergenic
1053017123 9:34668235-34668257 AAGAAGAGAACAGTGCATGTGGG - Intergenic
1053105747 9:35406378-35406400 TAGGAGCACACAGTGCTTGTCGG - Intergenic
1053118061 9:35522954-35522976 AAGGTCAGCAGAGTGATTATTGG + Intronic
1053169548 9:35868953-35868975 AAGGAGAGCACAGAGCTGGGTGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055705438 9:78995527-78995549 AATTAGATAACAGTGATTGTTGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056424287 9:86461163-86461185 AAGGTAAGCTCAGTGATTCTTGG + Intergenic
1057528882 9:95826748-95826770 AAGGAGAGCAAAGAAATTGGAGG - Intergenic
1058086284 9:100752028-100752050 AGGGGTTGCACAGTGATTGTGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1059910672 9:119040559-119040581 AAGGAGGGGACAGTGGTGGTTGG - Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060624185 9:125095489-125095511 AAGGAGAGAACACGTATTGTAGG - Intronic
1061502608 9:131012659-131012681 AAGGAGAGGCCTGGGATTGTCGG + Intronic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185755848 X:2652309-2652331 AAGGAGACTACAGTGTTTGGGGG + Intergenic
1186434820 X:9533659-9533681 AAGAAAGGCACAGTGATGGTGGG + Intronic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186602260 X:11050303-11050325 AAGGAGAACATAGTGATCATGGG - Intergenic
1186606420 X:11097699-11097721 ATGGAGAGCACAGTGATCTGAGG - Intergenic
1187362889 X:18644548-18644570 AAGGAGATCAAAGTGATTTCAGG - Exonic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1187990744 X:24869486-24869508 AAGGAGGGCACAGTGAAGGAAGG + Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188585816 X:31773882-31773904 TAGGAGAGTAAAGTGATTGGTGG + Intronic
1188711338 X:33404296-33404318 AAAGAAAGCACAGTGCTTTTTGG + Intergenic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188881141 X:35493289-35493311 AAGAAGAGCACTGTGCATGTGGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189119414 X:38378261-38378283 AAGGAAGCCACAATGATTGTGGG - Intronic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1190521508 X:51282852-51282874 AAAGAGAGTAGAGAGATTGTGGG + Intergenic
1190648280 X:52543742-52543764 AAGCAGAGGACAGTGAGTGCAGG + Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194797405 X:98228649-98228671 AATGAGAGCACAGTCAATGAAGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195018337 X:100800188-100800210 AATGAGAGCACAAAGATTATAGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195230901 X:102845813-102845835 TAAGAAAGCACAGTGATTGCTGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195300339 X:103524160-103524182 TAAGAAAGCACAGTGATTGCTGG - Intergenic
1195303333 X:103554330-103554352 CAAGAAAGCACAGTGATTGCTGG - Intergenic
1195543435 X:106088249-106088271 AAGGAAAGCACAGCAATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196141469 X:112267483-112267505 ATGGAGATCACAGAGATTGGAGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1196996695 X:121391245-121391267 AAGGCGTGCACAGTGCTTTTGGG - Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198697362 X:139355765-139355787 GAGAAAAGCACAGTGATTGTGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1202325676 Y:23689264-23689286 AAGGAGGGCACTGTGCCTGTGGG - Intergenic
1202545095 Y:25980790-25980812 AAGGAGGGCACTGTGCCTGTGGG + Intergenic