ID: 905746936

View in Genome Browser
Species Human (GRCh38)
Location 1:40426182-40426204
Sequence AACATTATGAGGGCCAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905746936_905746943 16 Left 905746936 1:40426182-40426204 CCACCCCTGGCCCTCATAATGTT No data
Right 905746943 1:40426221-40426243 GTCCTCATTCAAAGCCATCCTGG No data
905746936_905746942 -6 Left 905746936 1:40426182-40426204 CCACCCCTGGCCCTCATAATGTT No data
Right 905746942 1:40426199-40426221 AATGTTTTACGAATTTGTGTTGG No data
905746936_905746944 17 Left 905746936 1:40426182-40426204 CCACCCCTGGCCCTCATAATGTT No data
Right 905746944 1:40426222-40426244 TCCTCATTCAAAGCCATCCTGGG No data
905746936_905746946 27 Left 905746936 1:40426182-40426204 CCACCCCTGGCCCTCATAATGTT No data
Right 905746946 1:40426232-40426254 AAGCCATCCTGGGCCGAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905746936 Original CRISPR AACATTATGAGGGCCAGGGG TGG (reversed) Intergenic
No off target data available for this crispr