ID: 905748574

View in Genome Browser
Species Human (GRCh38)
Location 1:40440947-40440969
Sequence CTGTCGTACAAGCTGGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905748570_905748574 27 Left 905748570 1:40440897-40440919 CCCTTTTAAACTGATAAAGATTT No data
Right 905748574 1:40440947-40440969 CTGTCGTACAAGCTGGAGTGTGG No data
905748569_905748574 28 Left 905748569 1:40440896-40440918 CCCCTTTTAAACTGATAAAGATT No data
Right 905748574 1:40440947-40440969 CTGTCGTACAAGCTGGAGTGTGG No data
905748571_905748574 26 Left 905748571 1:40440898-40440920 CCTTTTAAACTGATAAAGATTTT No data
Right 905748574 1:40440947-40440969 CTGTCGTACAAGCTGGAGTGTGG No data
905748568_905748574 29 Left 905748568 1:40440895-40440917 CCCCCTTTTAAACTGATAAAGAT No data
Right 905748574 1:40440947-40440969 CTGTCGTACAAGCTGGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905748574 Original CRISPR CTGTCGTACAAGCTGGAGTG TGG Intergenic
No off target data available for this crispr