ID: 905752770

View in Genome Browser
Species Human (GRCh38)
Location 1:40479994-40480016
Sequence AGGAGTAAATAGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 560}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905752762_905752770 10 Left 905752762 1:40479961-40479983 CCCAACAATCACACCTTATTTAG 0: 1
1: 0
2: 0
3: 10
4: 164
Right 905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG 0: 1
1: 0
2: 1
3: 38
4: 560
905752766_905752770 -3 Left 905752766 1:40479974-40479996 CCTTATTTAGTGGTCTGGTTAGG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG 0: 1
1: 0
2: 1
3: 38
4: 560
905752763_905752770 9 Left 905752763 1:40479962-40479984 CCAACAATCACACCTTATTTAGT 0: 1
1: 0
2: 2
3: 11
4: 135
Right 905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG 0: 1
1: 0
2: 1
3: 38
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905752770 Original CRISPR AGGAGTAAATAGAAGGATGG AGG Intronic
900717070 1:4152101-4152123 AGAAGAAAATCGAAGGCTGGGGG - Intergenic
900943081 1:5813751-5813773 AGGAGAACAGAGAAGGAAGGAGG + Intergenic
901228207 1:7626841-7626863 AGGAGTAAACAGAAGGGTTTAGG + Intronic
901539079 1:9903166-9903188 ATGAGTCATTAGAAGGAAGGAGG + Intronic
901628588 1:10637521-10637543 AGGAGGGAATGGAAGGCTGGCGG - Exonic
902121188 1:14167420-14167442 TGGACTAAATACAAGGATGGAGG + Intergenic
903177384 1:21589151-21589173 GGGAGGAAATAGAAAGATGAGGG + Intergenic
903466034 1:23553460-23553482 AGGAGCAAATAGAACAAGGGTGG - Intergenic
904522823 1:31109168-31109190 AGGAAGAAATAGAAGGAAGGAGG - Intergenic
904703470 1:32373142-32373164 AGAAATAAAAAGAAGAATGGGGG - Intronic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
905948362 1:41923447-41923469 AGGAGTAGAGAGTAGAATGGTGG + Intronic
906651387 1:47515489-47515511 AGGAGAAAAGGGAAGGATGGTGG + Intergenic
906658021 1:47562787-47562809 AGGCATAAAGAGATGGATGGTGG - Intergenic
906896935 1:49785133-49785155 AGAAGTAGATAGTAGAATGGTGG + Intronic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
907697907 1:56752642-56752664 GGGACTACATTGAAGGATGGTGG - Intronic
908054780 1:60273090-60273112 AGGTGAAAATAGAAAAATGGAGG - Intergenic
908451740 1:64262787-64262809 AGGTGTAAATACCAGGATGCAGG + Intronic
908975660 1:69894801-69894823 AGAAGTAAATAGTAGAATGATGG + Intronic
909964031 1:81885127-81885149 ACGAATAAATAGAAGTAAGGAGG + Intronic
910313615 1:85856977-85856999 GGAAGTAAAGAGAAGCATGGAGG + Intronic
911289067 1:96033644-96033666 AAAAGTAAATAGATGCATGGAGG - Intergenic
911808506 1:102243098-102243120 AGGAGAAAACAGAAGGGTTGGGG + Intergenic
911879666 1:103220309-103220331 AGGAAAAAAGAGATGGATGGAGG + Intergenic
912486371 1:110032276-110032298 AGGAGGAAATAGCAGTGTGGTGG + Intronic
913106198 1:115616269-115616291 AGGAGATAATAGAATCATGGGGG - Intergenic
913201828 1:116501068-116501090 TGGAGGAACTAGAAGGCTGGGGG - Intergenic
913310994 1:117493115-117493137 AGGAGAAAACAGAAGGATAGAGG - Intronic
913378891 1:118186430-118186452 AGGAATAAATTGAGGGAAGGAGG + Intergenic
913401742 1:118442272-118442294 AGGAGAAAATAGAACGAAGAAGG - Intergenic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
915304478 1:154969825-154969847 GGGAGTGAAAAGAAGGAAGGGGG + Intronic
915376378 1:155399858-155399880 AGGAGAAAAGTGTAGGATGGAGG + Intronic
915536083 1:156536432-156536454 AGGAGTAGAGAGTAGAATGGTGG + Intronic
915853244 1:159351255-159351277 AGAAGTACATAGGAGTATGGAGG - Intergenic
916208473 1:162338331-162338353 AGGAGAAAAGAGAATAATGGGGG - Intronic
916970394 1:170007276-170007298 AGGAGAGAATAGAAGGAAGTGGG + Intronic
917249787 1:173045922-173045944 AAGAGAAAATAGAAGTACGGAGG - Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917697810 1:177545643-177545665 AGGAGGAAAAAGAGGGATAGAGG - Intergenic
917830043 1:178873014-178873036 ATGAGGAAAAAGAAGAATGGTGG + Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
919158134 1:193793329-193793351 AGGAGTAGAGAGTAGAATGGTGG + Intergenic
919651497 1:200153798-200153820 AGGGGGAGATAGAGGGATGGAGG + Intronic
919708017 1:200697486-200697508 AGGAGGTAATTGAAGCATGGGGG + Intergenic
919911086 1:202111120-202111142 AGGAGTGAATAGAGGGAGTGAGG + Intergenic
919990068 1:202703384-202703406 GGGAGTAAAAAGAAGGGCGGGGG + Intronic
920654711 1:207867081-207867103 AAGGGTAACTAGAAGGATGGTGG - Intergenic
920917568 1:210270352-210270374 AGGGATAGATAGAAGGAAGGAGG - Intergenic
921219244 1:212961527-212961549 AGGAGAAGATAGAAGGAAGAGGG - Intronic
921274205 1:213501947-213501969 AACAGGAAATGGAAGGATGGAGG - Intergenic
921804223 1:219435979-219436001 AGGAGTATAGACAAGGATTGGGG - Intergenic
922140240 1:222877459-222877481 AGGAGATAATAGAATCATGGGGG - Intronic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
922790898 1:228310413-228310435 AATAGTAAATGGATGGATGGTGG - Intronic
923145610 1:231195656-231195678 AGGTGGAAATACAAGGAAGGGGG - Intronic
923188604 1:231598071-231598093 GGGAGTTATTAGAAGGATGCTGG + Intronic
923984336 1:239363955-239363977 ATGAGTAAATGGATGGTTGGGGG + Intergenic
1062928356 10:1335252-1335274 AGGGATGGATAGAAGGATGGAGG + Intronic
1063159493 10:3408898-3408920 AGGAGGAAAGAGGAGGAGGGAGG + Intergenic
1063937711 10:11096266-11096288 AGAAGTAATTAGCAGGAGGGAGG - Intronic
1064074098 10:12255163-12255185 AGGAGAAAACAGAGGGAGGGTGG - Intergenic
1064619062 10:17195869-17195891 AAGAGTAACTAGAAGGAAAGAGG + Intronic
1065666739 10:28071272-28071294 AGGTGTAAAGAGAAGTAGGGTGG + Intronic
1065951630 10:30657751-30657773 AGGAGGGAAAAGAAGGAGGGAGG - Intergenic
1066057200 10:31693325-31693347 AGGAGCAAAGAGAAGCTTGGTGG - Intergenic
1066594322 10:37032590-37032612 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1068303228 10:55173347-55173369 ATGTGTATGTAGAAGGATGGGGG + Intronic
1068352305 10:55862947-55862969 TGGAGTTAATTGAACGATGGAGG + Intergenic
1068877610 10:62013606-62013628 AGGAGTAGAGAGTAGAATGGTGG - Intronic
1069463835 10:68620317-68620339 TGGGGTAAATGGAAGGATTGGGG - Intronic
1070012345 10:72488715-72488737 AGGAGTAATTAGGAAGATGCTGG - Intronic
1071956029 10:90760303-90760325 AGGAGTAAAAAGGAGGACAGAGG + Intronic
1072485923 10:95855299-95855321 AGGCTTAAATAAAGGGATGGAGG - Intronic
1073580598 10:104662417-104662439 ATGAGTAAATAAAAGCATGGTGG + Intronic
1073943993 10:108730019-108730041 AGGAATAGACAGAAGGAGGGAGG + Intergenic
1074002115 10:109383833-109383855 AGAAAGAAAAAGAAGGATGGTGG - Intergenic
1074306866 10:112287148-112287170 AGGGCTAAAGAGAAGGATTGGGG + Intronic
1074929116 10:118105564-118105586 AGTAGTATAAACAAGGATGGAGG - Intergenic
1075485116 10:122815435-122815457 AGGAGGAAAGCGAAGGAGGGAGG - Intergenic
1076802537 10:132837262-132837284 TGGAGGACACAGAAGGATGGAGG - Intronic
1076833720 10:133009573-133009595 AGGAGGAAAGAGAAGGAGGTGGG + Intergenic
1076984199 11:223617-223639 AGGAGAAGGGAGAAGGATGGGGG - Intronic
1077283211 11:1754675-1754697 TGGAGGAAATGGAGGGATGGAGG + Intronic
1078086392 11:8235311-8235333 AGAAGTAGGTAGAAAGATGGAGG - Intronic
1078166986 11:8895649-8895671 AGAAGTATAGAGATGGATGGTGG + Intronic
1078579402 11:12526923-12526945 ACCAGTAAATAGATGGATGAAGG + Intronic
1080242761 11:30145989-30146011 AGAAGTAAAGAGCAGTATGGTGG + Intergenic
1081014613 11:37860014-37860036 AGGAGTGGATAGAAAAATGGGGG - Intergenic
1082038725 11:47667251-47667273 AGGAGTAGATGGATGGCTGGGGG - Intronic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085129089 11:74022298-74022320 AGGAGTAACTACATGGATGGTGG + Intronic
1085647149 11:78232227-78232249 AGTAGTCTATAGAAAGATGGTGG - Intronic
1085878260 11:80434662-80434684 AGGAGAAAATGGTAGCATGGAGG - Intergenic
1085890313 11:80571884-80571906 AACAGAAAATAGAATGATGGTGG - Intergenic
1086021260 11:82232660-82232682 AGGAGTAATTATAACAATGGAGG - Intergenic
1086272271 11:85081815-85081837 AGCTGTATACAGAAGGATGGAGG - Intronic
1086393665 11:86391936-86391958 AGGAGTAAGAGGGAGGATGGAGG + Intronic
1086498664 11:87429894-87429916 AGGAATAATCAGAAGGGTGGAGG + Intergenic
1086541920 11:87922975-87922997 AGGAGAAAATAAAAGAATAGGGG + Intergenic
1088024586 11:105162517-105162539 AGGAGTAGACAGAAAAATGGTGG - Intergenic
1088594607 11:111431177-111431199 AGAGGTGAATTGAAGGATGGGGG + Intronic
1088736498 11:112732066-112732088 AGGTGTAAAGAGAAGGAAGCTGG + Intergenic
1089257303 11:117200627-117200649 AGGAGGAAGGGGAAGGATGGTGG + Intronic
1089389250 11:118088838-118088860 TGGAGTTAATAGAGGGAAGGAGG - Intronic
1090222133 11:125036559-125036581 AGGAGGAAATCGAAAGATGAGGG - Intronic
1091130166 11:133139599-133139621 AGGAGTAATTAGAAGAAATGAGG + Intronic
1091586612 12:1820560-1820582 AGAAGGAAAGAGAGGGATGGAGG - Exonic
1092873921 12:12831999-12832021 AGGAGTAAAGAGTAGGAGGCAGG + Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093525101 12:20096379-20096401 AGGAGGAAATGGAAGCGTGGAGG + Intergenic
1094213056 12:27912846-27912868 AGGAGAAAAAAGAGAGATGGAGG + Intergenic
1094673748 12:32597443-32597465 AGGAGTTAATAGTAGGGTAGAGG + Intronic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095873453 12:47055392-47055414 AGGAGAACAAAGAAGGGTGGTGG - Intergenic
1096352360 12:50911096-50911118 AGGAGTGAAGAGAGAGATGGAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096616948 12:52838653-52838675 AGGAGGAACAAGAAGGAAGGGGG + Intronic
1097594063 12:61606006-61606028 AGGAGTAAATATAACCAAGGAGG - Intergenic
1097971990 12:65643174-65643196 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
1098187010 12:67907680-67907702 AGAACTAAATAGAAGGAGTGAGG - Intergenic
1098301488 12:69058733-69058755 AGAAGTAGATAGTAGAATGGTGG - Intergenic
1098812019 12:75106563-75106585 AGGAGAAAATCAAAGGATGAAGG + Intronic
1099337728 12:81385666-81385688 AGAAGTTGATAGAAGAATGGTGG + Intronic
1099369145 12:81809100-81809122 AGGAGGAAAAAGAAAGAGGGGGG - Intergenic
1099769705 12:87035276-87035298 GAGAGGAAATAGAGGGATGGAGG + Intergenic
1100732206 12:97483914-97483936 AGTAATAAATAGAATGAAGGAGG - Intergenic
1101521896 12:105491484-105491506 AGAAGTATACAGAAGAATGGTGG - Intergenic
1101615109 12:106328729-106328751 GGAAGTGAATGGAAGGATGGAGG + Intronic
1102188466 12:110967625-110967647 AAGATTAAATAAAAGGATGATGG + Intergenic
1102705705 12:114878461-114878483 AGGAGGGAAGAGAAGGAGGGTGG - Intergenic
1102833132 12:116026133-116026155 AGGAGTCAAAAAAAGGATGTCGG + Intronic
1104300940 12:127564584-127564606 AGAAGTAGATGAAAGGATGGGGG - Intergenic
1105378878 13:19868093-19868115 AGGAACAAAGAGAAGGTTGGGGG - Intergenic
1106458650 13:29949037-29949059 AGGGGTAAATAGAGGGACTGTGG + Intergenic
1106681446 13:32012537-32012559 AGGAATAAAGTGAAGGATGAGGG - Intergenic
1106755317 13:32817160-32817182 AGGAGTAAATTTAATGAAGGAGG + Intergenic
1106807830 13:33329460-33329482 AGAAGTAGAAAGTAGGATGGTGG - Intronic
1106929325 13:34646900-34646922 AGGAGTGAATAGTGGGAGGGAGG + Intergenic
1107684592 13:42884398-42884420 AGAAGAAAATAGAAGGTTGTGGG - Intergenic
1108444073 13:50488755-50488777 AGCAGAGAATAGAAGGATAGTGG - Intronic
1108895527 13:55322630-55322652 AAGAAAAAATAGAAGGAAGGAGG - Intergenic
1109364118 13:61333509-61333531 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1109516918 13:63455879-63455901 AGAAGAAAATAGGAGGATAGAGG - Intergenic
1110183692 13:72647328-72647350 AGAAGTAAAGAGAAAGATGATGG - Intergenic
1111039466 13:82726700-82726722 AGGGGCCTATAGAAGGATGGAGG - Intergenic
1112346500 13:98594338-98594360 AGGAGTAAACCGAAGCAAGGTGG - Intergenic
1113373605 13:109744250-109744272 AGGACTTAAGAGAAGGCTGGAGG + Intergenic
1113641469 13:111960490-111960512 ATGAATGAATAGATGGATGGAGG + Intergenic
1113695032 13:112339238-112339260 AGGACTGAAGAGAAGGAGGGAGG - Intergenic
1114774493 14:25465879-25465901 AAGAGTAAATACAAGGATTTGGG - Intergenic
1114853900 14:26414418-26414440 AGGAGAAAATAGAAGCATAGAGG - Intergenic
1115710472 14:36045135-36045157 AGGAGTTAGTTGAAGGATTGTGG + Intergenic
1116096170 14:40371825-40371847 AAGAGTAAAGAAAATGATGGAGG - Intergenic
1117484674 14:56182397-56182419 ACCAGTAAATAGTATGATGGTGG + Intronic
1117927751 14:60802082-60802104 AGAAGTAAAGAGTAGAATGGTGG + Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118505067 14:66402327-66402349 AGGAATTAAGAGAAGGAAGGTGG - Intergenic
1118532680 14:66724547-66724569 AGGGGTAGATAGAGGGATGCAGG + Intronic
1119880564 14:78096462-78096484 AGGAGTTAATTGAACCATGGGGG - Intergenic
1120182759 14:81362443-81362465 AGAAGTAAAAAGTAGAATGGTGG + Intronic
1120236497 14:81897692-81897714 AGGAGTAAATTTAACCATGGAGG - Intergenic
1120417833 14:84242773-84242795 AGGAGATAATAGAATTATGGGGG - Intergenic
1120442464 14:84558136-84558158 GGGAGAAAATAGAATCATGGGGG - Intergenic
1120635179 14:86942215-86942237 AGGAATAGATGGAAGGAGGGAGG + Intergenic
1121099732 14:91242289-91242311 ATGAGTAAATGGAGGGATAGGGG + Intronic
1121425796 14:93851011-93851033 AGGATGAAATAGAAGGTTGTAGG - Intergenic
1122832224 14:104404154-104404176 AGGAGTAAGTAAGAGGATGCTGG + Intergenic
1202918717 14_KI270723v1_random:10780-10802 AGAAGTAGACAGTAGGATGGTGG + Intergenic
1202925907 14_KI270724v1_random:23790-23812 AGAAGTAGACAGTAGGATGGTGG - Intergenic
1123779548 15:23612735-23612757 AGAAGTAGAGAGAAGAATGGTGG + Intronic
1123789683 15:23708532-23708554 AGGAGTGAATATAAAGATAGGGG - Intergenic
1125370190 15:38967242-38967264 AGGAGTTAATTGAATCATGGAGG - Intergenic
1125398283 15:39273122-39273144 AGTTGGAAATAGAAGGATTGGGG - Intergenic
1126951310 15:53884809-53884831 AGGAGTAAAGGGAAAGAGGGGGG - Intergenic
1127174714 15:56341257-56341279 AGGAGTAATTATAAGGATTGTGG - Intronic
1127566713 15:60196546-60196568 AGGAATAAAGGGAAGGAAGGAGG + Intergenic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1128752651 15:70160271-70160293 AGGACTAAGTAGAAGAATAGAGG + Intergenic
1128793684 15:70450134-70450156 ATGAGTGGATAGAAGGATGGAGG + Intergenic
1130155014 15:81342886-81342908 AGGAGGAAATGGAGGGAGGGTGG + Intronic
1130872798 15:87984481-87984503 CGGATTCAATAAAAGGATGGCGG + Intronic
1131357607 15:91758991-91759013 AGGAGAAAATAGAAGCATGAGGG + Intergenic
1131715561 15:95106944-95106966 ATGAGTAAACAGAGGCATGGAGG - Intergenic
1131723948 15:95202316-95202338 GGGAGGTAATAGAATGATGGGGG + Intergenic
1133087433 16:3375854-3375876 AGGAGGAAAGGGAAGGAGGGAGG - Intronic
1133205971 16:4233822-4233844 AGGATCAAATAGAAGCATGAGGG - Intronic
1133849659 16:9490252-9490274 AGGAGGAGAGAGAAGGAGGGAGG + Intergenic
1135250730 16:20899797-20899819 ATGATTAAAGAGAACGATGGGGG + Intronic
1137033822 16:35551343-35551365 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1138495766 16:57408313-57408335 ATGAGTGAATGGATGGATGGAGG - Intronic
1138585950 16:57970648-57970670 AGGAGGAAAAAGAAAAATGGGGG - Intronic
1139383204 16:66547638-66547660 AGCAGTAACTAGGAGAATGGTGG - Intronic
1139602178 16:67993508-67993530 AGGAGTAAAAGGGAGGGTGGAGG - Exonic
1140535258 16:75703964-75703986 AGGAAAAAAAAAAAGGATGGGGG - Intronic
1140558743 16:75952433-75952455 AGGACTACATAGAATGATGTCGG + Intergenic
1140681641 16:77390993-77391015 TAGAGTAGATGGAAGGATGGTGG - Intronic
1140702430 16:77593587-77593609 AGGAGTAAATATAAGAATATTGG + Intergenic
1141251788 16:82365621-82365643 AGGAGTTAATTGAATCATGGGGG - Intergenic
1141714888 16:85721158-85721180 ATGAGTAGATTGAAGGCTGGAGG - Intronic
1141813599 16:86393581-86393603 AGAAGTGAAAAGGAGGATGGGGG + Intergenic
1142768334 17:2078717-2078739 AGGAGTAAAAGGAAGGATGGAGG + Intronic
1143481585 17:7230276-7230298 AGGACTCACTGGAAGGATGGAGG + Exonic
1145353241 17:22109270-22109292 ATGAGTAAATAGAAGAATCAAGG - Intergenic
1146356183 17:32136180-32136202 AGGATTAAATAAAATGATGCAGG - Intergenic
1146699247 17:34940206-34940228 AGAAGTAGATAGTAGAATGGCGG - Intronic
1148914719 17:50966193-50966215 AGCATTAAATAAAAGGATAGAGG + Exonic
1149128232 17:53261452-53261474 AGAACTGAATAGCAGGATGGAGG + Intergenic
1149241552 17:54656549-54656571 AGAAGTAGAGAGTAGGATGGTGG - Intergenic
1149278344 17:55071303-55071325 AAGAGTGAATATAGGGATGGAGG - Intronic
1150973417 17:70056686-70056708 AGGAGTTCATAGTATGATGGGGG + Intronic
1151345740 17:73500268-73500290 AGGAGGATGGAGAAGGATGGAGG - Intronic
1151345747 17:73500298-73500320 AGGAGGATGGAGAAGGATGGAGG - Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1152305247 17:79516583-79516605 AGGAGTAATTAGAGGAATGAGGG - Intergenic
1153064111 18:1025497-1025519 AGAATTAAATTGGAGGATGGTGG + Intergenic
1153198322 18:2624859-2624881 AAGAGAAAATAGAAGTATGTAGG + Intergenic
1153445395 18:5166526-5166548 TGAAGTATATAGAAGTATGGTGG - Intronic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1153534048 18:6081238-6081260 AGGAGGAGCTAGCAGGATGGTGG + Intronic
1153918544 18:9767472-9767494 AGGAGTCAGTAGGAGTATGGTGG + Intronic
1154304716 18:13222189-13222211 ATGAGTAAATAAATGGATGGGGG - Intronic
1154469521 18:14685322-14685344 AGGAGTAGAGAGTAGAATGGTGG - Intergenic
1155066550 18:22273801-22273823 AGGAGGAAGGAGGAGGATGGAGG - Intergenic
1155427579 18:25722692-25722714 AGGAGCAACAAGAAGGCTGGAGG - Intergenic
1156456340 18:37296772-37296794 AGGAGGACATAGAATGATGCTGG - Intronic
1156687219 18:39664713-39664735 AGAAGTAAAAAGGAGGATGTAGG + Intergenic
1157285400 18:46373997-46374019 AGGAGTAATTAGAAACATGAGGG - Intronic
1157392408 18:47313882-47313904 AGCAGTGAATATGAGGATGGGGG - Intergenic
1157684028 18:49628684-49628706 AGGAGGTAAGAGAAGAATGGTGG + Intergenic
1158582538 18:58697138-58697160 AGGAGGATAGAGAGGGATGGGGG - Intronic
1158641594 18:59208177-59208199 AGGAGGAAATGGAGGGAGGGAGG + Intergenic
1159235605 18:65669067-65669089 TGGGGTAAATAGAAAGATGATGG - Intergenic
1159254186 18:65924375-65924397 AGGAGGAAATTGAATAATGGGGG + Intergenic
1160902868 19:1437670-1437692 AGGAGTAACTAGAACTATGTAGG - Intergenic
1161864025 19:6821098-6821120 AGGATTAAATAGAAAGATAGAGG + Intronic
1163045543 19:14638813-14638835 AGGAGTAGAGAGTAGAATGGAGG - Intronic
1165585134 19:36908490-36908512 AGGAGAAAAGAAAAAGATGGCGG + Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166158983 19:40937537-40937559 AGGAGGAAAGAGACAGATGGAGG + Intergenic
1166167934 19:41005457-41005479 AGGAGGAAAGAGACAGATGGAGG + Intronic
1167720401 19:51175902-51175924 AGGAGACAGTAGAATGATGGAGG - Intergenic
1167728952 19:51238988-51239010 AGGAGAGAGTAGAATGATGGAGG - Intronic
1168053883 19:53850152-53850174 AGAAGTAAAGAGTAGAATGGGGG + Intergenic
1168417074 19:56175948-56175970 AGGAGACAATAGAAGGGAGGGGG - Intergenic
925217561 2:2110587-2110609 AGGAGGAAATAGAGGGAGGGAGG - Intronic
926266882 2:11331005-11331027 AGGAGCAGAAAGAAGGAGGGAGG + Intronic
927439096 2:23097680-23097702 GGGAGTAAAGAGAAGCATTGGGG - Intergenic
927493931 2:23539955-23539977 AGGATTACAGAGGAGGATGGAGG - Intronic
928269297 2:29841990-29842012 AGGAGTGAAGAGGAGGATGGAGG - Intronic
930366500 2:50446354-50446376 AGGAGTGAAAAGAGGGAGGGAGG - Intronic
930654359 2:53993328-53993350 AGGAGTGAAATGAAGGAAGGAGG + Intronic
930675650 2:54197718-54197740 AGGAATAAGTAGAAGGCTAGTGG + Intronic
931140709 2:59454630-59454652 AGGAGGAGATAGAAGGAAGCTGG + Intergenic
931307240 2:61041650-61041672 AGCAGTGAATGGAAGGAGGGAGG + Intronic
932208153 2:69902248-69902270 AGGAGAAGAAAGAAGGAAGGAGG - Intronic
933521247 2:83377202-83377224 AGGAGTTAAGGGAAGGAAGGAGG - Intergenic
935038879 2:99406317-99406339 AGGAGCACAAAGAAGGTTGGTGG - Exonic
935253056 2:101282555-101282577 AGCAGCAAATGGAAGGAGGGAGG - Intronic
935305889 2:101735957-101735979 ATCAGTAAATAGAAGGCTGTAGG - Intronic
935514104 2:104013425-104013447 AGGAGGTAATAGAATCATGGGGG - Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937451832 2:122008603-122008625 AGTATTAAATAAAAAGATGGGGG + Intergenic
937814065 2:126231673-126231695 AGGAGGAAAGAGAAGGAAGAGGG - Intergenic
938196026 2:129329199-129329221 AGGAGCAAAGAGTAGAATGGTGG + Intergenic
939361424 2:141177180-141177202 AGGAGTCACAAGAAGGAAGGAGG + Intronic
939472883 2:142647059-142647081 AGGATTAAAAAGAAAGATGTGGG + Intergenic
939875025 2:147568215-147568237 ATGAGTATATGGAGGGATGGAGG + Intergenic
939978334 2:148747297-148747319 AGGAGTAAAAGGTAGTATGGAGG - Intronic
940224016 2:151382998-151383020 AGTAGTACAGAGAAGGGTGGAGG - Intergenic
940258011 2:151752422-151752444 AGGAGTATTTAGAAGGATGAGGG - Intergenic
941143230 2:161811429-161811451 AGGAGAAAATGGAAAAATGGAGG - Intronic
941275628 2:163487099-163487121 AGCAGTAAACAGAAAGATGTGGG - Intergenic
941276826 2:163499943-163499965 AGGATCAAATAGAGGGATGGAGG + Intergenic
941797424 2:169615497-169615519 AGAAGTACAGAGAAGAATGGTGG - Intronic
942128038 2:172847070-172847092 AGGAGCAAATATAAGAATTGGGG + Intronic
942193562 2:173495007-173495029 AGGAGGAAATAGAAGTCTAGGGG + Intergenic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
942824315 2:180155705-180155727 AGGTGTAAATATCAGAATGGAGG - Intergenic
943659903 2:190548070-190548092 TGGAGCAAATAGAAGGAAAGAGG + Intergenic
943821113 2:192322172-192322194 AAGAGAAAATAGAAGCATGAAGG - Intergenic
944343449 2:198631755-198631777 AACAGTAAATCGATGGATGGTGG - Intergenic
944428880 2:199612026-199612048 AAGAGGAAATAACAGGATGGGGG - Intergenic
944542874 2:200770220-200770242 AGGAAGAAAAAGAGGGATGGAGG - Intergenic
945089846 2:206168536-206168558 AGGAGGCAATAGAATCATGGGGG + Intergenic
945768300 2:214007964-214007986 AGGGGTGAAGAGAAGGAGGGAGG - Intronic
947074854 2:226331520-226331542 AGCAGTAAGTAGAAGGGTGGGGG + Intergenic
947101594 2:226627018-226627040 AGGAGGTAATAGAACCATGGGGG + Intergenic
947513915 2:230784592-230784614 AGGAGGGAAAATAAGGATGGTGG + Intronic
947760956 2:232603460-232603482 AGGAGGAAAGAGGAGGAAGGAGG + Intergenic
947912862 2:233812927-233812949 AGGAGTTTAAAGCAGGATGGTGG + Intronic
948016883 2:234698387-234698409 AGGAGTTAATTGAATCATGGGGG - Intergenic
948554465 2:238797839-238797861 AGGAGTAAACAGATGGGTAGCGG - Intergenic
948735062 2:239998229-239998251 AGGAGGAAAGTGAAGGAGGGAGG - Intronic
1168764163 20:370675-370697 AGGAATGAATAGATGGGTGGAGG + Intronic
1168866162 20:1088725-1088747 AGGAATAAATACCAGGATGTGGG - Intergenic
1169241610 20:3986229-3986251 AGGAGGAAAAGGAAGGAAGGAGG - Intronic
1171227085 20:23451028-23451050 ATGGGTAAATGGATGGATGGGGG - Intronic
1171486390 20:25489460-25489482 GGGAGTAAGGAGAAGGAGGGGGG - Intronic
1171563487 20:26153466-26153488 ATGAGTAAATAGAAGAATCGAGG - Intergenic
1171782697 20:29435476-29435498 AGAAGTAGACAGTAGGATGGTGG + Intergenic
1172203989 20:33148968-33148990 ATGAGTAGGTAGATGGATGGAGG + Intergenic
1172896830 20:38305901-38305923 AGGAGTAAGTAGTAAGATGAGGG - Intronic
1173069535 20:39749182-39749204 AAGAGAAAATAGAAAGATGAAGG - Intergenic
1174102154 20:48136010-48136032 AGGTGTAAAGAGAAGTATGTTGG - Intergenic
1174349397 20:49956221-49956243 TTGAGCAATTAGAAGGATGGTGG - Intergenic
1174440222 20:50545655-50545677 AGAAGCAAAAAGAAAGATGGAGG + Intronic
1174547174 20:51334303-51334325 AGGAGGGAAGAGAAGGAAGGAGG + Intergenic
1174852818 20:54012231-54012253 AGGAGGTAAGAAAAGGATGGGGG + Intronic
1175010968 20:55735625-55735647 AGGAGAAAGAGGAAGGATGGAGG - Intergenic
1175029278 20:55936077-55936099 AGGAGTAGATACAAGTTTGGGGG + Intergenic
1175452163 20:59078634-59078656 AGGAGTAAATGGAAGGTTTGTGG - Intergenic
1175817959 20:61893385-61893407 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818037 20:61893706-61893728 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818051 20:61893757-61893779 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818064 20:61893804-61893826 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175983997 20:62755228-62755250 AGGAGTGAATGGAGGGAAGGAGG - Intronic
1176661927 21:9644908-9644930 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1176804982 21:13472328-13472350 AGGAGTAGAGAGTAGAATGGTGG + Intergenic
1177123317 21:17165161-17165183 AGGCTAAAATAAAAGGATGGAGG + Intergenic
1177281437 21:18987352-18987374 ACGAATAAATTGAAGGGTGGTGG - Intergenic
1177342214 21:19818233-19818255 AGGAGGAAATTGAATGAAGGAGG + Intergenic
1177382458 21:20362481-20362503 AAGAGTAAATAGGAGGATACCGG + Intergenic
1177606260 21:23381422-23381444 AGGAAGAAATAGAATAATGGAGG - Intergenic
1178783361 21:35628231-35628253 TGGAGTAAGTAGAGGCATGGCGG - Intronic
1178840845 21:36136387-36136409 GGGAGTGAAATGAAGGATGGGGG + Intronic
1181785932 22:25227177-25227199 AGCAGAAAATAGAAGGAAGAAGG - Intronic
1181893875 22:26089057-26089079 AGGAAGAAAAAGAGGGATGGAGG + Intergenic
1182155936 22:28072981-28073003 AGGAGAAGATAGAAGGCAGGTGG + Intronic
1182262141 22:29081142-29081164 AACAGTAAAAAGAAGGACGGGGG - Intronic
1182661076 22:31925707-31925729 AGGATTAAGTAGAAGAATTGGGG + Intergenic
1183038122 22:35155596-35155618 AGGAGGCAGTAGAGGGATGGTGG + Intergenic
1184958200 22:47906944-47906966 AATAGAAAATAGAAGAATGGGGG + Intergenic
1185123812 22:48992659-48992681 AGAAGTAGAGAGAAGAATGGTGG + Intergenic
949313627 3:2727871-2727893 AGGGGTTAAAAGAAGGAAGGCGG + Intronic
949649161 3:6135017-6135039 AGAAGTAGAGAGCAGGATGGTGG - Intergenic
950560118 3:13716319-13716341 GGGAGTACATACAAGGATAGAGG - Intergenic
951113268 3:18831115-18831137 AGGAGGTAATTGAATGATGGGGG + Intergenic
951650029 3:24941155-24941177 AGAAAGGAATAGAAGGATGGAGG + Intergenic
951666255 3:25127310-25127332 AGGAGTTGATAGAAGGCTGGTGG - Intergenic
951742695 3:25941827-25941849 AGGAGAAAAGATAAGGAGGGAGG - Intergenic
951940380 3:28071471-28071493 AGGTGTGAATTGAAGAATGGAGG - Intergenic
953900988 3:46843976-46843998 AGGAGGATTTGGAAGGATGGGGG - Intergenic
954725725 3:52607802-52607824 AGAAATAAAGAGAAGGATGGAGG - Intronic
954928283 3:54256878-54256900 AGGATACAATAGAAGTATGGAGG + Intronic
955096588 3:55804773-55804795 AGCAGTGAAAAGAATGATGGTGG - Intronic
955135077 3:56209247-56209269 AGGAGCAAATAGATGGGAGGTGG - Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
957082780 3:75650858-75650880 AGAAGTAGACAGTAGGATGGTGG - Intergenic
957420921 3:79968821-79968843 AGGAGTAAATATAACCAAGGAGG + Intergenic
957566396 3:81889812-81889834 ACTAGTAGATAGAAGTATGGAGG + Intergenic
957735983 3:84203066-84203088 AGGAATAAATAGAACCAAGGAGG + Intergenic
957738538 3:84233207-84233229 AGGAGGAAATTGAATCATGGGGG - Intergenic
958255631 3:91321581-91321603 AGGAATAGATAGAAGCAGGGAGG - Intergenic
958612042 3:96437873-96437895 GGGAGATAATTGAAGGATGGGGG - Intergenic
958751070 3:98193638-98193660 AGGAGTACATAAAAGAATGTTGG - Intronic
959144321 3:102525478-102525500 AGGACTAATGAGAGGGATGGAGG - Intergenic
959705419 3:109334825-109334847 AAGTGTAAATAGAAGTAGGGTGG - Intronic
960644189 3:119860304-119860326 AGGAAGAAATAGAAAGAAGGGGG + Intronic
960651499 3:119956117-119956139 ATTAGTAAATAGAAGGAGGGAGG + Intronic
961185915 3:124914981-124915003 AGGAGCAAAAAGAAGGATGAGGG + Intronic
961963297 3:130875310-130875332 AGAAGTAAATAGTAGAATAGTGG - Intronic
962113495 3:132475511-132475533 AGGAGAAACAAGAAAGATGGTGG + Intronic
962202863 3:133415035-133415057 AGGAGTGAATAGAAGGGAGAGGG - Intronic
962668748 3:137683771-137683793 AGAAGTGAGTAGTAGGATGGTGG + Intergenic
962981140 3:140491177-140491199 GGGAGTAAAGAGAAGGCCGGAGG - Intronic
963091102 3:141484895-141484917 AGGAGGAATGAGAGGGATGGGGG + Intergenic
963579194 3:147102796-147102818 AGGAGCAAAGAGTAGAATGGTGG - Intergenic
964487235 3:157198614-157198636 AGGAGAAAATAGAAAAATGATGG - Intergenic
964914887 3:161828510-161828532 AGGAGTAAATAGAAGACTTGAGG + Intergenic
965107978 3:164382940-164382962 TGGAGTAAAAAGAAAAATGGGGG + Intergenic
965565436 3:170111467-170111489 AGAAGAAAAAAGAAGGGTGGGGG + Intronic
966019516 3:175190646-175190668 AGGAGAAAATAAAAAGATGTGGG + Intronic
967226915 3:187300935-187300957 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
967356021 3:188572663-188572685 AGGATTAAATTGAATGATAGGGG + Intronic
969122809 4:4922346-4922368 AGAAGGAAATAGAAGGAAGAGGG - Intergenic
969424817 4:7118045-7118067 AGGAATGGATAGATGGATGGTGG + Intergenic
969637635 4:8378507-8378529 GGGAGTAAAAAGATGGGTGGTGG - Intronic
970324079 4:14904941-14904963 AGGAGGAAGTAGAAGGAAGCAGG - Intergenic
970492537 4:16589369-16589391 TGTAGAAAATAGAAGCATGGTGG + Intronic
970789077 4:19835229-19835251 TGGAGTTAATAGAATCATGGGGG + Intergenic
970874711 4:20856029-20856051 AGGAGAAAATTGAAGGATTTTGG - Intronic
971192607 4:24441675-24441697 AGGAAGAAACAGAAGGAAGGAGG + Intergenic
971534666 4:27734294-27734316 AAGAGTAACTATAAAGATGGTGG + Intergenic
972361399 4:38328707-38328729 GGGAGGAAAAAGAAGGAGGGAGG - Intergenic
972469503 4:39390162-39390184 CTGAGCAAATGGAAGGATGGAGG - Intergenic
973714486 4:53661755-53661777 AGGAGTAAATGGAAATGTGGAGG + Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976460041 4:85300625-85300647 AGAAGTAGAAAGTAGGATGGTGG - Intergenic
977046301 4:92072297-92072319 AGGAGAAAACAGAAAGATGTGGG - Intergenic
977737244 4:100431778-100431800 AGAAATAGATAGAGGGATGGGGG - Intronic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978040796 4:104058790-104058812 ATGGGTAAATATAAGGGTGGTGG + Intergenic
978132139 4:105211723-105211745 AGGAGTAAATGGAGGCATAGAGG + Intronic
978481362 4:109194533-109194555 TGGAGTATATAGAAGGAGTGAGG + Intronic
978695707 4:111575480-111575502 AGGAATTAATAGATGGATAGAGG - Intergenic
981145688 4:141321582-141321604 AGGAGAAAATTGAATCATGGGGG - Intergenic
982374102 4:154669298-154669320 AGGAATAAATATATGGATAGAGG - Intronic
982478835 4:155884210-155884232 AGCTGTAAACAGAAAGATGGTGG + Intronic
982822568 4:159961332-159961354 AGAAGTAAAGAGAAGAATAGTGG - Intergenic
983531022 4:168809940-168809962 AAGTGTTAATAGAAGGAGGGTGG + Intronic
983736730 4:171071133-171071155 AGAAGAAAATAGAAAGATGACGG - Intergenic
985032225 4:185800701-185800723 ATTAGGAAATAAAAGGATGGAGG - Intronic
985346625 4:189012168-189012190 GGGAGAAAATATAAGGGTGGCGG + Intergenic
985413468 4:189711638-189711660 AGGAGTGAAGAGCAGGAAGGTGG - Intergenic
986494064 5:8323788-8323810 GGGAGGAAGTAGAAGGAAGGGGG + Intergenic
987167946 5:15220446-15220468 AGGAGTAAATACAAGGAGATGGG + Intergenic
987770297 5:22293800-22293822 AGAAGTAGAGAGTAGGATGGTGG + Intronic
987788175 5:22528824-22528846 ATTAGTAAAGAGAAGGCTGGTGG - Intronic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988452008 5:31352675-31352697 AGGAGTAGAGGGAAGGAAGGAGG - Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988799107 5:34679698-34679720 AGCAGTAATGAGAAGGAAGGGGG + Intronic
989494620 5:42098064-42098086 AGCAGTAAAAAGAAGGAAGTTGG - Intergenic
989756216 5:44958768-44958790 AGGAGGAAGGAGAAGGAAGGAGG - Intergenic
990287638 5:54315688-54315710 AAGAGTTAATAGATAGATGGAGG + Intergenic
990642515 5:57803619-57803641 AGGAATACATAGAAGAAAGGAGG - Intergenic
990820370 5:59832961-59832983 AGGATGAAATGGAGGGATGGGGG + Intronic
990951833 5:61305961-61305983 ATGAGAAAACAGAGGGATGGGGG - Intergenic
990980024 5:61593910-61593932 AGGTGGGTATAGAAGGATGGTGG - Intergenic
991515564 5:67431348-67431370 AGTAGTAAATAGAAAAATTGGGG + Intergenic
991518803 5:67470758-67470780 AGAAGTAGAGAGTAGGATGGTGG - Intergenic
991615165 5:68489461-68489483 AGGAGGAGATAGAAGGAGGAAGG + Intergenic
992034967 5:72764169-72764191 AGGAGGGAAAAGGAGGATGGAGG - Intergenic
992837579 5:80655276-80655298 AGGAAAAAAAAAAAGGATGGAGG - Intronic
994428938 5:99630717-99630739 AGGAGGTAATTGAATGATGGGGG - Intergenic
995077234 5:108000309-108000331 AGGTGAAAATAGAAAGATGTGGG + Intronic
995142843 5:108752220-108752242 AGGAGTAAAAAAAGGGAAGGAGG - Intronic
995485740 5:112638303-112638325 AGGGGTACACAGAAGGATGGAGG + Intergenic
995877574 5:116806665-116806687 AGGAGTACAGAGAAGAGTGGTGG - Intergenic
996008053 5:118447330-118447352 ATGAGTAAATACAAGAATGAGGG + Intergenic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996572235 5:124944808-124944830 AGTAGTAAATAAAGGGATTGTGG - Intergenic
996714921 5:126579400-126579422 GGGAGTAAACGGTAGGATGGTGG - Intronic
997353778 5:133249215-133249237 AGCAGAAAATAGATGAATGGTGG - Intronic
997654474 5:135545040-135545062 AGGAGTAAAGAGAAGACAGGAGG + Intergenic
998753829 5:145353724-145353746 GGGAGTAAATTGAATCATGGAGG - Intergenic
998955049 5:147430193-147430215 GGAAGAAAAAAGAAGGATGGGGG + Intronic
999442699 5:151614976-151614998 AGGAGTCAAGAGAAGGCAGGTGG - Intergenic
999625382 5:153515436-153515458 AGAAGTAAAGAGTAGAATGGTGG + Intronic
999639278 5:153655356-153655378 ATGAGTTAATAGATGGATGGTGG - Intronic
999824600 5:155262093-155262115 AGGACTAGATAGAAGAAAGGAGG + Intergenic
1001365312 5:171132280-171132302 AGGAGAGAAAAGAAGGAAGGAGG + Intronic
1002682295 5:180976168-180976190 AGGAGGAAACACAAGGAAGGTGG - Intergenic
1003466140 6:6381948-6381970 AGGAGATAAAAGAAGGAAGGAGG + Intergenic
1004132488 6:12933835-12933857 AGGAGCTAAGAGAAGGAGGGTGG + Intronic
1004558973 6:16728905-16728927 AGGAATAAATAGAAGGAGAATGG - Intronic
1004918182 6:20351876-20351898 AGGAGCAAATAGGATGATGTTGG + Intergenic
1006381219 6:33698471-33698493 AGGATTAAAGAAAAGCATGGAGG + Intronic
1007855714 6:44854295-44854317 AAGAGTCCATAGAAGGATGATGG - Intronic
1008029079 6:46672795-46672817 AGGAGAGAATACAGGGATGGAGG + Intronic
1008067835 6:47069401-47069423 AGGAGGAAAAAAGAGGATGGCGG - Intergenic
1008999716 6:57699585-57699607 AGGAATAGATAGAAGCAGGGAGG + Intergenic
1009188198 6:60599007-60599029 AGGAATAGATAGAAGCAGGGAGG + Intergenic
1009750133 6:67871411-67871433 AGGAGGTGATAGAAGGGTGGGGG - Intergenic
1009750380 6:67872950-67872972 AGGAGGTGATAGAAGGGTGGGGG + Intergenic
1010081064 6:71863224-71863246 AAAAGTAAAGAGTAGGATGGTGG - Intergenic
1011368524 6:86607039-86607061 AGAAGCAGAGAGAAGGATGGTGG + Intergenic
1011390601 6:86848414-86848436 AAGAAGAAATAGAAGGTTGGAGG - Intergenic
1011633721 6:89352147-89352169 AGAAGTAAATAGAAGTCCGGTGG + Intronic
1012729131 6:102858064-102858086 AATAGTACAAAGAAGGATGGAGG - Intergenic
1012733329 6:102909113-102909135 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
1013438735 6:110139616-110139638 AGGAGAAAATATAAGACTGGAGG - Intronic
1013575358 6:111478927-111478949 AGGAGTAAATAGAAGAGTGTGGG - Intronic
1013604551 6:111735636-111735658 GGGAGAAAAGAGAAGCATGGGGG + Intronic
1013616626 6:111849543-111849565 AGGAGTGGCTAGGAGGATGGTGG + Intronic
1014017783 6:116553479-116553501 AGCAGCACATAGAAAGATGGAGG + Intronic
1014283466 6:119467288-119467310 GGGAGTAAATTGAACCATGGGGG - Intergenic
1014762901 6:125377528-125377550 AGGAATAAATAGAAGAATATGGG + Intergenic
1014841649 6:126226857-126226879 AGGAGGTAATAGAATCATGGGGG + Intergenic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1015787429 6:136932232-136932254 AGGGGTAAACTGAAGTATGGAGG + Intergenic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1016105809 6:140160515-140160537 AGGATTAAAAAGAAGGGGGGGGG + Intergenic
1016317784 6:142808812-142808834 AGGGATAAATGGATGGATGGTGG + Intronic
1016524072 6:144980210-144980232 AGAAGCAAAGAGTAGGATGGTGG - Intergenic
1016533532 6:145085528-145085550 AACAGTAAATAAAATGATGGTGG + Intergenic
1017525086 6:155235345-155235367 AGGAGTGCACAGAAGGCTGGGGG + Intronic
1018270205 6:162069164-162069186 AGGAGGTAATAGAATCATGGGGG + Intronic
1018361010 6:163068063-163068085 TGGAGCAAATGGATGGATGGAGG - Intronic
1018524052 6:164687642-164687664 AGGAAGAAAGAGAAGGATGGAGG - Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1020080034 7:5282229-5282251 GGGAGAAAAGAGGAGGATGGAGG + Intronic
1020476317 7:8599132-8599154 AGGAACAAATAGAAGGCTGTGGG + Intronic
1020983349 7:15099773-15099795 AGGAGAAAAGACAAAGATGGAGG + Intergenic
1021038555 7:15831887-15831909 TGGAGTTAAGAGAGGGATGGAGG - Intergenic
1021189665 7:17605194-17605216 ATCAGTAAAAAAAAGGATGGGGG + Intergenic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1021928278 7:25554113-25554135 ATGAGTCAAGAGGAGGATGGGGG - Intergenic
1023224633 7:37956314-37956336 AGAAGAAAAAAGAAGGATGTAGG + Intronic
1023646603 7:42323668-42323690 AGGAGGAAATATAAAGAGGGAGG - Intergenic
1025198882 7:56949987-56950009 GGGAGAAAAGAGGAGGATGGAGG - Intergenic
1025274230 7:57560829-57560851 ATGAGTAAATAGAAGAATCAAGG + Intergenic
1025673064 7:63626946-63626968 GGGAGAAAAGAGGAGGATGGAGG + Intergenic
1026231539 7:68488435-68488457 AGCAGTAAAGAGGAGGATGTGGG + Intergenic
1026275413 7:68871851-68871873 GTGAGTAGATAGATGGATGGAGG - Intergenic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1027007358 7:74706766-74706788 AGGAGTGCAGAGAAGGAAGGTGG - Intronic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1027401800 7:77816752-77816774 AGAAGTAAAAAGTAGAATGGAGG - Intronic
1028051536 7:86193942-86193964 AGAAGTGAAGAGAAGGAGGGAGG + Intergenic
1028254805 7:88581235-88581257 AGGAAAAAATACAAAGATGGAGG - Intergenic
1028779580 7:94720192-94720214 AGGACTGAATAGATGGCTGGTGG - Intergenic
1029118879 7:98253032-98253054 AGGAGAAAAAAGAAAGATGTCGG + Intronic
1030108362 7:106006190-106006212 AGGAGGAAATGGAATCATGGGGG - Intronic
1030108637 7:106008119-106008141 AGGAGGAAATTGAATCATGGTGG - Intronic
1031538835 7:122968013-122968035 AGAAGCAAATAGTAGGATTGTGG + Intergenic
1032696946 7:134345241-134345263 AGGAGTAAAGAGAATGGTTGGGG + Intergenic
1032885037 7:136128382-136128404 AGGAGTGAATGGAAGGATTCAGG + Intergenic
1033046265 7:137964810-137964832 AGGAGATAATTGAATGATGGAGG + Intronic
1033869862 7:145738775-145738797 AGGAGTAGAGAGCAGAATGGTGG - Intergenic
1034623257 7:152472513-152472535 GGGAGGAAATAGAATCATGGAGG + Intergenic
1034913384 7:155016805-155016827 AGGAGTACAAACAAGGCTGGAGG + Intergenic
1035237325 7:157507130-157507152 AGGAGCAGAGAGTAGGATGGTGG - Intergenic
1035245567 7:157560314-157560336 AGGAGACCATCGAAGGATGGTGG + Intronic
1035951522 8:4027298-4027320 AGGAGTAGAAAGTAGGATGATGG + Intronic
1036744826 8:11399195-11399217 AGGGGTGGACAGAAGGATGGAGG + Intronic
1038437694 8:27547734-27547756 AGAAGTAAAAAGTAGAATGGAGG - Intergenic
1038476937 8:27875206-27875228 AGGAGTGAAGAGAGGGAGGGAGG - Intronic
1038679426 8:29653070-29653092 ATGAGTAAATGGATGGATGATGG - Intergenic
1039410803 8:37353540-37353562 AGGAGGAATTAGAGTGATGGAGG - Intergenic
1039542669 8:38384154-38384176 AGGAAGAAAAAGAAGAATGGAGG - Intergenic
1039977461 8:42379555-42379577 AGGTATAAATATAAGGGTGGAGG + Intergenic
1040484839 8:47860219-47860241 AGGAGCATATAGAGGGATAGTGG + Intronic
1041349615 8:56935398-56935420 AGGAGTACTTAGAGGGCTGGTGG + Intergenic
1042970531 8:74403330-74403352 AGGAGGAAATAGAAGAAGAGGGG + Intronic
1042998253 8:74725281-74725303 AGCAGTATAAAGAAGGATGGAGG + Intronic
1043812413 8:84757616-84757638 AGAATTAAAAAGAGGGATGGAGG + Intronic
1043980803 8:86636771-86636793 AGTAGTAGAGAGTAGGATGGGGG - Intronic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1046125767 8:109905306-109905328 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1047931759 8:129734935-129734957 AGGCTCAAATAGAGGGATGGAGG + Intergenic
1048319323 8:133386118-133386140 GGTAGTAAATAAAAGGATGATGG - Intergenic
1048994102 8:139779809-139779831 AGCAATAATTAGAAGGATGCAGG + Intronic
1049371093 8:142267753-142267775 AGGAGAGATTAGGAGGATGGTGG - Intronic
1049916920 9:326771-326793 AGAAGAGAAAAGAAGGATGGAGG + Intronic
1051066014 9:13103995-13104017 AAGAGAAAATGGAAGGAGGGAGG - Intergenic
1051234827 9:14988596-14988618 AGAAGTAAAGAGTAGGATGGTGG + Intergenic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1051894319 9:21972035-21972057 AGCAGTAAAGAGTAGAATGGTGG - Intronic
1052299734 9:26940551-26940573 AAGAGTTAAAAGATGGATGGTGG + Intronic
1052598880 9:30598905-30598927 ACAAGTAAAGAGTAGGATGGTGG - Intergenic
1052916336 9:33926732-33926754 AGGAGTCAAAACAAGGTTGGGGG + Intronic
1053083638 9:35198640-35198662 AGAAGAAGATAGAAGGATGAGGG + Intronic
1053566410 9:39257342-39257364 AGGAGTAGAGAGTAGCATGGTGG - Intronic
1054130737 9:61361670-61361692 AGGAGTAGAGAGTAGCATGGTGG + Intergenic
1054976225 9:71149067-71149089 AATTGTAAAGAGAAGGATGGCGG + Intronic
1055015275 9:71610262-71610284 AGGAGTAAATAGAAGGAAAACGG + Intergenic
1055442350 9:76348827-76348849 AGAAGTAAAGAGTAGAATGGTGG - Intronic
1055674681 9:78645035-78645057 AGGGTTAAAGAGGAGGATGGGGG - Intergenic
1055742086 9:79401255-79401277 AGGAGTGGATAGAAGGAAGGAGG - Intergenic
1055864697 9:80798649-80798671 AGAAAAAAATAGAAGGATGTGGG + Intergenic
1056301074 9:85242600-85242622 AGGAGTAAATAGCCTGATTGGGG + Intergenic
1056620358 9:88207288-88207310 AGAAGTAAACAGAAGGCTGTGGG + Intergenic
1057690064 9:97276121-97276143 AGGAAGAAATGGAAGGAGGGAGG - Intergenic
1058212249 9:102183762-102183784 AGGAATAAATAGAAAGAGGAGGG - Intergenic
1058246062 9:102626631-102626653 TGGAGTTAATTGAATGATGGGGG - Intergenic
1059673641 9:116515519-116515541 AGGAGCCAATAGATGGTTGGAGG + Intronic
1061234586 9:129335029-129335051 GGGAGTTAATGGCAGGATGGAGG - Intergenic
1061461226 9:130740965-130740987 AGGAGTAAACAGCTGCATGGTGG + Intronic
1062144021 9:134978978-134979000 AGGAGAAAAGAGAGGGAGGGAGG + Intergenic
1062192701 9:135256001-135256023 AAGAGCAAAGAGACGGATGGAGG - Intergenic
1203639488 Un_KI270750v1:146751-146773 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1185497528 X:566566-566588 ATGAGTAGATGGATGGATGGTGG + Intergenic
1185543724 X:925204-925226 ATGAATAGATGGAAGGATGGTGG + Intergenic
1185759845 X:2682038-2682060 AGGAATGGATGGAAGGATGGTGG + Intergenic
1187032804 X:15505219-15505241 AGAAGTAAATAGAAGGAGAAAGG + Intronic
1187264589 X:17719162-17719184 AGGAATAATGAGAAGGAAGGAGG + Intronic
1187938331 X:24357447-24357469 TGAAGCAATTAGAAGGATGGTGG + Intergenic
1188337735 X:28958294-28958316 AGAAGTAGATAGTAGAATGGTGG - Intronic
1188894414 X:35649356-35649378 AGGAGGAAATAGAAAAATGGAGG + Intergenic
1189369123 X:40413907-40413929 AGGAGTAAATGGAACGTTGTGGG - Intergenic
1191058344 X:56267470-56267492 AGGAGTTAATTGAATCATGGTGG - Intronic
1191667954 X:63722623-63722645 AATAGTAAATCCAAGGATGGGGG - Intronic
1192301511 X:69908735-69908757 AGGAGAAATTAGAATGATGAGGG + Intronic
1192593999 X:72387352-72387374 AGGAGGAAAGGGAAAGATGGAGG + Intronic
1193103023 X:77637015-77637037 AGGAGGAAGAAGAAGGAAGGAGG + Intronic
1193521199 X:82530986-82531008 AGGAAAAAATAGAAAGAAGGTGG - Intergenic
1193853780 X:86573136-86573158 AGGAGGAAAGAGAGGGAGGGAGG + Intronic
1194052523 X:89088951-89088973 AGGAGTAAATAGACTGGTGTTGG - Intergenic
1194215667 X:91128140-91128162 AGGAGGTAATAGAATCATGGGGG - Intergenic
1194832259 X:98638127-98638149 AATAGTAAATATAAGGATTGTGG - Intergenic
1196758172 X:119176276-119176298 AGGAGGAAGTAGAAGGGAGGTGG + Intergenic
1196914130 X:120514230-120514252 AGTAGTGGACAGAAGGATGGAGG - Intergenic
1197072387 X:122314539-122314561 AGGAGAAAATGGAATTATGGGGG + Intergenic
1197411836 X:126124959-126124981 AGAAGTAAAGAGAAGGTTTGAGG - Intergenic
1197464465 X:126785564-126785586 AAAAAAAAATAGAAGGATGGTGG + Intergenic
1197727470 X:129785946-129785968 AGGAGGAAATAAATGGAAGGTGG + Intronic
1198728970 X:139707088-139707110 AGATGAAAAAAGAAGGATGGAGG + Intronic
1199007117 X:142713485-142713507 AGAAGTAAAGAGAAGAATAGTGG + Intergenic
1199057138 X:143310062-143310084 AGAAGCAAATAGTAGGATGATGG - Intergenic
1201341104 Y:12935510-12935532 AGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1201852670 Y:18504135-18504157 AGGAGTAAATTTAAGCAAGGAGG - Intergenic
1201880651 Y:18816249-18816271 AGGAGTAAATTTAAGCAAGGAGG + Intronic