ID: 905753542

View in Genome Browser
Species Human (GRCh38)
Location 1:40487221-40487243
Sequence GCTGCTCAAGAATCAACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905753542_905753544 -3 Left 905753542 1:40487221-40487243 CCTACAGTTGATTCTTGAGCAGC 0: 1
1: 0
2: 1
3: 17
4: 137
Right 905753544 1:40487241-40487263 AGCGCAGGTTTGAACTGTGCAGG 0: 2
1: 1
2: 34
3: 139
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905753542 Original CRISPR GCTGCTCAAGAATCAACTGT AGG (reversed) Intronic