ID: 905754045

View in Genome Browser
Species Human (GRCh38)
Location 1:40492556-40492578
Sequence CAGAACAACTTTAAAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 390}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905754045 Original CRISPR CAGAACAACTTTAAAGAACA AGG (reversed) Intronic
901354499 1:8632485-8632507 CAGAAAACCTGTAAAGAAAATGG - Intronic
903598545 1:24516162-24516184 AAGAAACACTTGAAAGAACAGGG + Intronic
904018051 1:27439210-27439232 CACAACAACTTTACAGACAAGGG - Intronic
905754045 1:40492556-40492578 CAGAACAACTTTAAAGAACAAGG - Intronic
906278485 1:44536279-44536301 CAGAACATCTTCTCAGAACAAGG + Intronic
907728461 1:57043017-57043039 CAGAAAAAGTTATAAGAACAGGG + Intronic
907842165 1:58168815-58168837 CATAACATCTTTATAGGACATGG + Intronic
908300250 1:62755649-62755671 CATAACATCTTTATAGGACAGGG + Intergenic
908415870 1:63912783-63912805 CAGTCCAACTCAAAAGAACAGGG - Intronic
908464033 1:64374117-64374139 CAGAACCACTTGAAACCACATGG + Intergenic
908927740 1:69276778-69276800 CAGAACAAATGGAAAGAAAAAGG + Intergenic
909245823 1:73282285-73282307 CAGTACAACGTTTAAAAACATGG + Intergenic
909543773 1:76820446-76820468 CTGAACAAATTTACTGAACATGG - Intergenic
909772933 1:79447438-79447460 AAGAACAACATTAAACATCATGG - Intergenic
910397677 1:86808384-86808406 CATAACATCTTTATAGGACATGG - Intergenic
910487810 1:87734877-87734899 CAGAAAATCTTGAAAAAACAAGG + Intergenic
911129949 1:94377505-94377527 CATAACATCTTTATAGGACAGGG - Intergenic
911673102 1:100629524-100629546 CAGCACTACTTTAAATATCATGG - Intergenic
911845788 1:102748797-102748819 CATAACATCTTTATAGGACAGGG - Intergenic
911991488 1:104703600-104703622 CAGACAAACTTTAAAAAAAAGGG + Intergenic
912021130 1:105110412-105110434 CATAACATCTTTATAGGACAGGG + Intergenic
913377294 1:118166516-118166538 CAGTAAAACTTAAAAGCACAGGG + Intronic
913469330 1:119173608-119173630 CATAACATCTTTATAGGACAGGG + Intergenic
914737633 1:150433291-150433313 CAAAACTACTTTCAAGAACCAGG + Intronic
917138162 1:171807843-171807865 GAGAACAACTTTATAGAATAGGG - Intronic
917227390 1:172799626-172799648 CATAACATCTTTATAGCACAAGG + Intergenic
917280967 1:173377926-173377948 CATAACATCTTTATAGGACATGG + Intergenic
917676104 1:177320930-177320952 CATAACATCTTTATAGGACAGGG + Intergenic
917690201 1:177460882-177460904 CTGAACAACAAGAAAGAACAGGG - Intergenic
917950848 1:180034048-180034070 CAGAACAACGACAGAGAACATGG + Exonic
918595398 1:186287053-186287075 CACAACAACTTTTAAGTAAAAGG - Intergenic
919190635 1:194213316-194213338 CAGAACATCAGTAAAGAAAAAGG - Intergenic
919228198 1:194736727-194736749 ATGAACAAGTTTAAAGAAAAAGG + Intergenic
919407092 1:197199185-197199207 CACAACAACTTTAAAGTAACAGG + Intronic
919601487 1:199628449-199628471 TTGAACAACATTAAAGAACTAGG + Intergenic
920187221 1:204167279-204167301 CAGTTCAACTTTAAAAAAAATGG + Intergenic
921019533 1:211223572-211223594 CATAACATCTTTATAGGACATGG + Intergenic
921157264 1:212448342-212448364 CAGAATTTCTTTAAATAACAAGG + Intergenic
1063197322 10:3755818-3755840 CAGAACCACTTTGAAGATCGGGG - Intergenic
1063321883 10:5058933-5058955 CATAACATCTTTACAGGACAGGG - Intronic
1065208612 10:23381165-23381187 CAGAACAAACTGAAAGACCATGG + Intergenic
1065648147 10:27858413-27858435 GAGGAAAACTGTAAAGAACAGGG - Intronic
1066614735 10:37283243-37283265 CATAACATCTTTATAGGACAGGG - Intronic
1066667440 10:37799324-37799346 CAGAAAAACTATAAACCACAAGG + Intronic
1068489258 10:57701251-57701273 CATAACAACTTTAATCTACAGGG + Intergenic
1068500147 10:57833990-57834012 CATAACATCTTTATAGGACAGGG + Intergenic
1068628872 10:59279103-59279125 CAGTAATACTTTATAGAACACGG - Intronic
1068802214 10:61154333-61154355 AAGTACAACTTGAAAGAACTTGG + Intergenic
1068847723 10:61698409-61698431 CAGAACCGCTTTCAAAAACAGGG - Intronic
1069137497 10:64783504-64783526 CATAACATCTTTATAGGACATGG - Intergenic
1070537259 10:77389106-77389128 TAGATGAACTTTAAAAAACAGGG - Intronic
1071113361 10:82188952-82188974 AAGAATAAAATTAAAGAACATGG + Intronic
1071220985 10:83464189-83464211 CATAACATCTTTATAGGACACGG + Intergenic
1072210841 10:93245803-93245825 CAGAAATAATTTAAAGAACAAGG - Intergenic
1072821402 10:98561403-98561425 CAGAACAATCTTAAAGACTAAGG + Intronic
1073630672 10:105145456-105145478 AAGAACAACTTAAAACACCAGGG - Intronic
1073866615 10:107811982-107812004 TGGAACAACTATAAACAACATGG + Intergenic
1074742793 10:116501028-116501050 CATAACATCTTTATAGGACAGGG - Intergenic
1075146182 10:119884914-119884936 CATAACACCTTTATAGGACAGGG + Intronic
1075389280 10:122080937-122080959 TATAATAACTTTAAAGAAAATGG + Intronic
1079206564 11:18420537-18420559 AAAAACATCTTTCAAGAACAAGG + Intronic
1079731397 11:23940285-23940307 CATAACATCTTTATAGGACAGGG - Intergenic
1079811812 11:25005911-25005933 CATAACATCTTTATAGGACAGGG - Intronic
1081421253 11:42876269-42876291 CATAACATCTTTATAGGACAGGG + Intergenic
1083712854 11:64559556-64559578 CAGGACAACTTTGAGGCACAGGG - Intronic
1084210819 11:67621325-67621347 CATAACATCTTTATAGGACAGGG + Intergenic
1085161488 11:74351327-74351349 CAGAATAACGTTAAAGAATGAGG - Intronic
1086317237 11:85607871-85607893 CATAACATCTTTATAGGACATGG + Intronic
1087478860 11:98673976-98673998 TAGAATAACACTAAAGAACAGGG + Intergenic
1088136828 11:106565583-106565605 TGATACAACTTTAAAGAACAAGG + Intergenic
1088464327 11:110118197-110118219 CATTACAATATTAAAGAACAAGG - Intronic
1088492391 11:110400761-110400783 CATAACATCTTTATAGTACAGGG + Intergenic
1089981140 11:122773497-122773519 AATAAAAACTTTAAAGTACATGG + Intronic
1091514247 12:1162223-1162245 CAGAACTACTTTAAACCATAGGG - Intronic
1091947345 12:4560271-4560293 CTGATAAACTATAAAGAACACGG - Intergenic
1094256634 12:28437051-28437073 TAGAACAACTTTGTAGAAAATGG - Intronic
1094320117 12:29174046-29174068 CATAACATCTTTACAGGACAGGG - Intronic
1094338271 12:29384460-29384482 CATAACATCTTTATAGGACAGGG - Intergenic
1095969837 12:47894128-47894150 CAGAACAGATTTAAACCACAGGG + Intronic
1097129087 12:56796942-56796964 CAAGACAATTTTGAAGAACAAGG + Intergenic
1098381781 12:69877554-69877576 CAGACCAAATTTTAATAACATGG - Intronic
1099364866 12:81756335-81756357 CAGAACAACTTTAAATTCCAAGG + Intronic
1099577026 12:84394314-84394336 CATAACATCTTTATAGGACAGGG - Intergenic
1100049202 12:90425111-90425133 CAGAACAACTTAAATTAAAATGG - Intergenic
1100092019 12:90984106-90984128 CATAACATCTTTATAGGACAGGG + Intronic
1100191673 12:92199611-92199633 CAGAACAGCTAGAAAGAATAAGG - Intergenic
1101465019 12:104939957-104939979 AAGAAAAAATTAAAAGAACAAGG - Intronic
1101704727 12:107211232-107211254 CATAACATCTTTATAGGACATGG + Intergenic
1102827236 12:115959272-115959294 CAAAAAAACTTTAAAAAAAATGG - Exonic
1103515270 12:121503758-121503780 CTGAATTACTTTAAGGAACAAGG - Intronic
1105559342 13:21475978-21476000 CTAAACAACTTTAAAGCATATGG + Intergenic
1105658581 13:22468120-22468142 CAGAACAACTTCAAAGATCAGGG + Intergenic
1105817139 13:24046903-24046925 GAGAACAAGTTTAATAAACAGGG + Intronic
1106335845 13:28782718-28782740 CAGGACAACATTCAAGTACAGGG - Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107111565 13:36703502-36703524 CAAAAAAAACTTAAAGAACACGG + Intergenic
1108029454 13:46213871-46213893 CAGAACTACTGCAAATAACAAGG + Intronic
1109480991 13:62953043-62953065 AAGGCAAACTTTAAAGAACATGG - Intergenic
1109500888 13:63235173-63235195 CATAACATCTTTAAAGGACAGGG + Intergenic
1110291572 13:73813728-73813750 CATAATAAGTTAAAAGAACAGGG + Intronic
1110680560 13:78307126-78307148 TAAAACATCTTTAAAAAACATGG + Intergenic
1111629726 13:90834718-90834740 CAGAACAATAAAAAAGAACAAGG + Intergenic
1112793698 13:103031077-103031099 CTGAAAAGCTTTAAAGACCATGG + Intergenic
1113204073 13:107896008-107896030 CATAACATCTTTATAGGACATGG - Intergenic
1113424757 13:110198827-110198849 CAAATTAACTTCAAAGAACAGGG + Intronic
1113539660 13:111096323-111096345 CAGAAGACCTTTAAGAAACAGGG - Intergenic
1113638710 13:111941792-111941814 CAAAACAACGGAAAAGAACAAGG - Intergenic
1113786983 13:113007094-113007116 TAGAACAACTTAAAAAATCAAGG - Intronic
1114566579 14:23637557-23637579 CATAACATCTTTATAGGACACGG + Intronic
1115178430 14:30592899-30592921 GAGTACAACTTTAAACATCAAGG + Intronic
1115202264 14:30867682-30867704 TAGAACATGTATAAAGAACATGG + Intergenic
1115285616 14:31710642-31710664 CATAACATCTTTATAGGACACGG - Intronic
1115438889 14:33409109-33409131 CAGAATAAATTTCAAGAATAGGG + Intronic
1115639109 14:35320772-35320794 TAGAACAACCTGGAAGAACAAGG - Intergenic
1115922519 14:38392141-38392163 CAGAAAAACATTAAAGTGCATGG + Intergenic
1116246747 14:42425101-42425123 GAGAAGAACTATAAAGAAAAGGG - Intergenic
1116597885 14:46875808-46875830 CAGAACAAATGTAAAGATAAAGG + Intronic
1117875527 14:60247965-60247987 CAGAACATCTTTTAAAAATACGG + Intronic
1118424734 14:65648230-65648252 CAGAACAACTTTACTGACCCTGG + Intronic
1118433676 14:65748933-65748955 CAGGTAAAGTTTAAAGAACAAGG + Intergenic
1118684197 14:68274791-68274813 CAGAACAAGTTAAAAGGACGTGG - Intronic
1119624518 14:76160756-76160778 CAGTAAATTTTTAAAGAACATGG - Intronic
1120198646 14:81514382-81514404 CATAACATCTTTATAGGACATGG + Intronic
1120378754 14:83746165-83746187 GAGAATAAATTTAAAAAACATGG - Intergenic
1120408907 14:84125738-84125760 TAGAATAACTTGAGAGAACAAGG - Intergenic
1120940248 14:89941277-89941299 CCTAACAACTATAGAGAACATGG + Intronic
1122039814 14:98978640-98978662 CAAAACAACTTTTAAAAAGAAGG + Intergenic
1123819050 15:24008346-24008368 CTGAAATATTTTAAAGAACAAGG - Intergenic
1123991412 15:25686254-25686276 CAGAAAAACAATTAAGAACATGG + Intronic
1126545152 15:49865209-49865231 CATAACAGCCTTAAAGAACAGGG + Intronic
1130658766 15:85813310-85813332 CTGAACCACTTTAAATAACATGG - Intergenic
1131411031 15:92208511-92208533 CATAACATCTTTATAGGACAGGG + Intergenic
1131627639 15:94139344-94139366 CAGAAAAACATTAAACAACTAGG + Intergenic
1131849059 15:96518319-96518341 CAAAAAAAACTTAAAGAACAAGG - Intergenic
1132492418 16:239902-239924 CAGAACCACTTTAAAGATCATGG - Intronic
1133066251 16:3209370-3209392 CACAACACCTTTAAAGTCCAAGG + Intergenic
1136989708 16:35144576-35144598 CAGACCAACATCAAAGAAGATGG + Intergenic
1137022820 16:35446781-35446803 CAGAGTAACTTTAAAAAACAAGG + Intergenic
1137498275 16:48988384-48988406 TAGAATAACTTTAAAAAAAAAGG - Intergenic
1137656429 16:50163288-50163310 GTGAATAACTTCAAAGAACAAGG - Intronic
1138403846 16:56772190-56772212 CAGAAAAAGGATAAAGAACATGG + Intronic
1139748012 16:69089946-69089968 CACAACAATCTTGAAGAACAGGG + Intergenic
1140470896 16:75213745-75213767 CAGAACAAGGATAAAGAACCCGG - Intergenic
1142575753 17:906348-906370 AAAAAAAACTTTAAAAAACATGG - Intronic
1142832286 17:2558144-2558166 CAGAAAAACTCCAAATAACAGGG - Intergenic
1146253625 17:31374396-31374418 CAGAACAACTGCAAAGAAAGTGG + Exonic
1147387465 17:40090781-40090803 CAAAAGAGCTTTAAAGAAAAAGG - Intronic
1148927120 17:51097104-51097126 CATAAAAACTCAAAAGAACAAGG + Intronic
1149416325 17:56463760-56463782 CTTAACAAATGTAAAGAACACGG - Intronic
1150760952 17:67961114-67961136 CAGAATTTCTTTAAATAACAAGG + Intronic
1151567848 17:74909725-74909747 CATAACATCTTTATAGGACATGG + Intergenic
1152281619 17:79388273-79388295 CAGAAGAGCTTGAGAGAACAAGG + Intronic
1153200233 18:2640170-2640192 AAGAAAAACTTAAAAGAATAGGG + Intergenic
1154016928 18:10627117-10627139 AAGATCATCTTTAAACAACACGG + Intergenic
1156279531 18:35622010-35622032 CATTACAATTTTAAACAACAAGG - Intronic
1157212835 18:45758783-45758805 CAGAAACACTTTAAAGATCTTGG - Intergenic
1158694697 18:59693493-59693515 AAGAACCACTTTGAAGAACATGG + Intronic
1159338652 18:67104644-67104666 CAGAACAAAAGTTAAGAACATGG + Intergenic
1160450290 18:78958441-78958463 CAGAAAAAGTTTAAACAACCTGG + Intergenic
1161598379 19:5164560-5164582 CATAACATCTTTATAGAACAAGG - Intronic
1164993128 19:32698884-32698906 CATAACATCTTTATAGGACATGG - Intronic
1165846940 19:38824173-38824195 CATAACATCTTTATAGGACAGGG + Intronic
1166248912 19:41552050-41552072 CAGACCAACTGTAAATTACAAGG + Intronic
1166415636 19:42593223-42593245 GAGAAAAACTCTAAAGAACTGGG - Intronic
1167119784 19:47509900-47509922 GAGAACACCTTTTAAGAAAAAGG - Intronic
1167850358 19:52196637-52196659 TAGAAAAACTCTAAATAACAGGG + Intronic
925950073 2:8901497-8901519 CATAACATCTTTATAGTACATGG - Intronic
926414804 2:12638944-12638966 CTTAACAACTGTAAAGAAGAAGG + Intergenic
927772093 2:25871784-25871806 CAGGAGAACTTTAAATAATATGG + Intronic
928180963 2:29068055-29068077 CAGAAGAGCTTGAGAGAACAGGG - Intronic
928248427 2:29652727-29652749 CATAAAAACTCCAAAGAACAGGG + Intronic
929125285 2:38517965-38517987 CAGAAAAAGTTTAAAGCTCAAGG - Intergenic
929415312 2:41741319-41741341 CAGAAAAACATTGAAGAACCTGG + Intergenic
930835066 2:55784181-55784203 AACAGCAACTTTAAAGAAGATGG - Intergenic
931540315 2:63323613-63323635 CATAACATCTTTATAGGACATGG + Intronic
931979633 2:67680560-67680582 CAGAACAAATTCAGAAAACATGG + Intergenic
933295783 2:80489549-80489571 CAGAACACCCTTATATAACATGG - Intronic
933341991 2:81036558-81036580 CATAACATCTTTATAGGACAGGG + Intergenic
936663060 2:114563720-114563742 CAAACCAACTTTAAAAAAAATGG - Intronic
936772334 2:115929358-115929380 CAACACAACTCTAAATAACATGG - Intergenic
937064990 2:119011137-119011159 TAGTACAACCTTAATGAACACGG + Intergenic
937398285 2:121558179-121558201 CAGAATAACTTCAAAGAATAAGG + Intronic
937965672 2:127506945-127506967 TAGCTCAACTTTAAATAACATGG + Intronic
938364984 2:130727435-130727457 CAGAGCATCTGTAAAGTACAAGG + Intergenic
938806351 2:134810111-134810133 CATAACATCTTTATAGGACAGGG - Intergenic
939299701 2:140319725-140319747 CAGAACAGCTTTTGAGAACGTGG + Intronic
939466996 2:142569959-142569981 CAGACTCACTTTAAATAACAAGG - Intergenic
941310235 2:163919446-163919468 CAGAACATCGTTGAAGAAAAGGG + Intergenic
941761052 2:169243955-169243977 CAGAACAATTCTAAAAACCAGGG + Intronic
943107570 2:183565690-183565712 CATAGAAACTTTAAATAACAAGG + Intergenic
943133588 2:183886803-183886825 CATAACATCTTTATAGGACAGGG + Intergenic
943640307 2:190350529-190350551 CAGAACAGCATTTGAGAACAAGG + Intronic
943831605 2:192471258-192471280 CAGTTCAACTTTTAACAACATGG + Intergenic
944198608 2:197081671-197081693 CAGAAGAACTTGAAAGAGCCAGG - Intronic
944385005 2:199154381-199154403 CAGCACAACTTTATAAGACAGGG - Intergenic
944728804 2:202498115-202498137 CATAACATCTTTATAGGACAGGG + Intronic
945005642 2:205402666-205402688 CAGCTCAGCTTTTAAGAACAAGG - Intronic
946207526 2:218120648-218120670 CATAACATCTTTATAGGACACGG - Intergenic
946771713 2:223095690-223095712 CCGAAGAACTTCAAAGAAGATGG + Intronic
1169345758 20:4826997-4827019 CAGCACAGGTTTACAGAACAAGG + Intergenic
1169647781 20:7833249-7833271 CATAACATCTTTATAGGACAGGG - Intergenic
1171270478 20:23813113-23813135 CATAACATCTTTATAGGACAGGG + Intergenic
1173033532 20:39385770-39385792 CAAAACAATTTTGAAGAATAAGG - Intergenic
1173689791 20:44951766-44951788 CAGGACTACTCTAAAGAAAATGG + Intronic
1173766397 20:45614142-45614164 CTGAACACCTTTAAAGGGCAAGG - Intronic
1174222560 20:48968776-48968798 CATACCAACTCTGAAGAACAAGG + Intronic
1174666269 20:52260788-52260810 CAGAGGAAGTTTAGAGAACAGGG - Intergenic
1177876580 21:26639656-26639678 AAAAACAACATTAAAGAGCATGG - Intergenic
1177945642 21:27466163-27466185 CAGAACAATTTTAAAGGACTGGG - Intergenic
1182832758 22:33316902-33316924 CATAACAATTTCAAATAACATGG + Intronic
1183014982 22:34978651-34978673 CAGAACAGATTTAGAGAAGAGGG - Intergenic
1183307985 22:37093260-37093282 CAGAACAACTGCCAGGAACATGG + Intronic
949492779 3:4605312-4605334 GAGAACAGCTATAAAAAACATGG + Intronic
950666832 3:14501975-14501997 CAGAAGAAGTATAAAGAAAATGG + Intronic
951650005 3:24940962-24940984 CTAAAGAACTTTTAAGAACAGGG + Intergenic
952555219 3:34523014-34523036 CATAACACCTTTATAGGACAGGG - Intergenic
954051314 3:47980560-47980582 GAGAACAATCTAAAAGAACAAGG + Intronic
955293587 3:57715183-57715205 CATAAAAACCCTAAAGAACAAGG + Intergenic
956131507 3:66057835-66057857 CAAAACAACTTAAAAGAAGATGG - Intergenic
958549389 3:95594200-95594222 CATAACATCTTTATAGGACAGGG - Intergenic
958778665 3:98515236-98515258 CAAAACTACTTTTGAGAACATGG + Intronic
960063509 3:113347816-113347838 CATAACATCTTTATAGGACAGGG + Intronic
961678417 3:128582601-128582623 GGGATCAACTGTAAAGAACATGG + Intergenic
961999911 3:131285148-131285170 AAGAGCATTTTTAAAGAACAGGG - Intronic
962032389 3:131614819-131614841 AAGAACAAGTATTAAGAACAAGG - Intronic
962927712 3:140010871-140010893 TAAAACAACTTTAAACAAGAAGG + Intronic
963423646 3:145094950-145094972 CAGAATAACATTAAAGAACTAGG - Intergenic
963696564 3:148572140-148572162 CATAACATCTTTATAGGACAGGG + Intergenic
963992458 3:151669586-151669608 CATAACATCTTTATAGGACAGGG - Intergenic
964064328 3:152561187-152561209 CATAACATCTTTATAGGACAGGG + Intergenic
964701089 3:159567761-159567783 CAAGACAATTTTGAAGAACAGGG - Intronic
964931059 3:162023647-162023669 CAGAACAACATTAATAAATAAGG - Intergenic
964972076 3:162575817-162575839 CATAACATCTTTATAGGACAGGG + Intergenic
965155220 3:165043116-165043138 CAGAAGAACTTTGCAGAAGATGG - Exonic
965970493 3:174549178-174549200 CAATGCAACTTTAAAGAAAATGG + Intronic
965984155 3:174731516-174731538 TAGAATATCTTTAAAGAAAATGG + Intronic
966166721 3:177027607-177027629 CAGATCTACTTAAAAGCACATGG + Intronic
967010386 3:185427498-185427520 AAGAACAAGTTTAAAGAGCTAGG + Intronic
967122574 3:186396265-186396287 CGAAATAAATTTAAAGAACAAGG - Intergenic
968825983 4:2897507-2897529 CAGAAAAACTTTAGAGCACTTGG + Intronic
968877018 4:3275959-3275981 AAGAACATCTTTAAAGAACTAGG - Intergenic
968974946 4:3817184-3817206 CATGACAACATTTAAGAACAGGG - Intergenic
969401309 4:6957460-6957482 CAAAACACCTTTACAGAGCAAGG - Intronic
970046040 4:11855598-11855620 AATAACAACCTCAAAGAACATGG + Intergenic
970290356 4:14564692-14564714 CAGACCAAGATTCAAGAACACGG - Intergenic
970393336 4:15639228-15639250 CAAAACAATTTTAAAGCATAAGG + Intronic
971281372 4:25244939-25244961 CATAACATCTTTATAGGACAGGG - Intronic
972026801 4:34389534-34389556 AATAACAACTTTGAAGTACATGG + Intergenic
972427241 4:38944928-38944950 CTTAAAAACTTTGAAGAACAAGG + Exonic
973045693 4:45532746-45532768 CATAACATCTTTATAGGACATGG + Intergenic
974526385 4:63054226-63054248 CATAACATCTTTATAGGACATGG + Intergenic
974679266 4:65139909-65139931 CAGAAGAAGTTTATAGAATAAGG + Intergenic
974971088 4:68828471-68828493 CAAAACACCTTTAAAGAAGATGG + Intronic
974984654 4:69007245-69007267 CAAAATACCTTTAAAGAAGATGG - Intronic
976174499 4:82337736-82337758 CATAACATCTTTATAGGACAGGG - Intergenic
976835458 4:89367951-89367973 CATAAGAAATTTAAATAACAAGG - Intergenic
976886498 4:89991241-89991263 CAAAAGGATTTTAAAGAACATGG - Intergenic
977544069 4:98354379-98354401 AAGAACAACTAAAATGAACAAGG - Intronic
977649808 4:99456428-99456450 CAGAAATACTTTAAATAAAATGG + Intergenic
977979951 4:103309647-103309669 CAGCAAAACTTTAAAGGAAATGG + Intergenic
977997851 4:103516482-103516504 TAGAACATTTATAAAGAACATGG + Intergenic
978737553 4:112101057-112101079 CATAAAAACTTTGAAGAATATGG + Intergenic
978850942 4:113335697-113335719 CAGGACAATTTTAAAAAGCAAGG - Intronic
980174233 4:129325319-129325341 GAGAACAACCTTAAAGAGGAAGG - Intergenic
980541572 4:134202075-134202097 CTGCAGAACTTTATAGAACAAGG - Intergenic
980842858 4:138287323-138287345 CAGAACTTTTTTAAAAAACATGG - Intergenic
982700944 4:158659276-158659298 CATAACATCTTTATAGGACACGG + Intergenic
982884801 4:160765175-160765197 AAGAACATGTTAAAAGAACATGG - Intergenic
983015851 4:162610485-162610507 AACAACAACATAAAAGAACAAGG + Intergenic
983761338 4:171410120-171410142 CATAGCCATTTTAAAGAACAAGG + Intergenic
983835108 4:172375872-172375894 CATAACATCTTTATAGGACACGG - Intronic
983974469 4:173916005-173916027 TTGAACAACTTTTAATAACAAGG + Intergenic
984047946 4:174825561-174825583 CAGAACAACTTCCAAAAGCAGGG - Intronic
984560293 4:181260320-181260342 CAGCACAGTTTTAAAGAACATGG + Intergenic
984658240 4:182343423-182343445 TAGAACTACTGCAAAGAACATGG + Intronic
984917283 4:184735907-184735929 CATAACATCTTTATAGGACAGGG + Intergenic
985396116 4:189546055-189546077 CACAACAATCTTAAAGAACAAGG + Intergenic
985944944 5:3173532-3173554 CAGATAAACTTGAAAAAACATGG - Intergenic
987210210 5:15673801-15673823 CAACACAGCTTTAAAGAACAGGG + Intronic
987217894 5:15757564-15757586 CACAACAACTTGAAAGCACCTGG - Intronic
987771315 5:22309209-22309231 CACAACAACCTTAGAGAAGAAGG - Intronic
988679019 5:33465530-33465552 TATAACTACTTTAAAGAATAAGG - Intronic
989957167 5:50371634-50371656 CATAACATCTTTATAGGACAGGG + Intergenic
989975253 5:50578179-50578201 CAGTTCAACTTTAGAGAAAATGG + Intergenic
990801786 5:59612489-59612511 AAGAACAACTCTAAAGGCCAGGG + Intronic
991641516 5:68758939-68758961 AAGAACTCCTTTAGAGAACAGGG - Intergenic
991913105 5:71581073-71581095 CAGAGAAAATTTAAAGTACATGG - Intergenic
992049173 5:72927613-72927635 CATAACATCTTTATAGGACATGG + Intergenic
992241081 5:74770434-74770456 CAGAACAAGTTTATATATCATGG - Intronic
992545583 5:77811323-77811345 CATAACATCTTTATAGGACAGGG + Intronic
992632071 5:78691196-78691218 AAGAACAAATAGAAAGAACAAGG + Intronic
993898123 5:93562904-93562926 CAGAAAAATCTTAAAGAACTGGG + Intergenic
993921328 5:93807649-93807671 GAGATCATCTTTAAAGAAAATGG + Intronic
994231909 5:97316879-97316901 CATAACATCTTTATAGGACAGGG - Intergenic
994425056 5:99575165-99575187 CAGAATAACTTTAAAACAAATGG - Intergenic
994436282 5:99737080-99737102 CAGAATAACTTTAAAACAAATGG + Intergenic
995280190 5:110326164-110326186 TAGAACAACATAAATGAACATGG - Intronic
995706187 5:114991290-114991312 CATAACACCTTTATAGGACATGG + Intergenic
996099420 5:119431551-119431573 CATAACATCTTTATAGGACAGGG - Intergenic
996188338 5:120507737-120507759 CAGACCAACCTTAAAAAAAATGG - Intronic
996348828 5:122516119-122516141 CACAACATTTTCAAAGAACAAGG + Intergenic
998111281 5:139504638-139504660 CATAGCATCTTTATAGAACAGGG + Intergenic
999323435 5:150628519-150628541 CAGAACAACAGTATACAACAGGG - Intronic
999955743 5:156699774-156699796 CAGAGCTACTCTAAAGAACAGGG - Intronic
1000085040 5:157881320-157881342 CATAACATCTTTATAGGACATGG + Intergenic
1000456526 5:161456151-161456173 AAGAAAAACTTTAAATATCAAGG - Intronic
1001479033 5:172074233-172074255 CCAAACAACTTTAAAAAACAAGG + Intronic
1001945080 5:175772027-175772049 CATAAAAACTTCAAAGGACAAGG - Intergenic
1002557809 5:180057586-180057608 CCTAAAAACTTTAAACAACAGGG + Intronic
1003805602 6:9723524-9723546 CATAACATCTTTATAGGACAGGG + Intronic
1004243554 6:13951255-13951277 CAGAAGACCTTCAAGGAACAGGG + Intronic
1004451309 6:15749559-15749581 CAGACCAGCTTTAAAAAACAGGG - Intergenic
1004812061 6:19272607-19272629 CATAACACCTTTATAGGACATGG + Intergenic
1005519285 6:26584446-26584468 CTGACCAACTTTGAAGACCAAGG - Intergenic
1006221600 6:32496329-32496351 CATAACATCTTTATAGGACAGGG + Intergenic
1007354970 6:41307972-41307994 CAGAAAAACTCCAAATAACAGGG + Intergenic
1007562519 6:42822003-42822025 CATGACAACTATAAAGAAAAGGG - Exonic
1008165918 6:48138010-48138032 TAGAGCTACTTTAAATAACATGG + Intergenic
1008441401 6:51535818-51535840 CAGAACATTTTTAAAGGAGAGGG - Intergenic
1008587193 6:52960747-52960769 CATAACATCTTTATAGGACATGG - Intergenic
1008752049 6:54746715-54746737 AAGAACAAATTTAAAGAAACAGG - Intergenic
1008832705 6:55787055-55787077 CAGAAGAAATTCAAAGATCAAGG - Intronic
1009276579 6:61689313-61689335 CAGAACAACTCAAAGGAAAAAGG - Intronic
1009748333 6:67848931-67848953 GAGAACAAATTTAAAGTATAGGG + Intergenic
1009848931 6:69171421-69171443 CAGAATAACTACCAAGAACAAGG - Intronic
1009872597 6:69469516-69469538 CATAACATCTTTATAGGACAGGG + Intergenic
1010951653 6:82043956-82043978 CAGAAAAAATTTAAAGAAATGGG + Intergenic
1012441723 6:99267332-99267354 CATAACATCTTTATAGGACATGG - Intergenic
1013874647 6:114809373-114809395 CAAAACAATTTTAAAGAATAGGG + Intergenic
1013908041 6:115239841-115239863 CATAACATCTTTATAGGACACGG - Intergenic
1014795354 6:125718337-125718359 CTGAACAACTTTAATTACCAGGG + Intergenic
1015120355 6:129694170-129694192 CAGAGCAAGTTAAAAGTACAAGG - Intronic
1015300247 6:131644792-131644814 TAGAACAACCTTAAAGAATTGGG + Intronic
1015988513 6:138910918-138910940 AAGAACAAGTTAAGAGAACAGGG + Intronic
1016170688 6:141012039-141012061 CAGATCAACGTGAAATAACAGGG + Intergenic
1016936094 6:149450556-149450578 CTGACCATCTTTAAAGAAAAGGG + Intronic
1017586074 6:155924876-155924898 CAGAAAAATGTTCAAGAACAAGG + Intergenic
1018489449 6:164276496-164276518 CTGAAAAACTTTAAAGTTCAAGG - Intergenic
1019851207 7:3559952-3559974 CCTCACAACTTTGAAGAACATGG + Intronic
1021878143 7:25067648-25067670 CAGAATTTCTTTAAATAACAAGG - Intergenic
1023151241 7:37203299-37203321 CATAACATCTTTATAGGACATGG - Intronic
1023273206 7:38489034-38489056 CAAAACAACTTTGAAGAAGAAGG + Intronic
1023347977 7:39291034-39291056 AAGCACAAGTTTACAGAACAAGG + Intronic
1024051432 7:45626221-45626243 CAGTAAAACTTTACAAAACAAGG + Intronic
1024870966 7:53961463-53961485 CATAACATCTTTATAGGACAGGG - Intergenic
1027790931 7:82638392-82638414 CATAACACCTTTATAGGACAGGG + Intergenic
1027967895 7:85037421-85037443 CATAATAACTTTAAATAAAATGG - Intronic
1028712548 7:93926175-93926197 AAGAACCCCTTTAAAGAAAAAGG + Exonic
1028763579 7:94523747-94523769 CACAACAAATCTGAAGAACAAGG + Intronic
1030003372 7:105090054-105090076 CAGAACTACGTTTTAGAACAGGG - Exonic
1030164761 7:106542994-106543016 CAGAACAAATTTCAAGAGCCAGG + Intergenic
1030420324 7:109300497-109300519 CATAACATCTTTATAGGACAGGG + Intergenic
1031154602 7:118095077-118095099 CAGACCAGGTATAAAGAACAAGG + Intergenic
1031187279 7:118498710-118498732 CAGGACAGCATTAAAGAACATGG - Intergenic
1031758821 7:125683631-125683653 TATAACAACTTTATAAAACATGG + Intergenic
1033759441 7:144423543-144423565 CATAACATCTTTATAGGACAGGG - Intergenic
1034124625 7:148660173-148660195 AAGAACAACTTCAAATTACATGG + Intergenic
1034511285 7:151537031-151537053 CACAACATCATTAAAGAACAAGG - Intergenic
1035270682 7:157718192-157718214 CAGAACAATTTGAATGAACGTGG + Intronic
1035272481 7:157728497-157728519 CAAAACAGCTTTAAAGTTCAAGG + Intronic
1035391994 7:158510275-158510297 CAGAACAACTTAGAAGCCCAGGG + Intronic
1036412402 8:8514309-8514331 AAGTACAACTTTAAAGGCCAAGG + Intergenic
1036492406 8:9240037-9240059 CAGAGCAATCTTAGAGAACAAGG - Intergenic
1036736567 8:11323300-11323322 CAAAACTATTTTAAAGAAAATGG - Exonic
1038638601 8:29306356-29306378 CATAACATCTTTATAGGACAGGG + Intergenic
1040648877 8:49428404-49428426 CATAACATCTTTATAGGACATGG + Intergenic
1041522377 8:58770722-58770744 CAGAACATGTGGAAAGAACAGGG - Intergenic
1041751201 8:61262786-61262808 CAAGTCAACTGTAAAGAACAGGG - Intronic
1043052638 8:75403101-75403123 AAGAAAAACTTTAAACAAAACGG - Intergenic
1043434484 8:80224894-80224916 CAGAAGAAATATAAAGAAAATGG - Intronic
1043606488 8:82006873-82006895 CTGAGCAGCTTTATAGAACACGG + Intergenic
1044456824 8:92399586-92399608 CATAACATCTTTATAGGACAGGG - Intergenic
1045858366 8:106789963-106789985 CATAACATCTTTATAGGACAGGG + Intergenic
1049172318 8:141169249-141169271 CAGGGCAACTGTAAAGACCACGG - Intronic
1050041780 9:1503662-1503684 CACTACAACTTGAATGAACATGG + Intergenic
1051935065 9:22435839-22435861 CATAACATCTTTATAGGACATGG + Intergenic
1052060389 9:23953565-23953587 CCGAATAAATTTAAATAACAAGG + Intergenic
1052762100 9:32603125-32603147 CAGAACAACTTTCAAGCAGGTGG + Intergenic
1052808987 9:33040162-33040184 GAGAAAAACTTTAAAAAATAAGG + Intergenic
1055783103 9:79842142-79842164 GACAACAACTTCAAAGAATAAGG - Intergenic
1057338982 9:94182351-94182373 TGGAACAACTTCAAAGAAAAGGG - Intergenic
1057473387 9:95378492-95378514 CAAAACAACATTGAAAAACAAGG - Intergenic
1057612679 9:96560430-96560452 CATGACAACTTTATAGAAAAAGG - Intronic
1057816652 9:98300936-98300958 CATAAAAACTCAAAAGAACAGGG + Intronic
1057923540 9:99121051-99121073 CATCACATCTTAAAAGAACAGGG - Intronic
1058438160 9:104982913-104982935 AATAAAAACTCTAAAGAACATGG + Intergenic
1059147407 9:111912837-111912859 AACAAGAAATTTAAAGAACAGGG - Intronic
1059382658 9:113939110-113939132 CAGAATAAATTTAAATAATATGG + Intronic
1059717103 9:116923438-116923460 CAGGACAACTGTAAAGACAAGGG - Intronic
1060452894 9:123760187-123760209 CAGAAGAAATTTAAAAATCATGG + Intronic
1060577996 9:124715740-124715762 CAAAACAACTTTGAAAAAGAAGG + Intronic
1186118804 X:6335260-6335282 CAGAACAACATCTAAGATCAGGG - Intergenic
1187020589 X:15377337-15377359 CAGAACAACTTTAGTGAAGATGG - Intronic
1189592381 X:42528870-42528892 CAGAATAACTTTAAAGTTGAAGG - Intergenic
1190438431 X:50451058-50451080 CAGAACAACTCTAATCAAGAGGG + Intronic
1191651879 X:63547759-63547781 CAAAACACATTTAAAAAACAAGG + Intergenic
1192051283 X:67726132-67726154 CAAAACAGCTTTAAATAACAAGG + Exonic
1192400502 X:70829613-70829635 CACAACAACTTTTCAAAACATGG + Intronic
1192482965 X:71500750-71500772 CATAACATCTTTATAGGACAGGG - Intronic
1192542088 X:71982645-71982667 CACAAAAACTCAAAAGAACAGGG + Intergenic
1192870242 X:75177536-75177558 CATAACATCTTTATAGGACAGGG - Intergenic
1194871917 X:99142771-99142793 CAATACAAGTTTAAAGAAGACGG + Intergenic
1195439360 X:104883969-104883991 CATAACATCTTTATAGGACAGGG + Intronic
1196266560 X:113654721-113654743 GAGAACAACTTGAAAGAAGGTGG + Intergenic
1197332112 X:125166318-125166340 TAGAAAAACTTTATAGAAAATGG - Intergenic
1197488098 X:127079756-127079778 AAAGACAACATTAAAGAACAGGG + Intergenic
1197513204 X:127396325-127396347 CATAACATCTTTATAGGACATGG + Intergenic
1198053637 X:132972894-132972916 CAGCACAGCTCTAAAGAAAAGGG + Intergenic
1198127857 X:133663981-133664003 CAGAATTTCTTTAAATAACAAGG - Intronic
1199832608 X:151560834-151560856 CATAACACCTTTATAGGACAGGG - Intergenic
1199868957 X:151879033-151879055 AAGAACAACTCCAAAGAAAAGGG - Intergenic
1200801195 Y:7388488-7388510 CATAACATCTTTATAGGACAGGG - Intergenic
1201429493 Y:13890247-13890269 CATAACATCTTTATAGGACAGGG + Intergenic
1201496597 Y:14596024-14596046 CATAACATCTTTATAGGACAGGG - Intronic
1201578856 Y:15490374-15490396 CAGAACAACTTTCTACAAGAGGG - Intergenic
1201861997 Y:18608696-18608718 AAAAACAACATTAAAGAAGATGG + Intergenic
1201871326 Y:18711684-18711706 AAAAACAACATTAAAGAAGATGG - Intergenic
1202257655 Y:22938437-22938459 CATAACATCTTTATAGGACAAGG + Intergenic
1202410645 Y:24572184-24572206 CATAACATCTTTATAGGACAAGG + Intergenic
1202460136 Y:25097888-25097910 CATAACATCTTTATAGGACAAGG - Intergenic