ID: 905758427 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:40532244-40532266 |
| Sequence | CAGTTAACTCATATGCAAAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4325 | |||
| Summary | {0: 1, 1: 0, 2: 31, 3: 578, 4: 3715} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 905758427_905758429 | 5 | Left | 905758427 | 1:40532244-40532266 | CCATTTTGCATATGAGTTAACTG | 0: 1 1: 0 2: 31 3: 578 4: 3715 |
||
| Right | 905758429 | 1:40532272-40532294 | GAAAGGTGAAATTACTTGCCTGG | 0: 1 1: 0 2: 2 3: 46 4: 330 |
||||
| 905758427_905758431 | 27 | Left | 905758427 | 1:40532244-40532266 | CCATTTTGCATATGAGTTAACTG | 0: 1 1: 0 2: 31 3: 578 4: 3715 |
||
| Right | 905758431 | 1:40532294-40532316 | GACTCACACAGCTTAGTAAGTGG | 0: 1 1: 0 2: 2 3: 18 4: 164 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 905758427 | Original CRISPR | CAGTTAACTCATATGCAAAA TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||