ID: 905758427

View in Genome Browser
Species Human (GRCh38)
Location 1:40532244-40532266
Sequence CAGTTAACTCATATGCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4325
Summary {0: 1, 1: 0, 2: 31, 3: 578, 4: 3715}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905758427_905758429 5 Left 905758427 1:40532244-40532266 CCATTTTGCATATGAGTTAACTG 0: 1
1: 0
2: 31
3: 578
4: 3715
Right 905758429 1:40532272-40532294 GAAAGGTGAAATTACTTGCCTGG 0: 1
1: 0
2: 2
3: 46
4: 330
905758427_905758431 27 Left 905758427 1:40532244-40532266 CCATTTTGCATATGAGTTAACTG 0: 1
1: 0
2: 31
3: 578
4: 3715
Right 905758431 1:40532294-40532316 GACTCACACAGCTTAGTAAGTGG 0: 1
1: 0
2: 2
3: 18
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905758427 Original CRISPR CAGTTAACTCATATGCAAAA TGG (reversed) Intronic
Too many off-targets to display for this crispr