ID: 905761519

View in Genome Browser
Species Human (GRCh38)
Location 1:40562190-40562212
Sequence CAATGAAACAAACACCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905761519_905761522 12 Left 905761519 1:40562190-40562212 CCAAGTAGGTGTTTGTTTCATTG No data
Right 905761522 1:40562225-40562247 TTGATTACCTATTCTAAGTCAGG No data
905761519_905761524 30 Left 905761519 1:40562190-40562212 CCAAGTAGGTGTTTGTTTCATTG No data
Right 905761524 1:40562243-40562265 TCAGGCACTGTGTTTCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905761519 Original CRISPR CAATGAAACAAACACCTACT TGG (reversed) Intergenic
No off target data available for this crispr