ID: 905764938

View in Genome Browser
Species Human (GRCh38)
Location 1:40592498-40592520
Sequence GGTGGGTTAATGCAAATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905764938_905764945 5 Left 905764938 1:40592498-40592520 CCCTCAATTTGCATTAACCCACC No data
Right 905764945 1:40592526-40592548 ATTTGTGTGTAATTGAAAGTAGG No data
905764938_905764946 15 Left 905764938 1:40592498-40592520 CCCTCAATTTGCATTAACCCACC No data
Right 905764946 1:40592536-40592558 AATTGAAAGTAGGTATAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905764938 Original CRISPR GGTGGGTTAATGCAAATTGA GGG (reversed) Intergenic
No off target data available for this crispr