ID: 905768004

View in Genome Browser
Species Human (GRCh38)
Location 1:40619210-40619232
Sequence TAGGAAAGTCATTGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 2, 2: 1, 3: 25, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905768000_905768004 21 Left 905768000 1:40619166-40619188 CCGTGGTATGGACTAGAAAAGTT 0: 1
1: 0
2: 2
3: 12
4: 139
Right 905768004 1:40619210-40619232 TAGGAAAGTCATTGTGAGGCAGG 0: 1
1: 2
2: 1
3: 25
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905768004 Original CRISPR TAGGAAAGTCATTGTGAGGC AGG Intergenic
900095043 1:936751-936773 TAGGAAGGCCCTTGTGGGGCTGG + Intronic
902573179 1:17359991-17360013 TAAGACAGTCATCTTGAGGCCGG + Intronic
902599877 1:17533696-17533718 TAGGACAGGCATTTTGAGGGGGG - Intergenic
904893269 1:33795081-33795103 TAGCAAGGTCAAGGTGAGGCGGG + Intronic
905768004 1:40619210-40619232 TAGGAAAGTCATTGTGAGGCAGG + Intergenic
906063653 1:42964393-42964415 TAGGAGACCCAGTGTGAGGCAGG - Intergenic
907133866 1:52120944-52120966 CAGGAAAGTCTTTTTGAGGAAGG - Intergenic
908539375 1:65108041-65108063 TAAGAAAGTATCTGTGAGGCTGG - Intergenic
909969052 1:81957867-81957889 TATGAAAGTCATTTTACGGCCGG + Intronic
910859742 1:91731954-91731976 TCGGAAAGTCATTGGGGAGCGGG - Intronic
912723264 1:112037700-112037722 TTGGAAAGTCAATGTCAGCCAGG + Intergenic
913361136 1:117981547-117981569 TAAGAAAGCCATTAAGAGGCAGG + Intronic
913521548 1:119649374-119649396 TAGAAAAGTCTCTGGGAGGCCGG + Intergenic
914958850 1:152188826-152188848 GAGGAAAGTCTTTCAGAGGCCGG + Intergenic
915414084 1:155726586-155726608 TAGGAAAGTAAAGCTGAGGCCGG - Intronic
915666220 1:157447445-157447467 TGGGAAAATTATTATGAGGCTGG + Intergenic
916161855 1:161924662-161924684 TAGGAAAGGAATTGTTAGGAAGG + Intronic
917363048 1:174198375-174198397 CTGCAAAGTCATTGTGAGGCTGG - Intronic
918428615 1:184435806-184435828 TAAGAAAGTGATTGAAAGGCTGG + Intronic
920113955 1:203606697-203606719 TAAGAAAGACATTGTGGGCCGGG + Intergenic
920556915 1:206910476-206910498 TAGGCAAGTCTTTTTGAGGGGGG - Intronic
920684559 1:208099545-208099567 TAACAGAGTCATTCTGAGGCAGG - Intronic
922217252 1:223530232-223530254 AAGGAAATTCCTTGTGAGGTAGG - Intergenic
922254920 1:223885464-223885486 AAGGAAATTCAGTGTGAGGGGGG + Intergenic
923447264 1:234083770-234083792 TGGGAAAAGCATTGTGAGGCAGG + Intronic
924709707 1:246522189-246522211 TAGAAAGGTCTTTCTGAGGCAGG - Intergenic
924818685 1:247466304-247466326 AAGAAAAGTGATTGTGAAGCGGG - Intergenic
1063771701 10:9210761-9210783 TAAAAAAGTCATTGTAAGTCAGG - Intergenic
1064066718 10:12188427-12188449 TAGGAAAGTGGCGGTGAGGCCGG + Intronic
1064407212 10:15074758-15074780 TATAAAAGTAATTGGGAGGCCGG + Intergenic
1064970847 10:21065374-21065396 AAGGAAAGTAAGTGTGAGGGAGG + Intronic
1065220041 10:23487042-23487064 AAGGAAAGACACTGAGAGGCTGG + Intergenic
1065750556 10:28882806-28882828 TAAGAAAGTCAGTGTGAAGGTGG - Intergenic
1066324222 10:34340003-34340025 TAGGGAAGATATTGTCAGGCTGG + Intronic
1069047192 10:63755441-63755463 TAAGAAAGTCAGTGTGATCCAGG - Intergenic
1070286448 10:75087297-75087319 TTGGATAGTGATTGTGAGGGAGG - Intergenic
1070558202 10:77546163-77546185 GAGGAAAGTCTGTGTGGGGCTGG + Intronic
1071025926 10:81113138-81113160 AAAGAAAGTCATTGATAGGCCGG - Intergenic
1072101164 10:92230765-92230787 TAGAAAATTCCTTGTGAAGCTGG + Intronic
1072516460 10:96188144-96188166 TAGAAAAGTCTTTAAGAGGCTGG - Intronic
1073330417 10:102666939-102666961 AAAAAAAGTCACTGTGAGGCTGG + Intergenic
1073640191 10:105244770-105244792 TATGAAAGGCAATGTGCGGCCGG + Intronic
1073666077 10:105535313-105535335 TAGGAAAGTCATTGTTCTGATGG - Intergenic
1075685445 10:124361946-124361968 TAAGAAACTCTTTCTGAGGCTGG - Intergenic
1077601443 11:3577655-3577677 GAGGAAGGTTATTGTGAGCCTGG - Intergenic
1078578100 11:12517999-12518021 AAGGAAAGTGACTGTGAAGCTGG + Intronic
1081525491 11:43924897-43924919 TAGGAAAGTCAGAGAGAGGAGGG + Intergenic
1081699860 11:45146317-45146339 TAATAAAGTCATTGTGAGGGGGG - Intronic
1085500913 11:77022818-77022840 TAGAAAATACTTTGTGAGGCCGG + Exonic
1088757649 11:112899503-112899525 CAGGCAAGTCAGTGTGAAGCCGG + Intergenic
1091809034 12:3379596-3379618 TAGAAAAGTCATTGTGACGATGG - Intergenic
1094529314 12:31258807-31258829 TTGCAAAGTCATTGTGAAGAAGG + Intergenic
1095512035 12:42961873-42961895 TAGGAAAGGCATTGTGTCTCAGG + Intergenic
1096160537 12:49373268-49373290 TAGAAAATGCAATGTGAGGCTGG - Intronic
1098408956 12:70158560-70158582 AAGGAAATTCCTTGTGAGGGAGG - Intergenic
1098681413 12:73360250-73360272 TAAGAAAGACACTGTGAGACTGG + Intergenic
1099277426 12:80594905-80594927 GAGGAAATTCATGGTCAGGCAGG - Intronic
1099623410 12:85033757-85033779 TGGGAAAGTTATTGAGAGGGTGG - Intronic
1101179629 12:102201171-102201193 TATAAAAGTCCTTGTTAGGCTGG + Intergenic
1102224493 12:111218188-111218210 TAGCAGAGCCATTGTAAGGCTGG - Intronic
1104266533 12:127238473-127238495 TGGCAGAGTCATTGTGAGGAAGG - Intergenic
1107347785 13:39481478-39481500 ATGGAAAGTCATTGTGAGGTGGG + Intronic
1109934962 13:69270705-69270727 TAAGAAATTCATTGTGAGGCTGG - Intergenic
1110977263 13:81854644-81854666 TAGCAATGTCATTGGGAAGCTGG - Intergenic
1114253124 14:20978716-20978738 TAGGCTAATCATTATGAGGCTGG - Intergenic
1114937982 14:27568460-27568482 TTGGAATGTCAGTGGGAGGCAGG - Intergenic
1116972353 14:51079700-51079722 TGGGCAAGTCAATGTCAGGCTGG + Intronic
1117048736 14:51839422-51839444 AAGGAAATTCCTTGTGAGGGAGG + Intronic
1117070361 14:52050419-52050441 TGGGGAAGTCTTTGTGAGGAAGG - Intronic
1117446265 14:55806430-55806452 AAGGAAATTCCTTGTGAGGAAGG + Intergenic
1121084409 14:91134732-91134754 TAGAAATGTAATTGTGAGGCCGG - Intronic
1121204300 14:92149285-92149307 TAAGAATGTCCTTGAGAGGCTGG + Intronic
1121806680 14:96832807-96832829 TATGGAAGTCACTGTGAGGAAGG - Intronic
1125935359 15:43630738-43630760 AAGGAAACAGATTGTGAGGCTGG + Intronic
1125948134 15:43727218-43727240 AAGGAAACAGATTGTGAGGCTGG + Intergenic
1125980974 15:44000973-44000995 TAGTATAGCCATTTTGAGGCTGG - Intronic
1126579442 15:50229782-50229804 TTGGACAGTAATTTTGAGGCTGG - Intronic
1127802727 15:62491597-62491619 AAGGAAACTCCTTGTGAGGGAGG + Intronic
1128200314 15:65799700-65799722 TAAAAAAGTTAATGTGAGGCAGG + Intronic
1129296457 15:74602876-74602898 TAGGAAGGCCCCTGTGAGGCTGG - Intronic
1129718687 15:77866185-77866207 AAGGAAAGTTGTTGTGGGGCTGG - Intergenic
1131529247 15:93178256-93178278 AAGGAAATTCCTTGTGAGGGAGG + Intergenic
1132074777 15:98810842-98810864 TAAGAAAATCATTTAGAGGCTGG - Intronic
1132132691 15:99297556-99297578 TAGGAAAGTCATTGAGGGCCAGG - Intronic
1135908838 16:26540943-26540965 TAGGAATGTCATTCTGTGGGTGG + Intergenic
1137591387 16:49696240-49696262 TAGAAAAGTCATTGCGATGGTGG + Intronic
1137986522 16:53113197-53113219 AAAGAACGTCAATGTGAGGCAGG + Intronic
1139020425 16:62742351-62742373 TAGAAAAGTCAGTTTCAGGCCGG + Intergenic
1144114738 17:12077004-12077026 TAGGAAAGTCATTCTGAGGCAGG + Intronic
1144158835 17:12536967-12536989 TTGAAAAGTGATTGTCAGGCCGG + Intergenic
1144292726 17:13841998-13842020 TGGGAAAATCACTGTCAGGCAGG - Intergenic
1145119888 17:20248878-20248900 TAGAAAAGACATTTTAAGGCAGG - Intronic
1145753041 17:27368837-27368859 TAGCAAAGCCATGGTAAGGCAGG - Intergenic
1146074129 17:29712260-29712282 AAGGAAATTCCTTGTGAGGGAGG + Intronic
1147726332 17:42568063-42568085 TAAGAAAGCCATTGTGTGGCCGG + Intronic
1147765296 17:42831024-42831046 TATGATAGTCATTGGGAGGGTGG + Intronic
1150155162 17:62847058-62847080 TTAGAAAGTCAATCTGAGGCTGG - Intergenic
1150548544 17:66188131-66188153 TAGGAAACTCATTCTGGAGCAGG - Intronic
1151731352 17:75913442-75913464 AAAAAAAGTCATTGTCAGGCTGG - Intronic
1152099931 17:78295162-78295184 TAAGAAGGTCAGTGTGAGGCCGG + Intergenic
1153254086 18:3152838-3152860 GAGGAAGGTGATTGTGAGGAGGG - Intronic
1153696425 18:7647419-7647441 TAGGTAAGTTATTGTGACCCAGG + Intronic
1156114924 18:33776241-33776263 TAGCAAGGTCAAAGTGAGGCTGG - Intergenic
1159303182 18:66604806-66604828 TAAGAAAGTCTATGTGGGGCAGG + Intergenic
1159789057 18:72753467-72753489 AATGAAAGACATTGTGAGACTGG + Intronic
1160320753 18:77891988-77892010 TATGAATGTCATTGTTAGGATGG + Intergenic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1162042893 19:7980995-7981017 TTGGAGAGTGACTGTGAGGCTGG + Intronic
1163725953 19:18923135-18923157 TGGGAAGGTCATTGAGAAGCTGG + Intronic
1165044355 19:33092890-33092912 TTCTAAAGTCAGTGTGAGGCGGG + Intronic
926774633 2:16409588-16409610 TATGATAGTAATTGTGAGCCTGG + Intergenic
927250037 2:20989143-20989165 GAGGAAAGGCAGGGTGAGGCGGG - Intergenic
927505814 2:23613987-23614009 AAGGAAATTCCTTGTGAGGGAGG - Intronic
929738500 2:44577085-44577107 TAGGAAAGTCACTTTGATGCTGG + Intronic
933196850 2:79400259-79400281 AAGGAAATTCCTTGTGAGGGAGG + Intronic
933273551 2:80259494-80259516 AAGGAAGGTCATTGTGAAGAGGG - Intronic
936923538 2:117713324-117713346 CATGAAAGGCATTGTGAGGCTGG - Intergenic
937194027 2:120133968-120133990 TAGAAATGTCATTGGGAGGTGGG - Intronic
937808552 2:126173363-126173385 TGGTAAAGTCATTGTGATGGTGG + Intergenic
938314428 2:130316122-130316144 AAGGAAAGGCAGTCTGAGGCCGG + Intergenic
939741624 2:145915111-145915133 TAGGAATGTCCTTGTGGGGCTGG + Intergenic
941090951 2:161175022-161175044 TAGGAAAGGCTTTGAGAGGTAGG - Intronic
941269334 2:163405825-163405847 TAGTAAAGTCCCTGTGAGCCAGG + Intergenic
941403003 2:165054846-165054868 TGGGAAATTCATAGTGAGGGAGG + Intergenic
942030803 2:171956868-171956890 TAGGATATTCATTGTCAGGAAGG + Intronic
943586168 2:189743175-189743197 TAGGAAAGTCTCTGTAAGGGAGG - Intronic
944309850 2:198221691-198221713 TGGGAAAGGAATTGTGAGGGGGG - Intronic
944373600 2:199013637-199013659 TAGGAAAGCCATTTTGAATCTGG - Intergenic
944831545 2:203538076-203538098 TAAGGAAGTCATTGTTAGACTGG + Intergenic
945215466 2:207429423-207429445 AAGAAAACTCATTGTGTGGCTGG + Intergenic
946046572 2:216826342-216826364 AAGGAGAGCCCTTGTGAGGCAGG - Intergenic
947199381 2:227600813-227600835 TAGGAAAGTCATTCTAACCCTGG + Intergenic
947919454 2:233856567-233856589 TTAGAGAGTCATGGTGAGGCAGG - Intergenic
1169964114 20:11196282-11196304 TAGGAAGTCCATTGTGAGGCTGG + Intergenic
1170051792 20:12154091-12154113 TCTGAAACTCATTGTGAGGCAGG - Intergenic
1173130745 20:40390907-40390929 AAGGAAAGTTCTTGTGAGACTGG - Intergenic
1173676571 20:44840877-44840899 TAGGAAATACATACTGAGGCGGG + Intergenic
1174899901 20:54488381-54488403 AAGGCAAGTCATTCTGAGGAAGG - Intronic
1175334172 20:58184364-58184386 TTGGGAGGTCATTGTGGGGCAGG - Intergenic
1175799161 20:61791429-61791451 TAGGAAAGTCCATCTTAGGCCGG + Intronic
1175823969 20:61926569-61926591 TTAGAAAGTGATTGTGAGCCCGG + Intronic
1176954281 21:15082664-15082686 TAGGAAAATGATTAAGAGGCAGG + Intergenic
1177657488 21:24037918-24037940 TAAGAAAGTAATGTTGAGGCTGG + Intergenic
1178174756 21:30083669-30083691 CAGAAAAGTCACTGTGATGCAGG - Intergenic
1178703061 21:34850360-34850382 TAGGAAACTCAGTGGGTGGCCGG + Intronic
1178828367 21:36034366-36034388 TAGGAACGGGATTGTGGGGCGGG + Intergenic
1178902670 21:36609827-36609849 TAGGAATGTGACTTTGAGGCTGG + Intergenic
1181783696 22:25210421-25210443 TAAGAATGTCATTGGGAGGTAGG + Intergenic
1181927142 22:26369039-26369061 AAGCAAAATCATTGAGAGGCGGG + Intronic
1183240745 22:36656578-36656600 GAGGAAAGTCATTTTCTGGCTGG - Intronic
1183338483 22:37264833-37264855 TTGGAAAGTGGGTGTGAGGCTGG - Intergenic
1184031325 22:41896653-41896675 TAGGAAAGTGACTTTGGGGCCGG - Intronic
1184733821 22:46386264-46386286 TAGAAAAATGATTGTGAGGCCGG - Intronic
950288319 3:11762761-11762783 TAAGAAATTGATTGTGAGGCTGG + Intergenic
950386458 3:12664053-12664075 GAGGAAAACGATTGTGAGGCGGG - Exonic
951382745 3:22004640-22004662 AAGGAAATTCCTTGTGAGGGAGG - Intronic
952597570 3:35036986-35037008 TATGAAACTGATTGTGATGCTGG - Intergenic
956084513 3:65595904-65595926 GAGGAAAGGCATTGAGAGACAGG + Intronic
957564523 3:81866792-81866814 TAGGAAATTCCTTGTGAGGGAGG + Intergenic
958900184 3:99876426-99876448 TAACAAAGTCATTGGGAGGCAGG + Intronic
960608918 3:119536632-119536654 TATTAAAGTCACTGTGAGACTGG - Intronic
961182035 3:124885576-124885598 AAGGAAAGTCCTTGTGGAGCAGG + Intronic
962478393 3:135777925-135777947 TAGGAAAGCCTTGGTGAGGCTGG + Intergenic
963882462 3:150544337-150544359 TAGGAAAGTCATTCTGAGGCAGG + Exonic
964618376 3:158695075-158695097 TAGAAAAGATATTCTGAGGCCGG + Intergenic
965603343 3:170476007-170476029 TAGAAATGTGATTTTGAGGCTGG - Intronic
965859001 3:173124490-173124512 CAGCAAAGTCATTGAGAGGCTGG - Intronic
966982447 3:185150948-185150970 CAGGAAAGACATTGTGAGAATGG + Intronic
967889513 3:194355089-194355111 TTGGAAAGTGAGTGGGAGGCCGG - Intergenic
968335934 3:197913652-197913674 TTTCAAAGTCATTATGAGGCGGG + Intronic
970578214 4:17448318-17448340 TATAAAAGTCCTTGTGAGCCAGG - Intergenic
971708888 4:30085808-30085830 TATGAAAGTTATTTTTAGGCTGG + Intergenic
971899181 4:32636119-32636141 TAGGTTAGTCATTGTGAGAATGG - Intergenic
974795501 4:66743772-66743794 TTGGAATTTCAATGTGAGGCAGG - Intergenic
975585256 4:75941928-75941950 TAGGAAAATCTTAGTAAGGCTGG + Intronic
976262437 4:83158434-83158456 CAGGAAAGGCAATGTGTGGCAGG + Intergenic
978437301 4:108699324-108699346 TAGGGAGGTGATTGTGAGCCTGG - Intergenic
979905433 4:126284151-126284173 TACGAAAGTTATTGTGAAGGTGG - Intergenic
980417680 4:132513579-132513601 TAGGAAAGGCATTTAGAGCCAGG - Intergenic
980428380 4:132657205-132657227 TGAGAAATTCATTGTTAGGCTGG + Intergenic
982760318 4:159274913-159274935 TAGGAAAGACAGTGAGTGGCAGG - Intronic
984626927 4:182017988-182018010 CAGGAAATTTATGGTGAGGCAGG + Intergenic
986399310 5:7364666-7364688 GAGGAAATTCCTTGTGAGGGAGG - Intergenic
987959639 5:24789364-24789386 AAGGAAAGTCACTGTGAGTCAGG + Intergenic
989952851 5:50321069-50321091 TTGGTAAGCCATTGTGAGCCTGG - Intergenic
990569175 5:57060591-57060613 TAGAAAGGTCATTTTGAGGCAGG - Intergenic
991043254 5:62196788-62196810 AAGGAAATTCCTTGTGAGGGAGG + Intergenic
993288840 5:86038655-86038677 TAGGAAGCTCATTTTGAGGAAGG + Intergenic
994762156 5:103868338-103868360 TGGGCAAGTCATTGTCTGGCTGG + Intergenic
996220259 5:120923740-120923762 TAGAAGTGTCATTGTGAGCCAGG - Intergenic
998016099 5:138733638-138733660 CAGGAAAGGCATTTTGAGGAAGG + Intronic
999115858 5:149162858-149162880 TAGAAAACACATTTTGAGGCAGG - Intronic
1002067349 5:176658502-176658524 TGGGAAAGTCAAAGTGAAGCAGG - Exonic
1003238540 6:4320516-4320538 TAAGAAAATCATTCTCAGGCAGG - Intergenic
1005239976 6:23813363-23813385 TAAGAAAGTTCTTGGGAGGCCGG + Intergenic
1007191302 6:40021214-40021236 CAGTAAAGCCATTGTGAGGCTGG - Intergenic
1009240741 6:61183398-61183420 TAAGAAATACATTTTGAGGCCGG + Intergenic
1009361894 6:62825154-62825176 AAGGAAATTCCTTGTGAGGGAGG - Intergenic
1012503240 6:99914243-99914265 TAGAAAAATTATTGTGTGGCTGG + Intergenic
1013430433 6:110050460-110050482 TAGGGCAGCCAGTGTGAGGCAGG - Intergenic
1013654792 6:112235121-112235143 TAGGAAGGTTTTTGGGAGGCAGG - Intronic
1014305380 6:119735051-119735073 TAGGAATGTAATTGTGAAGAAGG + Intergenic
1014925165 6:127261790-127261812 TAGAAATGCCATTGTGAGACTGG - Intergenic
1015658996 6:135552685-135552707 TAGGAAGGTGGTTGTGAGGGAGG - Intergenic
1016668856 6:146676859-146676881 TTAGAAAGTAACTGTGAGGCCGG + Intronic
1016935006 6:149443198-149443220 GAGGTAACTCACTGTGAGGCTGG + Intergenic
1017348265 6:153409472-153409494 AAGGAAATTCCTTGTGAGGTAGG + Intergenic
1021615204 7:22496774-22496796 TGAGAAATTCATTGTAAGGCGGG - Intronic
1022170272 7:27821332-27821354 TAGAAAAGTAATTGTTGGGCTGG + Intronic
1022889106 7:34677632-34677654 TAGGTAAGACATTCTGAGGGAGG + Intronic
1023814876 7:43941998-43942020 TAGGAATGTCTTTGTTTGGCTGG + Intronic
1024151525 7:46576620-46576642 TATAAAAGTCATTTTGAGGCTGG + Intergenic
1025059635 7:55794626-55794648 TATAAAAGTCATTGTGGGTCAGG + Exonic
1025127855 7:56359032-56359054 TATAAAAGTCATTGTGGGTCAGG + Intergenic
1025615888 7:63116181-63116203 TATAAAAGTCATTGTGGGCCGGG + Intergenic
1026493846 7:70886020-70886042 AAGGAAATTCCTTGTGAGGGAGG + Intergenic
1026521792 7:71124178-71124200 TAGGAAAGGTCTTCTGAGGCCGG - Intergenic
1027390489 7:77698287-77698309 TAGGAAAGTGGTTTTGAGGATGG + Intronic
1027642749 7:80757432-80757454 AAAGAAAGTCAGTCTGAGGCAGG - Intronic
1027956494 7:84885432-84885454 TCTGAAAGTCATTCTGAAGCAGG + Intergenic
1028377293 7:90157856-90157878 TGAGAAATTCATTGTAAGGCGGG + Intronic
1029611086 7:101626909-101626931 CAGGAAGGTCAGTGAGAGGCAGG + Intronic
1030289705 7:107859814-107859836 TAGCCAAGGCATGGTGAGGCTGG - Intergenic
1032775763 7:135110777-135110799 TAAGAAAGTGGTTGGGAGGCTGG - Intronic
1034473832 7:151271195-151271217 TGGGAAAGGGATTGTGCGGCTGG - Intronic
1034738166 7:153448073-153448095 AAGGTAAGTCATTCTGAGGCAGG + Intergenic
1035412315 7:158654751-158654773 TAGGAGAAGCTTTGTGAGGCTGG - Intronic
1035554303 8:554748-554770 CATGCAAGTCACTGTGAGGCTGG + Intergenic
1036752666 8:11453152-11453174 TAGGAAAGTTATTAAGGGGCAGG - Intronic
1037504274 8:19515107-19515129 CAGGAAAGGCACTCTGAGGCTGG - Intronic
1041085042 8:54249045-54249067 ATGGTAAGTCATTGTGTGGCTGG + Intergenic
1041553582 8:59127212-59127234 GAGGAAGGGGATTGTGAGGCTGG - Intergenic
1042910920 8:73825379-73825401 TAAGAGAGTTATTGGGAGGCTGG - Intronic
1043107587 8:76134555-76134577 TAGGAAAGGGCTTGTGAGGAGGG + Intergenic
1046368160 8:113264419-113264441 AAGGAAATTCATTGTGAAACAGG + Intronic
1046446811 8:114331885-114331907 TAGGAAAGTTATTGTAACCCAGG - Intergenic
1054863942 9:69980794-69980816 TGGGACGGTCATTTTGAGGCTGG + Intergenic
1056800619 9:89688203-89688225 TAGGAAAGAAATTGTGATTCAGG + Intergenic
1060405521 9:123371145-123371167 AAGGAAAGACACTGTGAGGTTGG - Exonic
1062336004 9:136068199-136068221 TAAAAAAGTAATTGTGTGGCTGG + Intronic
1186503800 X:10073947-10073969 TGGAAGAGTCATTGTGAGACAGG - Intronic
1187940039 X:24372432-24372454 TGAGAAAGTCAGTGTGAAGCGGG + Intergenic
1188440352 X:30209934-30209956 TAGGACAGTCATCAGGAGGCTGG - Intergenic
1189419451 X:40843718-40843740 TGAGAAAGTCTTTGTCAGGCAGG + Intergenic
1194492602 X:94569804-94569826 AAGGAAATTTCTTGTGAGGCAGG + Intergenic
1199186438 X:144920993-144921015 AAGGAAATTCTTTGTGAGGGAGG + Intergenic