ID: 905768405

View in Genome Browser
Species Human (GRCh38)
Location 1:40622049-40622071
Sequence CAAGCTCAGGGTTCGGGGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905768390_905768405 13 Left 905768390 1:40622013-40622035 CCTCACAGGCACAGCCATGCTGG 0: 1
1: 0
2: 0
3: 34
4: 298
Right 905768405 1:40622049-40622071 CAAGCTCAGGGTTCGGGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 166
905768393_905768405 -1 Left 905768393 1:40622027-40622049 CCATGCTGGGCCCACACAAGCCC 0: 1
1: 0
2: 3
3: 35
4: 360
Right 905768405 1:40622049-40622071 CAAGCTCAGGGTTCGGGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 166
905768389_905768405 14 Left 905768389 1:40622012-40622034 CCCTCACAGGCACAGCCATGCTG 0: 1
1: 0
2: 2
3: 30
4: 349
Right 905768405 1:40622049-40622071 CAAGCTCAGGGTTCGGGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905768405 Original CRISPR CAAGCTCAGGGTTCGGGGGG AGG Exonic
901104815 1:6746903-6746925 GAAGCTCAGGGTGGGCGGGGGGG + Intergenic
902205861 1:14867725-14867747 CATGCCCAGGGTGGGGGGGGGGG - Intronic
902525320 1:17053703-17053725 ACAGCTAAGGGTGCGGGGGGGGG - Intronic
902723879 1:18322716-18322738 CAGGCTCTGGGTTCAGGGGTGGG - Intronic
903371570 1:22839569-22839591 CAAGGACAGGGTTAGGGGGCAGG + Intronic
903390369 1:22959636-22959658 CATGGTCAGGGTTGGGGGGATGG + Intronic
904890269 1:33774345-33774367 CAGGCTCAGGGATGGGGGAGGGG + Intronic
904940040 1:34159329-34159351 CAAGCTCCTGGGTGGGGGGGGGG - Intronic
905768405 1:40622049-40622071 CAAGCTCAGGGTTCGGGGGGAGG + Exonic
906068845 1:43002662-43002684 CAAGATCAGGCTTCGGGGTTTGG + Intergenic
907310660 1:53537180-53537202 CAAGCTCTGGCTTGGGGAGGGGG + Intronic
909788684 1:79645156-79645178 TAAGGTCTGGGTTGGGGGGGAGG - Intergenic
915325823 1:155080727-155080749 AAAGCTCAGGGAGCGGGTGGGGG + Intronic
915472703 1:156135372-156135394 GAAGCCCAGGGTTGGGGGTGGGG + Intronic
923096264 1:230777678-230777700 CAAGATCAGGGTTAGTGGGGTGG - Intronic
1064421969 10:15198397-15198419 CAAGCCCAGGGTTAGGGGAGGGG - Intergenic
1064622617 10:17230150-17230172 CAAGGTCTGGGTTCTGGGCGGGG - Intronic
1065741629 10:28802329-28802351 CAAGCACAGGGTGTGGTGGGGGG - Intergenic
1068061933 10:52079351-52079373 AAAGCTCAGGCTTCGGGCAGGGG - Intronic
1070737771 10:78876153-78876175 GAAGCTCACAGTTTGGGGGGAGG + Intergenic
1070761210 10:79025411-79025433 AAGGCACAGGGTTGGGGGGGCGG + Intergenic
1074723928 10:116288294-116288316 GAAGCTCAGGGTGATGGGGGTGG - Intergenic
1075791043 10:125084591-125084613 CAGTCTCAGGGGTCCGGGGGTGG + Intronic
1075982709 10:126755284-126755306 CAATGTCGGGGGTCGGGGGGGGG + Intergenic
1076071583 10:127494319-127494341 CATGCTCAAGTTTGGGGGGGTGG - Intergenic
1076481234 10:130786521-130786543 CACGCACAGGGAGCGGGGGGGGG - Intergenic
1077049022 11:558434-558456 CATGCGCAGGGTTAGGGTGGAGG + Intronic
1077496328 11:2888263-2888285 CAAGCGCGGGGTTGGGGGGGCGG + Exonic
1078438363 11:11344161-11344183 CAAGGTCAGGGCTGGAGGGGTGG - Intronic
1079643037 11:22830033-22830055 CAAGCCCAGCGGTCGCGGGGCGG - Intronic
1080892623 11:36422532-36422554 CAAGCTCAGAGTTGGGGGTCAGG - Intronic
1082028255 11:47587871-47587893 TAAGCTCAGGGTTGGGAAGGGGG + Intronic
1084760673 11:71268725-71268747 CAAGCCCAGGCTTTGGGAGGAGG + Intergenic
1085454908 11:76660243-76660265 CAGGCTCAGGCTGCGGAGGGAGG + Exonic
1088988466 11:114929760-114929782 CAGGGTCAGGGGTCGGGGAGTGG - Intergenic
1089869601 11:121660393-121660415 AAAGGGCAAGGTTCGGGGGGGGG + Intergenic
1090835995 11:130454293-130454315 CAAGCTCAGGGTTGTGAGAGGGG - Intronic
1091626778 12:2127114-2127136 AAAGCTCAGGGGTGGGGGAGTGG - Intronic
1091723652 12:2830955-2830977 AAGGCTCAGGGCTGGGGGGGTGG - Intronic
1092455053 12:8635782-8635804 CAAGCACAGGGTTGGGGGTAGGG - Intergenic
1095040536 12:37435751-37435773 CAAGCGCAGGATTCAGGGTGGGG - Intergenic
1095726161 12:45455329-45455351 CAAGCTCTAGGTTGGGGGTGCGG - Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097174229 12:57133633-57133655 GATGCTCAAGGTGCGGGGGGTGG - Intronic
1099574454 12:84362381-84362403 CAAGGTCGGGGTTGGGGCGGGGG - Intergenic
1100378798 12:94042717-94042739 GAACCCCAGGGTTTGGGGGGTGG - Intergenic
1100952354 12:99865392-99865414 TAACCTCAGGGGTCGGTGGGAGG + Intronic
1101568299 12:105930539-105930561 CAAGTGCAGGGTGCTGGGGGAGG - Intergenic
1102397540 12:112600073-112600095 CAGGCTCAGGGTTCAGGGTTAGG - Intronic
1102444683 12:112992797-112992819 GATGCTCAGGGTTGGGGGTGGGG + Intronic
1104648209 12:130511966-130511988 CAAGCTCAGGCTTCTGTGAGGGG + Intronic
1106634644 13:31514726-31514748 CGAGATCTGGGTTCGGGGGTGGG + Intergenic
1113573174 13:111373180-111373202 GAAGCTCAGGCCCCGGGGGGAGG + Intergenic
1115310624 14:31974835-31974857 CAAGCTCAGGGATGGAGGTGGGG - Intergenic
1121640549 14:95482014-95482036 AAAGCTCAGGGTGCTGGGTGGGG + Intergenic
1121841994 14:97142333-97142355 CAACCTCAGGGTCCTGGGAGAGG - Intergenic
1122374923 14:101251261-101251283 CAACCTCAGGGCCCAGGGGGAGG + Intergenic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1129298124 15:74610935-74610957 CAAGCTGAGGGTTCTTGGGAAGG - Intronic
1133503745 16:6390312-6390334 CAAGTTCAGGATTTGGGGGTGGG - Intronic
1135563196 16:23492560-23492582 CAAGCTCAGAGTCCAGGGGAGGG + Intronic
1136014363 16:27385844-27385866 CAAGTTCAGGGGTGGGGGTGCGG - Intergenic
1137573226 16:49580011-49580033 GAAGCTCAGGGTCCCGTGGGTGG - Intronic
1138183518 16:54959447-54959469 CAAGCTCAGGGGTTTGTGGGTGG - Intergenic
1140222082 16:73050935-73050957 CCAGCTCAGCGTTAGGGGGCAGG - Intronic
1140743676 16:77962968-77962990 CAATCTTAGGGTTCTGGGTGAGG + Intronic
1141665213 16:85462352-85462374 CAAGCTGAGGGTAGGGAGGGTGG - Intergenic
1141751544 16:85961721-85961743 GAAGCTCGGGGGGCGGGGGGCGG - Intergenic
1142240784 16:88943932-88943954 CACACTCAGGGCTCGGGAGGGGG + Intronic
1142262825 16:89050712-89050734 CAGGCTCAGGGGTGGGGGGCGGG - Intergenic
1142509672 17:385856-385878 CCAGCTCGGGGTGCGGGTGGGGG - Intronic
1142727828 17:1829603-1829625 CAAGCTCAGGGCTTGGAGGCGGG + Intronic
1142765931 17:2064352-2064374 CCAGCTCAGGGTTGAGGGTGAGG + Intronic
1143974490 17:10820034-10820056 CAGGCTCAGGGCTCTGGGGATGG + Intergenic
1144100358 17:11937396-11937418 CAATCTCTGCGTTCGGGTGGAGG - Exonic
1145798642 17:27669998-27670020 CAAGCCCAGGCTTTGGGGGTTGG - Intergenic
1147155697 17:38543630-38543652 AAAGCTCCGGGATCGGGAGGAGG + Intronic
1147402508 17:40189423-40189445 CAAGCTCAGGGCTCTGGGGGAGG + Intronic
1149303597 17:55327840-55327862 CAAGCTCAGGAATCTGGGAGTGG + Intergenic
1150219019 17:63485386-63485408 CATGCTCAGGTTTGGGGGTGGGG - Intronic
1151199066 17:72454408-72454430 CAAGGTCAGGGTTGGGGGTGAGG - Intergenic
1151575030 17:74948890-74948912 CGAGCTCAGGGTACAGGGTGGGG + Intronic
1152618684 17:81350013-81350035 AAGGCTCAGGTTGCGGGGGGAGG + Intergenic
1153319550 18:3759155-3759177 GAAGCTCAGGGTTCAGGGTAGGG + Intronic
1158007717 18:52692112-52692134 CAACCTCAGGGTTGGGAGGAGGG + Intronic
1160007078 18:75075528-75075550 CAACCTGAGGGTTCAGGGAGGGG - Intergenic
1160133392 18:76249788-76249810 CATGCTCAGGGTTCCGGGACGGG - Intergenic
1160556284 18:79727411-79727433 GAAGCGCAGCGTTCGTGGGGTGG + Intronic
1163250658 19:16124712-16124734 CAAGCACGGGGGGCGGGGGGGGG - Intronic
1163693410 19:18749993-18750015 CATGCTGAGGGATCGGGGGAGGG + Intronic
1165295081 19:34920303-34920325 CAAGCACAGGGTTGGGGGTAGGG - Intergenic
1165822653 19:38686378-38686400 TAAGCTCAGGTTTCAGGGTGGGG - Intronic
1166361806 19:42255629-42255651 CAGGCTCAGGGTTGGGGGGTTGG - Intergenic
926088269 2:10033476-10033498 CTGGCCCAGGGTTCGGGGAGAGG - Intergenic
928708663 2:33979876-33979898 CAAGCTCTGGGGTAGGGTGGGGG + Intergenic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
930700953 2:54457114-54457136 CAAGCGCAGGGATGGGGCGGAGG - Intronic
942448001 2:176091359-176091381 TGAGCCCAGGGTTCTGGGGGTGG - Intergenic
947305078 2:228736807-228736829 CAATCTCTGGGTTGGGGAGGAGG - Intergenic
1169871801 20:10255488-10255510 CCAACTCAGGGTTCTGGGGTGGG + Intronic
1171572785 20:26269534-26269556 CAAGCTCAGGATTCAGGGCGGGG + Intergenic
1171805968 20:29680528-29680550 CAAGCGCAGGATTCAGGGCGGGG + Intergenic
1172656604 20:36541870-36541892 CAAGCCCAGAGCTCCGGGGGGGG + Intronic
1174664757 20:52247670-52247692 GAAGCTCAGGGTCTGGGGTGGGG - Intergenic
1175414698 20:58793853-58793875 CATGGTCAGGGTGCGGGGTGGGG - Intergenic
1175573520 20:60041997-60042019 CAAGCACAGGGTTGGGGGTAAGG + Intergenic
1176237371 20:64059884-64059906 CAAGCGCAAGGTTCTGGGGAAGG - Intronic
1176407721 21:6430486-6430508 CAAACTCAGGGTGGGCGGGGAGG + Intergenic
1178604630 21:34025053-34025075 GAAGCTCAGTGATCGGGTGGAGG + Intergenic
1179383980 21:40924741-40924763 CAGGCACAGGGTTGGGGGCGGGG + Intergenic
1179874642 21:44261807-44261829 CAGGCTCAGGGTCCCCGGGGAGG + Exonic
1179930425 21:44567875-44567897 GAAGCTCATGGTGCGGGGGGCGG + Exonic
1180214860 21:46317601-46317623 TCAGCTCAGGGTTCAGGTGGGGG - Intronic
1180574480 22:16759952-16759974 CAAGCGCAGGATTCAGGGCGGGG - Intergenic
1182084831 22:27554441-27554463 CAAGCTCAGGGTTGAGGGTGTGG + Intergenic
1182123700 22:27801815-27801837 CAAGTTCCGGGCTCGGGGCGGGG + Intergenic
1182351352 22:29701797-29701819 TAAGCTCAGGGTGCAGGTGGAGG - Intergenic
1183345277 22:37303976-37303998 CAAGTTCAGGGTCTGGTGGGAGG + Intronic
1183466183 22:37981501-37981523 CAAGCCCAGGGTTCTGGGCTGGG + Intronic
1183483485 22:38077295-38077317 CACGCTCATGATTCGGAGGGAGG + Intergenic
1183605220 22:38863941-38863963 CAAGCTGAGGTTTGGGAGGGTGG - Exonic
1183958943 22:41399354-41399376 GAAACTCAGGGTTGGGGGTGGGG - Intergenic
1184878214 22:47288847-47288869 CCAGCTCCGGGTTAGGGCGGAGG - Intergenic
952205152 3:31173859-31173881 GAAGCTCAGGGGTCCGGAGGAGG - Intergenic
953126536 3:40096061-40096083 AAGGCTCAGGGTTGGGGGTGTGG - Intronic
953374420 3:42416885-42416907 CAAGCACAGGGTTTGGGTTGCGG - Intergenic
954716839 3:52531172-52531194 CAAGTTCAGGGTGTGGGTGGGGG + Intronic
954735995 3:52706739-52706761 CAAACTGAGGGTTGGGAGGGAGG - Intronic
956435630 3:69232056-69232078 CAACCTCAGAGTTCAGAGGGAGG + Intronic
957950663 3:87122037-87122059 CAAGCTCAGGAATCTGGGAGTGG + Intergenic
958798803 3:98733107-98733129 GAGGCTCAGGGTTGGGGGTGGGG + Intronic
960437839 3:117648777-117648799 CATGCTGGGGGTTCGGGGTGGGG + Intergenic
961491263 3:127258079-127258101 CAAGCTCAGGGCCTGGGGGTGGG - Intergenic
963269087 3:143267969-143267991 CAAGCTCAGGGTTTCTGAGGCGG + Intronic
966605634 3:181819168-181819190 CAAGCTCAGGGATCGAGGTCAGG - Intergenic
968084750 3:195869306-195869328 GAAGCCCAGGCTCCGGGGGGCGG + Intronic
968393071 4:208619-208641 CAAGCACAGGGTTGGGGGTAGGG + Intergenic
970195133 4:13544633-13544655 CTGGCTCTGGATTCGGGGGGAGG - Exonic
972095042 4:35338064-35338086 CATGCTCAGAGTTCTGGGGTAGG - Intergenic
974433467 4:61828407-61828429 AAAGCGCAGGGTGCGGGGGATGG + Intronic
981007194 4:139888163-139888185 CAAGCTTGGGGTTTCGGGGGTGG + Intronic
982802984 4:159727061-159727083 AAAGCTCAGGGTATGGGGTGAGG + Intergenic
984011722 4:174380187-174380209 CAAGCACAGGGTTGGGGGTAGGG - Intergenic
985614307 5:910386-910408 ATAGCTCAGGGTTCTGTGGGGGG + Intronic
986270590 5:6227449-6227471 CAAGCACAGGGTTCTGGAGGAGG - Intergenic
990324885 5:54665430-54665452 CATCATCAGGGTTCGGGGGTAGG - Intergenic
994170212 5:96651652-96651674 AAAGCTCAGGGTTTGGAGGTGGG - Intronic
995177645 5:109197459-109197481 CAAGCTCAGGGATGAGGAGGGGG - Intergenic
995646295 5:114316340-114316362 CAAGCTCAGGGGCCAGGAGGGGG - Intergenic
997718472 5:136059549-136059571 GAAGCCCTGGGTTTGGGGGGTGG - Intronic
998063706 5:139139300-139139322 CACGGTCAGGGTTCGAGGGGAGG + Intronic
998950817 5:147391480-147391502 CATCCTCAGGGTTGGGGGGCAGG + Exonic
999319106 5:150602224-150602246 CAGGCTCTGGGTTCTGGTGGTGG + Intronic
1002189873 5:177472857-177472879 CCAGCCCAGGTTTCGGGGGGAGG + Exonic
1003640793 6:7873606-7873628 CAAGCACAGGATTAGGGGGTTGG - Intronic
1007484096 6:42168709-42168731 CCAGCTCAGGGTTGGGGCAGCGG - Intronic
1008378801 6:50820392-50820414 CAACATTAGGATTCGGGGGGGGG - Intronic
1018048778 6:159989288-159989310 CTAGTTCAGGGTTGGGGAGGAGG + Intronic
1019578299 7:1748182-1748204 CAAGCTCAGGTGGCGGCGGGAGG + Intergenic
1022020789 7:26398172-26398194 AAGGCCCAGGGTTCGGGAGGCGG + Intergenic
1022110182 7:27225391-27225413 AAAGCTCAGGCTTCGGGCGGCGG - Intergenic
1025609858 7:63068415-63068437 CATGCTCCGGGCTCGGGGGCGGG - Intergenic
1026402404 7:70028062-70028084 CAAGATGAGGGTGGGGGGGGCGG - Intronic
1026981030 7:74526636-74526658 CAACAGCAGGGTTCGGGGGTTGG + Intronic
1032015933 7:128380478-128380500 CAAGCACAGGGTAAGGGGGATGG + Intergenic
1032398965 7:131610465-131610487 CAAGCTCAGGTTTGGGGGTGGGG + Intergenic
1032804240 7:135339474-135339496 CAACCTCATGGTGCAGGGGGAGG + Intergenic
1037423820 8:18732715-18732737 CCAGCCCAGGCTTCGGCGGGAGG + Intronic
1038103450 8:24406601-24406623 CAAGGTCAGGGGTTGGGGGTGGG - Intergenic
1046252702 8:111653490-111653512 AAAGCTCAGGGGGTGGGGGGAGG - Intergenic
1046934515 8:119873648-119873670 CAAGCTCAAGTTTCTGGGGCCGG + Intergenic
1048324538 8:133428994-133429016 TGAGCTCAGGGTTTGGGGGTAGG - Intergenic
1049358757 8:142201859-142201881 CCAGATCAGGGCTCGGGGTGCGG - Intergenic
1049377878 8:142297637-142297659 CCTGCGCAGGGCTCGGGGGGTGG - Intronic
1051174041 9:14346292-14346314 TTAGCTCAGGTTACGGGGGGGGG - Intronic
1053268061 9:36730359-36730381 CAGGCACAGGGTTCTGGGGCTGG + Intergenic
1059143380 9:111875424-111875446 CAAGCACAGGGTTGGGGGTAGGG - Intergenic
1061217148 9:129228082-129228104 CACGCTAAGTGTTCTGGGGGAGG + Intergenic
1061261766 9:129484071-129484093 CAAGATCAGGGTTCGGGTGCTGG + Intergenic
1192183093 X:68928621-68928643 TAGGCTCAGGGTTCGGGGAGCGG - Intergenic
1197804459 X:130385692-130385714 CTAGCTCAGGGCCCAGGGGGAGG - Intergenic
1199634885 X:149805461-149805483 CAAGGTCAGGATTCTGAGGGAGG + Intergenic
1201472238 Y:14346310-14346332 CAAGGTCAGGGTGGGGTGGGAGG - Intergenic