ID: 905771412

View in Genome Browser
Species Human (GRCh38)
Location 1:40640341-40640363
Sequence AAGCTATTATAGGTGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905771412_905771422 14 Left 905771412 1:40640341-40640363 CCCTTCCCCACCTATAATAGCTT 0: 1
1: 0
2: 0
3: 16
4: 191
Right 905771422 1:40640378-40640400 CCACATCACAGCTTGATTGCTGG 0: 1
1: 0
2: 0
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905771412 Original CRISPR AAGCTATTATAGGTGGGGAA GGG (reversed) Intronic
904664244 1:32107919-32107941 CAGCTACTAAAGGTGGGGAGTGG - Intergenic
904905887 1:33896939-33896961 AAGCCATTGTGGCTGGGGAAGGG + Intronic
905518964 1:38582985-38583007 AACCTGTTAAAGGTGGGCAAAGG + Intergenic
905771412 1:40640341-40640363 AAGCTATTATAGGTGGGGAAGGG - Intronic
906186892 1:43869138-43869160 CAGCTATTGGAAGTGGGGAATGG - Intronic
910155940 1:84219499-84219521 AAGATTTTATGGGTGGGGCATGG - Intronic
911570889 1:99515368-99515390 AAGCTATCAGAGGCTGGGAAGGG + Intergenic
911820249 1:102410224-102410246 AAGCTATTATAATTGGTTAAGGG + Intergenic
915527176 1:156483109-156483131 AAGCTATTACAGAAGGGGAAGGG - Intronic
916262413 1:162855459-162855481 AAGGTAATATAGGTGGGAATGGG + Intronic
916472375 1:165136974-165136996 GAGCTCTTTTATGTGGGGAATGG - Intergenic
916837472 1:168562277-168562299 ATGCTATTAAAAGTGGGCAAAGG + Intergenic
917121392 1:171647691-171647713 ATCCTATTCTAGGTGAGGAAAGG + Intronic
917143811 1:171866022-171866044 AATTTAGTATATGTGGGGAAAGG - Intronic
917335940 1:173924461-173924483 AAGATATTTTAGGTTGGGCATGG + Intergenic
917633509 1:176913618-176913640 AAGCGATTATTGCTGGGGCAGGG + Intronic
919553170 1:199018474-199018496 AAGTGGGTATAGGTGGGGAAAGG - Intergenic
919731640 1:200916666-200916688 GACCTATTATTTGTGGGGAATGG + Intergenic
920888168 1:209954128-209954150 AAGCTATTAAAGGTGTGGTCAGG + Intronic
921901966 1:220460873-220460895 AAGCAATTAAAGGTAGGCAATGG + Intergenic
1064169956 10:13022262-13022284 ATGCCCTTATAGGTGTGGAAGGG - Intronic
1064334579 10:14427156-14427178 AAACTATTAGAGCTGGGAAAAGG + Intronic
1067096277 10:43302796-43302818 ACGTTATTATAGGCTGGGAAGGG + Intergenic
1069299991 10:66895623-66895645 TATCAATTATAGGTGGTGAATGG - Intronic
1073529980 10:104221991-104222013 AATCTAAAGTAGGTGGGGAATGG - Intronic
1074434295 10:113420824-113420846 AAGCTCTGATAGTTAGGGAAGGG - Intergenic
1074959278 10:118425504-118425526 AAGCAATTAAAGGTGAAGAATGG + Intergenic
1075164320 10:120053271-120053293 AAGCTATTATCTGTGGAGCAGGG + Intergenic
1076347761 10:129791769-129791791 AATTTATTATTGGTGGGGAGTGG - Intergenic
1078470362 11:11581421-11581443 CAGCTATTACAGGTGGGCGAGGG - Intronic
1078590915 11:12640386-12640408 AAATTATTACAGGTGTGGAAAGG + Intergenic
1082991027 11:59207252-59207274 AAGAAGGTATAGGTGGGGAAGGG + Exonic
1083000143 11:59283850-59283872 AAGAAAGTATAGGTGGGGAAAGG + Intergenic
1083293843 11:61704777-61704799 AACCTACTACAGGAGGGGAATGG - Intronic
1085657052 11:78325265-78325287 TGTCTATTATAGGTGGGGAGGGG + Intronic
1086020170 11:82218358-82218380 AAGCTAATATCTGTGAGGAATGG - Intergenic
1087900896 11:103639296-103639318 AAGCCTTTCTAGGTGAGGAATGG + Intergenic
1088323733 11:108580883-108580905 AAGATATTAGAGGCTGGGAATGG + Intronic
1089173104 11:116529071-116529093 TAGCTATTAGGGGTGGGGAGAGG - Intergenic
1094714106 12:32994621-32994643 AAGCAATAATTGGTGGGGCAGGG - Intergenic
1095335943 12:41026594-41026616 AAAATATTTTAGGTGTGGAAAGG + Intronic
1095554116 12:43480811-43480833 CAGATATTAGAGGTAGGGAATGG + Intronic
1098007334 12:66011698-66011720 GACCCATTATAGCTGGGGAAAGG + Intergenic
1101167757 12:102055631-102055653 AAGCTTTGATGGGTGGGGCACGG - Intronic
1102158939 12:110753123-110753145 AAGATATTTTAGGCGGGGCATGG + Intergenic
1106581806 13:31025491-31025513 AAGCTATCATAGGAGGGAAGGGG + Intergenic
1112090493 13:96078232-96078254 AAGCTGGTATGGATGGGGAAGGG - Intergenic
1114337184 14:21702398-21702420 AGGCCATTATGGGGGGGGAAAGG - Intergenic
1115174003 14:30541413-30541435 AAGCTATGGTAGATGGTGAAAGG - Intergenic
1116245954 14:42412236-42412258 CAGCTATTATAGGCTGGGCATGG - Intergenic
1116596774 14:46858715-46858737 AAGGTATTATAGGCCGGGCACGG - Intronic
1118084644 14:62400479-62400501 AATATATTACAGGTGAGGAAAGG - Intergenic
1118850355 14:69578279-69578301 AAGCTAGTACAGGTGGGGCTGGG + Intergenic
1119235184 14:73013668-73013690 GAGCTTTTGAAGGTGGGGAAGGG - Intronic
1125863905 15:43024981-43025003 ATGCTATAGGAGGTGGGGAATGG + Exonic
1126213757 15:46131016-46131038 AAGCTATTAAAGGTAGGTACAGG - Intergenic
1128438115 15:67675978-67676000 AGGCTTTTAGAGGTGGGGACTGG - Intronic
1128589195 15:68879549-68879571 AAGATATTTGGGGTGGGGAAGGG + Intronic
1129190625 15:73935540-73935562 AAGCTTCTAGAGGTGGGGTAGGG + Intronic
1130544140 15:84842427-84842449 AAGCAGTTATAGATCGGGAATGG + Intronic
1131310729 15:91287768-91287790 GAGCTTTTAGAGGTGTGGAAAGG + Intronic
1133278348 16:4651439-4651461 AAGCCATGATAGGTGGGAAGGGG + Intronic
1133395885 16:5447160-5447182 AGGTTATTGTAGGTGGGGAGGGG - Intergenic
1135033530 16:19057870-19057892 AAGTTATTATATTTGGGGAGAGG - Intronic
1135141446 16:19925521-19925543 AAGCCATTATAGGCTGGGCAGGG - Intergenic
1137929281 16:52571458-52571480 AAGCTAAAATAAGTGGGGCACGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1140301602 16:73763490-73763512 AAGCTATTAAATGTGGTGAAAGG - Intergenic
1140312521 16:73863279-73863301 AAGCTTTAATAGGTAGGCAATGG + Intergenic
1140953285 16:79839396-79839418 AAGAGATTTAAGGTGGGGAATGG + Intergenic
1146134290 17:30305049-30305071 AAGTGATAATAGCTGGGGAAAGG + Intergenic
1150927730 17:69551304-69551326 AAGGTGTTGTAGGTGGAGAAGGG + Intergenic
1154234788 18:12594596-12594618 CAGCTATTATTGTTGGGGAATGG + Intronic
1154301889 18:13201360-13201382 ATGCTATTTTAGATGGGGAAAGG - Intergenic
1155406067 18:25488355-25488377 TAGCCAATATAGGTGGGGCATGG - Intergenic
1157047119 18:44114977-44114999 AAGATATTGAAGGTGGGGCAAGG + Intergenic
1159990653 18:74903020-74903042 AGGGTATTAGAGGTGGGGCAAGG - Intronic
1160234706 18:77076884-77076906 AAGCTATTAAGGGTGGGGTTGGG - Intronic
1163626704 19:18394258-18394280 AAGCTTTTCTAGGTTGGAAAAGG - Intronic
1165020970 19:32923952-32923974 AAGCTAGATTTGGTGGGGAAGGG + Intronic
1166150900 19:40875190-40875212 AAGCTGTTTTACGTGAGGAATGG + Intronic
1166179420 19:41096421-41096443 AAGCTATTTTACGTGAGGAAGGG - Intergenic
1167635963 19:50655944-50655966 AAGCTATTCTGGGTGTGGCATGG + Intronic
925387744 2:3474044-3474066 AAGCCATTACAGATGGGCAATGG - Intronic
927769612 2:25848320-25848342 AAGCTATTAGAAGTGGAGACCGG + Intronic
928167485 2:28981564-28981586 CATCTATTGTAGGTGGTGAATGG + Intronic
928173170 2:29016437-29016459 AAGATATTATCACTGGGGAAGGG + Intronic
928502524 2:31912041-31912063 AAGCAATTATAGGCTGGGAGCGG + Intronic
929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG + Intronic
931128312 2:59302408-59302430 AAGGGATTGTTGGTGGGGAAGGG + Intergenic
935340359 2:102053979-102054001 AAGCTATTCTAGCTGGGGTACGG + Intergenic
935703106 2:105830233-105830255 AGGTTACTAGAGGTGGGGAAGGG - Intronic
936559060 2:113520694-113520716 AAGCCTCCATAGGTGGGGAAGGG + Intergenic
937936083 2:127246665-127246687 AAAATATTATAGGTGAGAAATGG - Intergenic
938398763 2:130970296-130970318 AAGCCATTCTAGGTTGGGCATGG + Intronic
939306253 2:140415658-140415680 AAACTATGGTAGGTGAGGAATGG - Intronic
944500404 2:200353556-200353578 TAGCTATTGGAGGTAGGGAATGG - Intronic
944629157 2:201605652-201605674 AAGCTATTATAGGGAGAAAATGG + Intronic
945598177 2:211822126-211822148 AAGATATTAGAGGTTGGGAAGGG + Intronic
945790369 2:214296711-214296733 AAACTATTATCAGTGGGCAAAGG - Intronic
945808578 2:214520212-214520234 AAGCAAGTATATATGGGGAATGG - Intronic
947555919 2:231093057-231093079 ATGTTATTAGAGGTTGGGAAGGG + Intronic
948702066 2:239766743-239766765 AAGATATTGTCAGTGGGGAAGGG + Intronic
1169848816 20:10027186-10027208 ATGCTTTTTTAGGTTGGGAAAGG + Intronic
1170490682 20:16870834-16870856 TAGATAGTCTAGGTGGGGAAAGG - Intergenic
1172070873 20:32255977-32255999 AATCTATTTTAGGTCGGGCACGG + Intergenic
1176066573 20:63200068-63200090 AAGCTATTTGAGGCGGGGCACGG + Intronic
1177963994 21:27704220-27704242 AAGCTAATTTAAGTGGGGCATGG - Intergenic
1180978388 22:19864688-19864710 AGGCTATTAGAGCTGGGGGAAGG + Intergenic
1181865263 22:25849746-25849768 GAGCTATTATAGGAGAGGACAGG - Intronic
1182574052 22:31261023-31261045 AAGCTATTGTAGGCTGGGCATGG + Intronic
949301457 3:2589071-2589093 ATGCTATTATGGATGGGGAGAGG - Intronic
949652271 3:6173639-6173661 AAGTTTTTATAGGTAGGGAAAGG + Intergenic
952803276 3:37318335-37318357 AAGATAATATGGGTGGGGCATGG - Intronic
952989566 3:38820067-38820089 AAGATATTATAATTGGGGAAAGG + Intergenic
953295975 3:41717163-41717185 AATGTATTATAGGTGGGTGACGG + Intronic
955047226 3:55371931-55371953 CTGGTATTCTAGGTGGGGAAAGG + Intergenic
955271148 3:57500578-57500600 TAGATTTTATAGGTGGAGAAGGG - Intronic
955600047 3:60635480-60635502 CAGGTAGTAGAGGTGGGGAAAGG - Intronic
956612782 3:71141418-71141440 AAGCTCTTAAAAGTGGGGGAGGG - Intronic
958597411 3:96245388-96245410 AAGCTATGGTAGGTAGTGAAAGG + Intergenic
959806162 3:110556482-110556504 AAGCTATTTTAATTGGGGTAAGG + Intergenic
960272355 3:115688982-115689004 AAGCTATTAGGGCTGGAGAATGG - Intronic
960745176 3:120879898-120879920 CTACTATTATAGTTGGGGAAAGG - Intergenic
961735239 3:128997289-128997311 AAGCTGTTAAAAATGGGGAAGGG - Intronic
961834426 3:129645076-129645098 AAGCCATTACAGGTGTTGAAAGG - Intergenic
963366051 3:144336045-144336067 AAGCCTTTCCAGGTGGGGAATGG + Intergenic
963563623 3:146899742-146899764 AAGCTATCATGGGTGAGGTATGG - Intergenic
963635257 3:147786788-147786810 AAGGTATTAGAGGTTGGGAGTGG + Intergenic
964367958 3:155969868-155969890 AAGCTAGAATAGGAAGGGAATGG - Intergenic
965329561 3:167353816-167353838 AAGCTAATAGTGGTGGGGACAGG + Intronic
966495333 3:180573659-180573681 AAGCTTTTAAAGTTGGGGACTGG + Intergenic
967516802 3:190379408-190379430 AAGATATTCTAGTTGGGGGAGGG - Intronic
967555929 3:190858860-190858882 AAGATATTAGCAGTGGGGAATGG + Intronic
967814941 3:193790573-193790595 AAGGCATTCTAGGTGGGGGAAGG + Intergenic
971530371 4:27680391-27680413 AAGCTTTTATAGGTGAGGATTGG - Intergenic
971631119 4:28995161-28995183 AAGCTATGAAAAGTGGGGAATGG - Intergenic
971734982 4:30436560-30436582 AAGCTGTCATGGGTCGGGAATGG + Intergenic
972428935 4:38961792-38961814 TAGTTATTAGAGGTTGGGAAGGG - Intergenic
973948303 4:55983808-55983830 AGGCTATTACAGGTCGGGCATGG - Intronic
974776504 4:66490004-66490026 ATGTTTTTATAGTTGGGGAAGGG + Intergenic
975509742 4:75181071-75181093 AAGCCATGGTAGGTGGGGAGAGG + Intergenic
976211671 4:82677468-82677490 AAGTCATTATATGTGGGGATAGG - Intronic
980874777 4:138650587-138650609 AAGCAATAATATGTGTGGAAGGG + Intergenic
981394409 4:144230095-144230117 AAGCAGTTATAGGTAGAGAATGG + Intergenic
981410979 4:144431553-144431575 AAGTAATAATAGGAGGGGAAGGG - Intergenic
982137336 4:152284293-152284315 AAGCCATTATAGGCTGTGAAGGG - Intergenic
982961349 4:161841727-161841749 AAGCTATTTTAGGAGTAGAAAGG + Intronic
983697669 4:170552573-170552595 AAGCTATAATAGATTGGGAAGGG + Intergenic
983967786 4:173834172-173834194 AATAGATTACAGGTGGGGAAAGG + Intergenic
986775532 5:11010680-11010702 AAGTAATTATAGATGGGTAAGGG - Intronic
987461348 5:18214856-18214878 AAGACAGTATAGGTTGGGAAGGG - Intergenic
989028440 5:37092152-37092174 ATGTTATTATAGGCTGGGAAGGG - Intergenic
991185631 5:63803482-63803504 AAACTATTAAAGTTGGGGAGGGG + Intergenic
991434834 5:66587210-66587232 AAGCTATTATTGTTGGGGCAGGG - Intergenic
992450862 5:76874600-76874622 AAGCATTTATACGTGGGGGAGGG - Intronic
993211464 5:84957765-84957787 AAGATATTATATGAGGGAAAAGG - Intergenic
995544485 5:113216241-113216263 AAGTTATAATAGGTAGGGCAAGG - Intronic
995946180 5:117649118-117649140 AAGAAATTAAAGCTGGGGAAAGG + Intergenic
998506104 5:142674135-142674157 AAGCTATTATACATTGGGAGGGG - Intronic
999107433 5:149086188-149086210 AGGCTGTTATAGGTGTGAAAAGG - Intergenic
999197389 5:149791783-149791805 AAGTTGTTAAAGGTAGGGAAGGG - Intronic
1000271839 5:159692903-159692925 TAGTTATTAGAGGTCGGGAAGGG + Intergenic
1007970388 6:46046261-46046283 AAGCTATCAGAGGAGGAGAAAGG - Intronic
1010439219 6:75874184-75874206 AAGCTTATATAGTTGGGGAGAGG - Intronic
1010699194 6:79021707-79021729 TGGCTATTATAGGCTGGGAAAGG + Intronic
1011408654 6:87042805-87042827 AGGCTACTAGAGGTTGGGAAGGG + Intergenic
1012064248 6:94529344-94529366 AAGCTATTAAAGAAGGAGAAAGG - Intergenic
1012903217 6:105031935-105031957 CAGGGGTTATAGGTGGGGAAGGG - Intronic
1017048687 6:150370822-150370844 AAGCTATCATAAGTGGGTGAGGG + Intronic
1017784328 6:157742288-157742310 AAGCTATTACGGGTTGGGAGAGG + Intronic
1023678926 7:42663488-42663510 AGGCTATTATATGTGGGCAATGG - Intergenic
1025958719 7:66202504-66202526 TAGGTCTTATAGGTGGGGGAAGG + Intergenic
1027391633 7:77709578-77709600 AAGTAACTATTGGTGGGGAACGG - Intronic
1030167562 7:106570370-106570392 AAGAAATTTTGGGTGGGGAAGGG + Intergenic
1031589327 7:123570341-123570363 TAGCTCTTATAAGTGGTGAAAGG + Intronic
1031860801 7:126978149-126978171 AATGTATTATAGGAGGGGAGAGG + Intronic
1033302156 7:140196246-140196268 AAGATATTTCAGTTGGGGAAAGG + Intergenic
1036393267 8:8344161-8344183 AAACTCTTATAAGTGGAGAAAGG + Intronic
1037044604 8:14282753-14282775 AAGAGCTAATAGGTGGGGAAAGG - Intronic
1037149766 8:15622421-15622443 AGGCTCTTATAGGCTGGGAATGG - Intronic
1039034041 8:33340078-33340100 ATTCTATTATAAGTGGAGAAGGG + Intergenic
1040455009 8:47588552-47588574 AAGACAAGATAGGTGGGGAAAGG - Intronic
1042750618 8:72153910-72153932 ATGCTATTTAAGGTGGGGAAAGG - Intergenic
1042874283 8:73426473-73426495 AGGATATTAGAGGTTGGGAAGGG - Intronic
1043841616 8:85111753-85111775 TAGCTATTCTAGGTGTGAAACGG - Intronic
1045058082 8:98386453-98386475 ATACTATTAAAAGTGGGGAAAGG + Intergenic
1048261408 8:132948521-132948543 AAGCTCTCATAGGGAGGGAAAGG + Intronic
1049893792 9:95487-95509 AAGCCTCCATAGGTGGGGAAGGG - Intergenic
1052277226 9:26690757-26690779 AAGATATAATAAGTGGGGTAAGG + Intergenic
1053508693 9:38668750-38668772 CAGGCATAATAGGTGGGGAATGG + Intergenic
1053524859 9:38818076-38818098 AAGCTAATATGGGTAGGCAAAGG - Intergenic
1053735017 9:41095571-41095593 AAGCCTCCATAGGTGGGGAAGGG - Intergenic
1054197093 9:62042492-62042514 AAGCTAATATGGGTAGGCAAAGG - Intergenic
1054641315 9:67546202-67546224 AAGCTAATATGGGTAGGCAAAGG + Intergenic
1054693365 9:68335826-68335848 AAGCCTCCATAGGTGGGGAAGGG + Intronic
1056250526 9:84743089-84743111 AAGCTAATATAGGCCGGGCATGG - Intronic
1056536403 9:87531462-87531484 AAGCCTTTGTAGGTGGTGAAGGG + Intronic
1057323499 9:94036751-94036773 TGGCTACTATAGGTGGAGAATGG + Intronic
1061345668 9:130023061-130023083 AAGATATTATAAGTGGTAAAAGG + Intronic
1189059977 X:37742869-37742891 AAGCTATTTTAGGCAGGGCATGG - Intronic
1191210217 X:57876569-57876591 ACGTTATTATAGGCTGGGAAAGG - Intergenic
1191210587 X:57880886-57880908 TAGATACTATAGGTTGGGAATGG + Intergenic
1193600791 X:83507071-83507093 AAGCTTTTATAAGTTAGGAAAGG - Intergenic
1195553777 X:106198258-106198280 CAGGTGTTACAGGTGGGGAAGGG - Intronic
1195926589 X:110031781-110031803 TAGTTACTAGAGGTGGGGAAAGG - Intronic
1197248008 X:124186309-124186331 AAACTATCCAAGGTGGGGAAGGG - Intronic
1202058371 Y:20859726-20859748 ATGCTGTTATAAGTGTGGAAAGG + Intergenic