ID: 905776012

View in Genome Browser
Species Human (GRCh38)
Location 1:40667582-40667604
Sequence CAGAAGGACTGGATGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 9, 3: 58, 4: 517}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905776012 Original CRISPR CAGAAGGACTGGATGGGAGG TGG Intergenic
900240970 1:1617025-1617047 CAGATGGGCAGGATTGGAGGTGG + Intronic
901658359 1:10783444-10783466 CAGAAGGAAAGGATGTGAGGGGG + Intronic
901676874 1:10890529-10890551 CGGGAAGGCTGGATGGGAGGAGG + Intergenic
901786793 1:11630052-11630074 CACAGGGGCTGTATGGGAGGAGG + Intergenic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
902334381 1:15746739-15746761 CAGGAGGATGTGATGGGAGGAGG + Intronic
902440861 1:16429053-16429075 GAGAGGGCCTGGAGGGGAGGAGG - Intronic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
904358939 1:29960094-29960116 CAGATGGAGTGGTTGGGATGAGG - Intergenic
904378514 1:30096219-30096241 CAGATGGAGTGGCTGGGATGAGG + Intergenic
904946460 1:34202313-34202335 GAGAAGGAGTGGCTGGCAGGGGG + Intronic
905279156 1:36837809-36837831 CAGAAGCTCTGGATGGCAGATGG + Intronic
905302966 1:36998065-36998087 CTGAATGAATGAATGGGAGGGGG + Intronic
905321628 1:37121370-37121392 CAGAAGGAGAGGTTGGGAAGGGG - Intergenic
905409406 1:37757937-37757959 CTCTAGGACTGGAAGGGAGGAGG - Intronic
905516523 1:38565877-38565899 GAGAAGCACAGGATGGGAGATGG - Intergenic
905719610 1:40185867-40185889 CACAAAGGCTGGATGCGAGGTGG + Intronic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
906202252 1:43967690-43967712 GAGAAGGGGTGGATGGGATGGGG - Exonic
906240984 1:44242156-44242178 AGAAAGAACTGGATGGGAGGGGG + Intronic
906603472 1:47148804-47148826 CAGGAAGACAGGATGGCAGGTGG - Exonic
906694220 1:47813317-47813339 AAGGAGGACCGGATTGGAGGGGG + Intronic
907337491 1:53709943-53709965 CAGATGTACAGGATGGGAGGGGG + Intronic
907536869 1:55170058-55170080 CAGGAGGTCTGGTTGGGAAGGGG + Intronic
907961554 1:59288186-59288208 CAGAAGGACTGAATGGTGAGGGG - Intergenic
909069717 1:70980083-70980105 AAGAAGAACTGGAAGGGAGGCGG + Intronic
909913234 1:81286029-81286051 CACAAAGACTGGATGGAATGTGG + Intergenic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
912226823 1:107743248-107743270 AAGAAGGACTGGTTGGGAAGAGG + Intronic
912548708 1:110470134-110470156 AAGAAGGAAGGGAAGGGAGGAGG - Intergenic
912557428 1:110526294-110526316 CAGAGAGACTAGATGGGAGAAGG - Intergenic
912704739 1:111903678-111903700 CACACTGACTGGCTGGGAGGGGG + Intronic
912811738 1:112800302-112800324 CTGATGGACTGGATGGGGGCAGG - Intergenic
913966861 1:143383747-143383769 CTGAGGGACTGGATGGGAGGGGG + Intergenic
914061237 1:144209354-144209376 CTGAGGGACTGGATGGGAGGGGG + Intergenic
914117913 1:144757015-144757037 CTGAGGGACTGGATGGGAGGGGG - Intergenic
914829446 1:151159988-151160010 GAGAGGGTCTGGAGGGGAGGGGG + Exonic
915294257 1:154909071-154909093 CAGGAGGAAGGGATGGGAGGAGG + Intergenic
915528140 1:156488621-156488643 AAGGAGGACTGGTTTGGAGGGGG + Intronic
916295371 1:163213435-163213457 CAGAAAGAATGGAGAGGAGGGGG - Intronic
916549541 1:165836950-165836972 CAGAAGGGCAGGAGGAGAGGAGG + Intronic
917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG + Intergenic
917294806 1:173507531-173507553 CATAAGAATTGGGTGGGAGGTGG - Intronic
918416960 1:184320031-184320053 GAGCAGGACTGGAGGGGTGGGGG - Intergenic
919525790 1:198648529-198648551 CAGCAGGACTGAATGGGAGCTGG + Intronic
919924809 1:202186729-202186751 CTGAAGGAGTGGGAGGGAGGTGG + Intergenic
920420914 1:205832676-205832698 CAGAAGGGCTGACGGGGAGGGGG + Exonic
921064333 1:211611970-211611992 GAGAAGAACTGGGTGAGAGGGGG + Intergenic
921090462 1:211837002-211837024 CAGAAGGCTTGGATAAGAGGGGG - Intergenic
921668510 1:217901217-217901239 CAGAAGGACTGGAAGTGGGGAGG + Intergenic
922061962 1:222101367-222101389 CTGAAGGAGTGGAGCGGAGGTGG - Intergenic
922562617 1:226580150-226580172 CAGATGGGCTGTGTGGGAGGAGG + Intronic
923051636 1:230394569-230394591 CACAAGGAGAGGAGGGGAGGGGG - Intronic
923094221 1:230761763-230761785 CAGAAGGAACGGGTAGGAGGTGG + Intronic
923404100 1:233643512-233643534 GAGAAGCACTGCCTGGGAGGAGG - Intronic
1062790835 10:304504-304526 GAGAAGGATTTGCTGGGAGGGGG - Intronic
1062935098 10:1379661-1379683 CAGAAGTAGAGGAGGGGAGGAGG + Intronic
1063870151 10:10408770-10408792 CAGTGGGACTTGTTGGGAGGTGG - Intergenic
1064219396 10:13427648-13427670 CAGAAAGAGGGGGTGGGAGGGGG + Intergenic
1064322615 10:14319995-14320017 CATCAGGATTGGATGGGAGATGG - Intronic
1065497758 10:26347564-26347586 CATGAGGACTGCCTGGGAGGAGG - Intergenic
1065708278 10:28491252-28491274 GTGTAGGACTGGAAGGGAGGAGG + Intergenic
1065761370 10:28986317-28986339 TTGGAGGACTGGATGGCAGGTGG - Intergenic
1066071719 10:31822358-31822380 CAGAAGGACTTGATGGAAAAGGG + Intronic
1066626283 10:37409151-37409173 CACCAGGACAGGTTGGGAGGTGG + Intergenic
1067601837 10:47612126-47612148 GAGAAGGGCTGGATTGGAGTGGG + Intergenic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1068393967 10:56437124-56437146 CAGAAGGACAGAAGGGTAGGAGG + Intergenic
1069551339 10:69366557-69366579 GTGGAGCACTGGATGGGAGGTGG - Intronic
1069607654 10:69749827-69749849 CAGACAGACTGGAAGGGAAGAGG + Intergenic
1069957536 10:72061152-72061174 GAGGAGAACTGGATGGGTGGGGG + Exonic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1071302684 10:84268185-84268207 CAGTAGGGCTGGCTGGGATGGGG + Intergenic
1071316542 10:84406249-84406271 CAGAAGGTATGGATGGGAGGAGG + Intronic
1072051837 10:91712460-91712482 CAGAAGGACTGCATAGGAAGAGG - Intergenic
1073140397 10:101243420-101243442 GAGAAGGAGTGGAGGGGATGAGG + Intergenic
1073544337 10:104336261-104336283 CAGCAAGACTGGATGAGAGAAGG + Intronic
1074549116 10:114426887-114426909 CATTTGGACTTGATGGGAGGGGG + Intergenic
1075087473 10:119423139-119423161 AAGAAGGAAGGGAAGGGAGGTGG - Intronic
1075449275 10:122537609-122537631 GAGAATCACTTGATGGGAGGAGG + Intergenic
1075632477 10:124009405-124009427 CACAAGGACAGAATAGGAGGAGG + Exonic
1075698708 10:124454447-124454469 CAGAGGGAGTGGGGGGGAGGGGG + Intergenic
1076043293 10:127269846-127269868 CCCAAGGACTGCATGGGTGGTGG - Intronic
1076183259 10:128427184-128427206 GAGAAGGACTGGAATGCAGGAGG - Intergenic
1076449693 10:130548411-130548433 CAGAAGAACTGCATTGTAGGAGG + Intergenic
1077145541 11:1042667-1042689 GAGCAGGACTGGGTGGGGGGTGG + Intergenic
1077554098 11:3217756-3217778 CAGCAGGCCTGGCTGGGGGGTGG + Intergenic
1077895257 11:6448951-6448973 AAGAGGGTCTGGCTGGGAGGTGG - Exonic
1078080318 11:8199685-8199707 CAGCTGGACTGGGTGGGAGTGGG + Intergenic
1078847142 11:15128612-15128634 CATAAGGACTGCATGGGATAGGG + Intronic
1079660912 11:23035563-23035585 CAGCAGGACGGAAGGGGAGGTGG - Intergenic
1080624519 11:34016431-34016453 AAGAAGGACTTTGTGGGAGGGGG + Intergenic
1080650620 11:34220059-34220081 CAGAGGGACTGAAGGGGTGGAGG + Intronic
1081620700 11:44617733-44617755 CACAAGGACTAAATGGGATGAGG - Intronic
1082009805 11:47442273-47442295 CAGATGGATTGGAAGGGAGTGGG + Intronic
1084493440 11:69490391-69490413 AAGAAGAACTGGATGAAAGGCGG - Intergenic
1084575186 11:69984615-69984637 CAGCAGGCCTGGTGGGGAGGAGG + Intergenic
1086252100 11:84828144-84828166 CAAAAGGACTGGATAGGCAGGGG + Intronic
1086412721 11:86558502-86558524 CAGAAGCAATGGATGGTATGAGG + Intronic
1086888416 11:92227628-92227650 GAGAAGGAAAGGAAGGGAGGAGG + Intergenic
1086961526 11:92983546-92983568 TAGAAGGACAGGAAGGGAAGGGG + Intronic
1088068617 11:105753852-105753874 TAGAAGAAATGGATGGGAAGAGG + Intronic
1088484976 11:110331961-110331983 CAGAAAAACTGGATGGTAGTAGG + Intergenic
1089301229 11:117499901-117499923 CCGAGGGTCTGGATGGGAGTCGG - Intronic
1089309080 11:117545981-117546003 AAGAATGGATGGATGGGAGGCGG + Intronic
1089567415 11:119379014-119379036 CAGGGGCACTGGATGGGAGCTGG + Intronic
1089641914 11:119853352-119853374 GAGGAGGAATGGGTGGGAGGTGG - Intergenic
1090226188 11:125073491-125073513 AAGAAGGACTGGAGGGGTGGAGG - Intronic
1090387436 11:126365088-126365110 CAGGAGGACTGGGTGGCGGGTGG + Intronic
1090390002 11:126382286-126382308 CAGGAGGACTGGGTGGCGGGTGG + Intronic
1090500403 11:127255370-127255392 CAGAAGGAGTGAGAGGGAGGAGG + Intergenic
1090556556 11:127882904-127882926 AAGTAGGAAGGGATGGGAGGCGG + Intergenic
1090809254 11:130222223-130222245 CAGAAGAAGGGGATGGGAGTAGG - Intergenic
1090933325 11:131319400-131319422 GAGAAGGAGGGGAGGGGAGGGGG - Intergenic
1091453554 12:588230-588252 CAGAAGGGAGGGAAGGGAGGAGG + Intronic
1091616254 12:2053138-2053160 CAGGAGGACTCGCTGGGAGTGGG + Intronic
1092178140 12:6425069-6425091 GAGAAGCACTGGATGTGAAGTGG - Intergenic
1092968482 12:13668986-13669008 GAGAGGGAATGGAGGGGAGGTGG + Intronic
1095382112 12:41607407-41607429 CTGAATGAATGGAGGGGAGGGGG + Intergenic
1095735225 12:45548714-45548736 AAGAAGGACTGGATAGGAGAAGG + Intergenic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1096196075 12:49649602-49649624 CAGAAGGACTGGAAGGGCAGGGG + Intronic
1096501593 12:52067164-52067186 TCGAAGAACTGAATGGGAGGGGG + Intergenic
1096838847 12:54369225-54369247 CAGAAAGAGTTGATGGGAAGGGG + Exonic
1097147424 12:56951490-56951512 CAGAAGCAGTGGCTGGGAGGTGG - Exonic
1097191792 12:57222821-57222843 GAGGAGGGATGGATGGGAGGGGG + Intronic
1097776424 12:63651972-63651994 CAGAAAGGCTGGATGGAAAGTGG - Intronic
1098179661 12:67832708-67832730 GAGAGGGACAGGAAGGGAGGAGG - Intergenic
1100176894 12:92041072-92041094 TAGAAGGACTGGTTTGGGGGAGG - Intronic
1100270366 12:93018867-93018889 CCTAAGGACAGGATGGGTGGAGG - Intergenic
1100587870 12:95996148-95996170 CAGCAGGTCTGGATGGAAAGTGG - Exonic
1101536769 12:105625039-105625061 CAGATGGACTGACTGGCAGGAGG + Intergenic
1101700738 12:107171498-107171520 CAGAAGGAGTGGATGGGGGATGG - Intergenic
1101883606 12:108642485-108642507 CAGGAGGGCTGGGTGGGAGATGG - Intergenic
1102030896 12:109739590-109739612 CAGAAGGAAGGGGTGAGAGGAGG - Intronic
1102820753 12:115907346-115907368 CAGAAGGAAAGGGTGGGAAGGGG + Intergenic
1103848435 12:123915507-123915529 CGGAAGGACTGGAGGGGTGATGG - Intronic
1104757791 12:131279664-131279686 GGGCAGCACTGGATGGGAGGTGG - Intergenic
1104762429 12:131305461-131305483 CTGAAGGGCAGGATTGGAGGTGG - Intergenic
1104817348 12:131655335-131655357 CTGAAGGGCAGGATTGGAGGTGG + Intergenic
1105564572 13:21531523-21531545 CAAAGTCACTGGATGGGAGGAGG + Intronic
1106484272 13:30158743-30158765 CAGAATGGCAGAATGGGAGGAGG + Intergenic
1106755505 13:32819353-32819375 CAGAATTGCTTGATGGGAGGCGG - Intergenic
1107630009 13:42333689-42333711 CCAAGGGACTGGATTGGAGGAGG + Intergenic
1107662336 13:42651529-42651551 CAGAAGGAGGGGAAGGGAGAGGG - Intergenic
1108206458 13:48095029-48095051 GAGAAGGAGCGGCTGGGAGGCGG - Exonic
1108515933 13:51202604-51202626 CCCAAGGACTGGCTGGGAAGAGG + Intergenic
1108728191 13:53203562-53203584 CAGATGGACTGGATAGAATGAGG - Intergenic
1109523708 13:63546124-63546146 CACAAGGTCAGGATGAGAGGAGG - Intergenic
1110845273 13:80185401-80185423 AAGCTGGACTGGATGTGAGGAGG - Intergenic
1111309091 13:86457875-86457897 CAGAAGGACTTTATGTGTGGAGG + Intergenic
1114225068 14:20730632-20730654 CTGATAGACTGGATGGAAGGAGG - Intergenic
1114518954 14:23321232-23321254 CCTAAGGACTCGATAGGAGGTGG + Intronic
1115471530 14:33773418-33773440 CAGAAGGAAGGGCTGGGTGGGGG - Intronic
1115521686 14:34239388-34239410 CAGAAAGACTGCAGGGGATGGGG + Intronic
1115772250 14:36676537-36676559 CAGAAGGGTTGGAGGGCAGGAGG - Exonic
1116157259 14:41221662-41221684 CTGAAGGACTGAAGGGGAGGAGG + Intergenic
1116841879 14:49827038-49827060 CAGAAAGAGTGTATGAGAGGAGG + Intronic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1119666558 14:76489199-76489221 CAGACAGACTGGAGGGGAGATGG - Intronic
1119986872 14:79148191-79148213 AAGAGTGACTGGATGGGAGGAGG + Intronic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1121026267 14:90618643-90618665 CAGAAGGTCTGGATGGAGGGTGG - Intronic
1121275864 14:92667085-92667107 CAGAGGAATTGGATGGGAGGGGG + Intronic
1121283292 14:92714835-92714857 CAGGAGGCCTGGAGGGGGGGAGG - Intronic
1121326096 14:93020364-93020386 CAGAAGCAGTGGATTGGAGATGG - Intronic
1121442586 14:93958180-93958202 CAGAAGCAGGGGATGGGAGAAGG - Intronic
1121447696 14:93988701-93988723 CGGAAGGAGGGGATGGGAGAGGG + Intergenic
1121846164 14:97173881-97173903 CAGAAGGAGTGAATGGGACATGG + Intergenic
1121980654 14:98451114-98451136 AAGCAGGACTGGGTGTGAGGAGG + Intergenic
1122030156 14:98906208-98906230 GAGGGGGACTGGATGGCAGGTGG - Intergenic
1122806730 14:104263465-104263487 CTGAAGGACAGGGTGGGGGGGGG + Intergenic
1122900733 14:104781370-104781392 CAGCAGGACTGGGTGGTGGGTGG - Intronic
1122985016 14:105208055-105208077 CACAATGGCTGGAGGGGAGGTGG - Intergenic
1123054405 14:105562257-105562279 CAGCAGGAGGGGATGGGAGACGG + Intergenic
1123078989 14:105682676-105682698 CAGCAGGAGGGGATGGGAGACGG + Intergenic
1125800193 15:42439277-42439299 CAGCAGGACTGGTCGGGAGCAGG - Exonic
1126859395 15:52869624-52869646 CAGAAGGACTGGTTAGAATGGGG + Intergenic
1127303750 15:57682454-57682476 CGGAAGCACTTGATGGGAAGTGG - Intronic
1128124942 15:65185356-65185378 GAGAAGGAGGGGAAGGGAGGGGG - Intergenic
1128245813 15:66132081-66132103 CAGAAGCCCTGGACAGGAGGAGG - Intronic
1128525775 15:68411344-68411366 AAGAAGGAGTGTGTGGGAGGGGG - Intronic
1128898599 15:71398505-71398527 CAGAAGGAGTGAAAGGGAGGAGG + Intronic
1128905104 15:71460467-71460489 CAGTAGGGCTGGATGGCATGTGG + Intronic
1129184765 15:73899379-73899401 CCGGAGGACTGGATTTGAGGAGG - Intergenic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129392763 15:75228816-75228838 CAGGCTGAGTGGATGGGAGGGGG + Intergenic
1129670783 15:77606607-77606629 GAGCAGACCTGGATGGGAGGAGG - Intergenic
1129849373 15:78783155-78783177 CTGAAGGACTGGTTTGGATGGGG - Intronic
1130226093 15:82059152-82059174 GAGAAGGAGAGGAGGGGAGGGGG - Intergenic
1131073965 15:89483435-89483457 GAGATGGGCTGCATGGGAGGTGG - Intronic
1131578264 15:93614023-93614045 CACAAGGGCTGGAGGAGAGGAGG + Intergenic
1132196848 15:99919888-99919910 AAGAAGGAATGGATGTGATGGGG - Intergenic
1132361227 15:101217602-101217624 CAGAAGGAAGGGATGGAGGGAGG + Intronic
1132609859 16:810255-810277 CAGAAGGAAGGGAGGGGAGAGGG + Intronic
1132667573 16:1089215-1089237 GAGCAGGGCTGGATGGGAGATGG - Intergenic
1132805936 16:1775155-1775177 CAGCAGGGCTGGCTGGGACGGGG + Intronic
1133282849 16:4676968-4676990 CTGCAGGACAGGATGGCAGGCGG - Intronic
1133388762 16:5392126-5392148 CAGGGGGAAAGGATGGGAGGAGG + Intergenic
1133890127 16:9871122-9871144 CAGGAGGACAAGATGGGAGCAGG - Intronic
1134037328 16:11040878-11040900 CAAAGGGACTGGCAGGGAGGTGG + Intronic
1134124951 16:11610134-11610156 CAGGAGGACTGGGTGGTGGGGGG + Intronic
1134624597 16:15714653-15714675 CCGGAGGACCGGATGGGAGACGG + Intronic
1135294010 16:21263785-21263807 CAGAGGGACTGGATTAGATGTGG + Intronic
1136030897 16:27502212-27502234 AACGAGGACTGAATGGGAGGGGG - Intronic
1136054583 16:27678912-27678934 GAGAAGGACTTGATGGGGAGAGG + Intronic
1136547906 16:30965777-30965799 CATCAGGTCTGGGTGGGAGGAGG - Exonic
1136991821 16:35157202-35157224 CAGAAGGGGAGGGTGGGAGGTGG + Intergenic
1137478743 16:48833512-48833534 CAGAAGGGCTTGAGGAGAGGTGG + Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138224729 16:55282843-55282865 CAGAAGGAATGGGAGAGAGGAGG + Intergenic
1139054838 16:63170276-63170298 TAGAAGGACTGGAAGTGGGGAGG + Intergenic
1139968135 16:70756827-70756849 CAGGAGGAAAGGATGGTAGGGGG - Intronic
1140519936 16:75572299-75572321 CAGCAGGGCAGGATGGGTGGTGG - Intronic
1140955917 16:79865161-79865183 CAGAGGCACTGGAAGGGAGATGG - Intergenic
1141423306 16:83930899-83930921 CAGCAGGGCTGCCTGGGAGGAGG + Intronic
1142377913 16:89716437-89716459 AAGATGGACAAGATGGGAGGTGG - Intronic
1142408461 16:89904103-89904125 CAGGAGGACTGCAGGGGAAGCGG - Exonic
1142608518 17:1095577-1095599 CAGCAGGACTGGGGAGGAGGGGG - Intronic
1142672107 17:1492006-1492028 CAGAAGGACGGTGTGGGAGGTGG - Intronic
1142850196 17:2701056-2701078 CAGAAGCACTGGAGTGCAGGTGG + Intronic
1142958098 17:3534986-3535008 GAGAAGGAGGGGCTGGGAGGAGG - Intronic
1142958115 17:3535048-3535070 CAGAGGGGCAGGAGGGGAGGAGG - Intronic
1143672519 17:8406275-8406297 CAGAGGGAGGGGATGGGATGGGG - Intergenic
1143941921 17:10551354-10551376 CAGAATGGCTGGATGGGGAGGGG - Intergenic
1144489292 17:15694542-15694564 CATAAAAAATGGATGGGAGGTGG - Intergenic
1144502655 17:15802688-15802710 AAGAAGGCCTGGTGGGGAGGAGG + Intergenic
1144777135 17:17790520-17790542 CAGACGGACAGGCAGGGAGGGGG + Intronic
1144911676 17:18687409-18687431 CATAAAAAATGGATGGGAGGTGG + Intergenic
1145274152 17:21420123-21420145 CAGAAGGAAGGGAAGGCAGGAGG - Intergenic
1145312014 17:21706022-21706044 CAGAAGGAAGGGAAGGCAGGAGG - Intergenic
1146536967 17:33661090-33661112 CAGAGGGAGTGGAAGGGAGTCGG - Intronic
1146728631 17:35175400-35175422 CAGCCAGACTGGAGGGGAGGTGG + Intronic
1146820398 17:35980051-35980073 CAGAGGGACTGTGTGGGAGGGGG - Intronic
1146975704 17:37109767-37109789 CAGAAGGACTGGATGGTGAGGGG - Intronic
1147170814 17:38617682-38617704 CAGCAGGAGAGGCTGGGAGGTGG + Intergenic
1147400229 17:40176651-40176673 CAGAAGGAGTGTGGGGGAGGAGG - Intergenic
1147725521 17:42564197-42564219 CAGAGGGAGTGGATGGGGGACGG + Intronic
1148050949 17:44769707-44769729 CAGATGGACAGGCTGGGTGGGGG - Exonic
1148062821 17:44848419-44848441 CAGGACGTCTGGATGGGTGGAGG + Intronic
1148455013 17:47806548-47806570 CAGAAGGACTGCTTGGGCCGGGG + Intergenic
1148544070 17:48503622-48503644 CAGCAGGGCTGGATGGGGTGAGG - Intergenic
1148810011 17:50284306-50284328 GGGAAGGACTGGATTTGAGGGGG - Intergenic
1148934464 17:51153768-51153790 GAGGAGGATCGGATGGGAGGAGG + Intronic
1149038559 17:52159719-52159741 CAGAAGGTCTCGTGGGGAGGCGG + Intronic
1149121916 17:53179541-53179563 CAGGAGGAAAGGATGGGAAGGGG - Intergenic
1149560473 17:57604727-57604749 CAGAAGGATAAGAAGGGAGGAGG + Intronic
1150004681 17:61462496-61462518 CAGGAGGACGGGGTGGGAGCAGG + Intronic
1150434869 17:65145941-65145963 AAGAAGGGCTGGGTGGGAGGAGG - Intronic
1150504034 17:65680491-65680513 AAGAAGGACGGGATGGAAAGAGG - Intronic
1151422473 17:74007468-74007490 GAGAAGGACTGGGAGGGAGAAGG + Intergenic
1151438658 17:74114372-74114394 CAGAAGGGCTGCCTGGGAGAAGG - Intergenic
1151907237 17:77056501-77056523 CTGAAAGGCGGGATGGGAGGCGG + Intergenic
1152243978 17:79175759-79175781 CAGAAAGCCTGGATTGGTGGTGG + Intronic
1152288538 17:79425819-79425841 CAGGAGGAGAGGATGGGGGGAGG + Intronic
1156501123 18:37559033-37559055 CAGAAGTCCTGGTTTGGAGGAGG - Intronic
1157193543 18:45601000-45601022 AAGTAGGATAGGATGGGAGGGGG + Intronic
1157353675 18:46914375-46914397 CAGAAGAACTGGAAGAGAGGTGG + Intronic
1157476854 18:48029215-48029237 GAGAAGGACTGGAGGGCTGGTGG + Exonic
1158945196 18:62441976-62441998 CAGCAGGTGTGGATGGGCGGCGG - Intergenic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1159771230 18:72547344-72547366 CAGAAGGGCAGGAGGGTAGGAGG + Intronic
1160848973 19:1180623-1180645 CAGGAGGGCTGGCAGGGAGGAGG - Intronic
1160965923 19:1746842-1746864 CCGAAGGGCTGGGTCGGAGGGGG + Intergenic
1161003728 19:1924316-1924338 CAGCAGGAATGAAGGGGAGGAGG - Exonic
1161299901 19:3537583-3537605 CAGGAGGAATGGCTGGGAAGTGG + Intronic
1161300176 19:3538771-3538793 CAAACGGACTGGATGTGAGTGGG + Intronic
1161410333 19:4113418-4113440 CAGATGGACAGGAGGGGAGGGGG + Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1163061271 19:14763924-14763946 CAGGAGGAGAGGAGGGGAGGAGG - Intronic
1163779673 19:19239785-19239807 GAGGAGGAGTGGAAGGGAGGAGG - Intronic
1165095034 19:33405653-33405675 CGGAAGGCCTGGCTGGGAGCAGG - Intronic
1166126014 19:40715819-40715841 AAGAAAGATAGGATGGGAGGTGG - Intronic
1167679169 19:50909088-50909110 CAGAGGGAAGGGCTGGGAGGCGG - Intronic
1167710390 19:51106999-51107021 CAGATGGGCTGGATGAAAGGTGG - Intronic
1167862483 19:52297005-52297027 CAGAGGCACTGGAAGCGAGGCGG + Intergenic
1168036614 19:53724764-53724786 CAGCAGGATTAGGTGGGAGGTGG - Intergenic
1168082677 19:54021743-54021765 CACAATGAGTGTATGGGAGGTGG - Intergenic
1168353669 19:55689738-55689760 CTGAAGGATTCGATGGGATGCGG - Intronic
1202700645 1_KI270712v1_random:161242-161264 CTGAGGGACTGGATGGGAGGGGG + Intergenic
925204418 2:1994275-1994297 CAGGAGGACTCGCTGGGAGGAGG - Intronic
925204435 2:1994328-1994350 CAGGAGGACTCGCTGGGAGGAGG - Intronic
925204453 2:1994381-1994403 CAGGAGGACTCGCTGGGAGGAGG - Intronic
925204472 2:1994434-1994456 CAGGAGGACTCGCTGGGAGGAGG - Intronic
925962786 2:9034040-9034062 CAGAAAAACTGAATGGAAGGGGG - Intergenic
926962849 2:18377895-18377917 CAAATGGACTGAATGGAAGGAGG + Intergenic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927967146 2:27277681-27277703 CAGAAGGAATGCATGAGATGTGG - Intronic
928947045 2:36780991-36781013 TAGAAGGGGTGGAGGGGAGGAGG - Intronic
929541688 2:42827967-42827989 AAGAAGGTCTGGAGAGGAGGAGG + Intergenic
929570801 2:43021872-43021894 GAGGAGGGCTGGATGGCAGGCGG - Intergenic
932396569 2:71452919-71452941 CTGAAGAACTGGGTGGGGGGAGG + Intergenic
932599035 2:73111757-73111779 CAGAGGGACAGGATGGGGGTGGG + Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
934160013 2:89240562-89240584 CAGAAGGACTGGGTAAGAGTTGG + Intergenic
934171571 2:89544714-89544736 CTGAGGGACTGGATGGGAGAGGG + Intergenic
934281881 2:91619032-91619054 CTGAGGGACTGGATGGGAGGGGG + Intergenic
935110687 2:100091837-100091859 GTGAAAGAATGGATGGGAGGTGG - Intronic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936124284 2:109773325-109773347 GTGAAAGAATGGATGGGAGGTGG + Intergenic
936220405 2:110598139-110598161 GTGAAAGAATGGATGGGAGGTGG - Intergenic
936531653 2:113280270-113280292 GAGAAAGACTGGGTGGAAGGAGG - Intergenic
937288514 2:120767921-120767943 CAGAAGGACTCGATGCCTGGTGG + Intronic
937353342 2:121182680-121182702 CTGAAGGACTTCATGGGAGCTGG - Intergenic
937430682 2:121835716-121835738 CAGAAGGGGAGGAGGGGAGGAGG - Intergenic
939549037 2:143590589-143590611 CAGGAGGAATGGATGGTTGGGGG - Intronic
940790099 2:158023101-158023123 CAGGAGGCCTGATTGGGAGGTGG + Intronic
940801269 2:158135852-158135874 CGGAATGACTGGATGGGGGATGG + Exonic
943768019 2:191683309-191683331 AAGAGGGACTGAATGGGAGTGGG + Intronic
943896406 2:193367633-193367655 CAGGAGGAAAGGGTGGGAGGGGG - Intergenic
945022061 2:205583830-205583852 CAGTAGAACTGGAGGTGAGGTGG - Intronic
946449265 2:219765760-219765782 CAGAAGGAGTGGAAGGGAGGTGG - Intergenic
946944207 2:224802918-224802940 CAGAAAACCTGGATGGGTGGAGG + Intronic
947162884 2:227231938-227231960 GTGAAGGGTTGGATGGGAGGTGG - Intronic
947772640 2:232682883-232682905 CAGAAGCCCTGGATGGGACTTGG - Intergenic
947935054 2:233997471-233997493 CAGAGGGACAGGATGGGAAGGGG + Intronic
948157252 2:235793244-235793266 CAGAAGGCCTGGCTGGGAATGGG + Intronic
948213970 2:236215279-236215301 CAGAAGGGCTAGATGGGGGCCGG - Intronic
948301920 2:236914035-236914057 GAGCAGGGGTGGATGGGAGGAGG + Intergenic
948373496 2:237505363-237505385 CAGCAGGACTGCATGCGATGAGG - Intronic
948578713 2:238970151-238970173 CCAAAGGGCTGGCTGGGAGGAGG + Intergenic
948761877 2:240197364-240197386 CACAAGGACAGGATGGGGTGTGG - Intergenic
948863345 2:240763460-240763482 AAGAAGGAGTGGCTGGGAGCTGG - Intronic
1169624854 20:7554212-7554234 CAGAGGGAAGGGATGGGAAGGGG - Intergenic
1170144104 20:13153882-13153904 CAGCAGCACTAGCTGGGAGGAGG - Intronic
1170211464 20:13849695-13849717 CAAAGGGAATGGGTGGGAGGAGG - Intronic
1170267218 20:14479652-14479674 TAGCAGGAGTGGGTGGGAGGAGG + Intronic
1170509025 20:17058004-17058026 AAGAAGGAAGGGAAGGGAGGAGG + Intergenic
1170513722 20:17106158-17106180 CAGATGGATGGGATGAGAGGTGG - Intergenic
1171122401 20:22578409-22578431 GAGAAGGACTGGCTGGGGGAGGG + Intergenic
1171322949 20:24262396-24262418 TAGAAGCACTGGGTGGGAAGTGG - Intergenic
1172893998 20:38286731-38286753 CAGAAGAAGTGGATGGAGGGTGG + Intronic
1173257968 20:41408446-41408468 CAGTAGGACTTGATGGGTCGGGG + Intronic
1173503606 20:43570602-43570624 AAGAAGAGCTGGAGGGGAGGAGG - Exonic
1173657407 20:44709890-44709912 CAGCAGGGCTGGAAGTGAGGAGG - Intergenic
1174114462 20:48217494-48217516 CAGGAGGAAACGATGGGAGGAGG + Intergenic
1174177168 20:48652474-48652496 GAGGTGGACTGGCTGGGAGGAGG + Intronic
1174557898 20:51408883-51408905 CAGCAGGACTGGGGTGGAGGTGG + Intronic
1175191416 20:57214532-57214554 GAGGAGGGCTGGGTGGGAGGAGG - Intronic
1175515686 20:59568464-59568486 GAGGAGGATTTGATGGGAGGCGG - Intergenic
1175540940 20:59747213-59747235 CAGATGGACAGGAAGGGAGGAGG - Intronic
1175709320 20:61206453-61206475 CAGAAGAACAGGAAGGAAGGAGG + Intergenic
1175891518 20:62318033-62318055 GAGGAGGAAAGGATGGGAGGGGG + Intronic
1176173511 20:63707235-63707257 CAGAGGGACGGGGTGGGAGAGGG - Intronic
1178207996 21:30492814-30492836 AAAAAGGAATGAATGGGAGGAGG - Intergenic
1178527630 21:33345449-33345471 CAGAATGACCGACTGGGAGGTGG + Intronic
1179040920 21:37801627-37801649 CAGAAGGAGAGGATGAGAAGTGG - Intronic
1179340151 21:40500113-40500135 CAGCAGTACTGGGAGGGAGGAGG + Intronic
1179470941 21:41609922-41609944 AAGATGGCCTGGAAGGGAGGGGG + Intergenic
1179658881 21:42862297-42862319 CAGAAGGACTCGATGCTATGGGG + Exonic
1180139287 21:45881744-45881766 CAGAAGCAGAGGGTGGGAGGTGG - Intronic
1180246902 21:46554545-46554567 GACAAGGACTGGCTGTGAGGAGG - Intronic
1180515692 22:16140940-16140962 CAGAAGGACTGGGAGGGGGTGGG + Intergenic
1180790988 22:18575422-18575444 AATAAGGACTTGAGGGGAGGCGG + Intergenic
1181230747 22:21419892-21419914 AATAAGGACTTGAGGGGAGGCGG - Intronic
1181247900 22:21514977-21514999 AATAAGGACTTGAGGGGAGGCGG + Intergenic
1181408188 22:22699944-22699966 CAGAAGGACTTGGTGGAACGAGG + Intergenic
1181413506 22:22743253-22743275 CAGAAGGACTTGGTGGAACGAGG + Intronic
1181436834 22:22916003-22916025 CAGAAGGACTGGATGACTTGGGG - Intergenic
1181767201 22:25100388-25100410 CAAATGGAGTGGAAGGGAGGAGG + Intronic
1182878741 22:33714949-33714971 CAGAAGGACTTGTTGGCAAGAGG + Intronic
1183015439 22:34982723-34982745 CAGAATGTCTGTATGGGAAGAGG - Intergenic
1183988929 22:41585067-41585089 CAGTTGGAGTGGGTGGGAGGTGG + Intronic
1184041891 22:41949282-41949304 CAGAAGAGATGGATGGGAGGAGG + Intergenic
1184340094 22:43881253-43881275 CAGGAGGACTGGCAGGGAGCTGG + Intronic
1184960901 22:47927739-47927761 CACAAGGAATGGGTGGGAGGTGG + Intergenic
1185015851 22:48342168-48342190 CAAAGAGACTGGATGAGAGGGGG - Intergenic
949913377 3:8935053-8935075 ATGAAGGAGTGAATGGGAGGGGG + Intronic
950053064 3:10006639-10006661 CAGAGGGAGGGAATGGGAGGGGG + Intronic
951474906 3:23094478-23094500 CAGAATGAGGGGATGGGATGGGG + Intergenic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951825128 3:26859853-26859875 CAGGAGGACTGGGGCGGAGGTGG - Intergenic
953054507 3:39377275-39377297 GGGAAGGAATGGAAGGGAGGAGG - Intergenic
953312171 3:41890803-41890825 GGGAAGGAAGGGATGGGAGGGGG + Intronic
954608774 3:51933369-51933391 ATGAGGGACTGGGTGGGAGGCGG - Intergenic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
955951697 3:64249350-64249372 GAGAAGGGCTTGGTGGGAGGTGG - Intronic
956015915 3:64882390-64882412 CAGAAGGAGTGGGAGGAAGGAGG - Intergenic
959507773 3:107175068-107175090 GGGAGGGACTTGATGGGAGGTGG - Intergenic
960806689 3:121590487-121590509 CAGAAGGAAGGGAGAGGAGGAGG - Intergenic
960939743 3:122925850-122925872 CAGAGGGAGGGGGTGGGAGGAGG + Intronic
961562125 3:127737916-127737938 AAGAAGGAGTTGATGGGCGGTGG - Intronic
962010988 3:131390591-131390613 AAGAAGATCTGTATGGGAGGAGG + Intergenic
962201950 3:133407573-133407595 AAGAAAGAGTGGAGGGGAGGAGG + Intronic
963807946 3:149745334-149745356 CAGAAAGAGTGGGTGGCAGGGGG - Intronic
964773624 3:160252108-160252130 CAGAAAGAATGAATGGGTGGGGG + Intronic
965135328 3:164758688-164758710 CACAAGGACTGTATGGTGGGTGG + Intergenic
965559550 3:170048260-170048282 CAGAAGGGCAGGATGGGAAGGGG + Intronic
965970103 3:174544096-174544118 AAGAAGGACTGGATTGGGGTGGG - Intronic
966198171 3:177334386-177334408 CAGAAGCCCAGGATGGCAGGTGG + Intergenic
966424795 3:179769807-179769829 AAGAAGGAAGGGATGGAAGGAGG - Intronic
966674647 3:182572216-182572238 CACAGGGCCTGGGTGGGAGGGGG - Intergenic
966950605 3:184813103-184813125 CAGGAGGATAGGGTGGGAGGAGG + Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967153098 3:186667590-186667612 TAGTAAGACTGGATGGGAGGAGG + Intronic
967315927 3:188152524-188152546 CAGGAGACCTGGATGGGAGGAGG + Intergenic
968482065 4:837675-837697 CAGAAGGTCAGGTGGGGAGGAGG - Intergenic
968937236 4:3617603-3617625 AAGAAGGGAGGGATGGGAGGTGG - Intergenic
969028188 4:4191173-4191195 CTGATGGACTGGATGGGAGGGGG - Intronic
969301330 4:6299122-6299144 CAGAGGGACTGGAGGGGATGGGG - Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
970987167 4:22171989-22172011 AACAGGGACAGGATGGGAGGTGG + Intergenic
971195510 4:24469838-24469860 GAGAGGGACTGGATGGGGGCAGG - Intergenic
971411655 4:26379290-26379312 CAGGAGGACTGCTTGAGAGGCGG - Intronic
972797720 4:42438667-42438689 CAGATGGACTGAATGCAAGGAGG + Intronic
972874630 4:43343477-43343499 AAGAAGGCATGGATGGAAGGAGG - Intergenic
975333849 4:73152479-73152501 CAGAAGGAGAGGAAGGGAAGGGG + Intronic
975829723 4:78356643-78356665 CAGATGCAATGGAGGGGAGGAGG + Intronic
976183053 4:82417409-82417431 GAGAAGGAGGGGATGGGAAGAGG - Intergenic
976208348 4:82642868-82642890 CAGAAAGAAAGGATGGGACGAGG - Intronic
976394058 4:84537106-84537128 CAGGAGGACTCAATGGTAGGAGG - Intergenic
978782068 4:112566780-112566802 CAGAAGGCCTGTAGAGGAGGAGG + Intronic
978904622 4:113991171-113991193 CTGAAGCACAGGAAGGGAGGAGG + Intergenic
979667025 4:123323399-123323421 CAGGAGGAAAGGATGGGAAGCGG + Intergenic
979892298 4:126113966-126113988 TAGAGGGAGTGGAAGGGAGGTGG - Intergenic
980563878 4:134512062-134512084 CAGAAGGGCTTGATGGGTGTAGG - Intergenic
980802085 4:137765214-137765236 AGGAAGGACTGGAGGGCAGGTGG - Intergenic
981692906 4:147529134-147529156 CTGAAGGATTGGATGTGTGGTGG + Intronic
981734208 4:147932647-147932669 CAGAAGGCGGGGGTGGGAGGAGG + Intronic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
984551052 4:181159242-181159264 CAGGAGGACGGCGTGGGAGGTGG + Intergenic
984767237 4:183408964-183408986 CAGAGGGCTTGGTTGGGAGGGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985033874 4:185819422-185819444 CAGAAGTGCTGGGTGGGAGGTGG - Intronic
985478023 5:90853-90875 CACGAGGACGGGCTGGGAGGAGG + Intergenic
986755410 5:10831586-10831608 CAGAAGCACTGGGTGGAGGGAGG - Intergenic
987040180 5:14055054-14055076 CAGAAGGTTGGGGTGGGAGGTGG + Intergenic
987254518 5:16136814-16136836 CAGAAAGAAAGGATGGAAGGTGG + Intronic
987296159 5:16553686-16553708 CAGCAGGACGGGGTGGGCGGGGG + Intronic
987392289 5:17387318-17387340 CAGAAGAACAGGATGGGGCGGGG - Intergenic
988650925 5:33149900-33149922 CTGAATGACTGTATGGAAGGGGG + Intergenic
989740865 5:44769894-44769916 CAGATGGACTGGAACGGAGAAGG + Intergenic
991637798 5:68723603-68723625 GAGAAAGAGTGGGTGGGAGGGGG + Intergenic
992093110 5:73337050-73337072 CTGATGGGCTGGGTGGGAGGTGG - Intergenic
992390727 5:76328497-76328519 CAGCAGGACTGAATGTGAGTTGG - Exonic
992802090 5:80302858-80302880 CAGCAGGTGTGGATGGGCGGCGG + Intergenic
995414214 5:111890739-111890761 GAGACGGACTGGCTGGGATGTGG + Intronic
996398578 5:123036357-123036379 CCGCGGGACTGGGTGGGAGGGGG - Intronic
997269651 5:132526129-132526151 CAGAATGAATGGATGGAGGGAGG - Intergenic
997675762 5:135711935-135711957 CAGGATGCCTGGGTGGGAGGGGG - Intergenic
998136307 5:139676321-139676343 GAGAAGGACTGGGGAGGAGGTGG - Intronic
998946253 5:147342496-147342518 CAGCAGGTGTGGATGTGAGGAGG + Intronic
999282052 5:150372458-150372480 CAGCAGGACTGGCTGGGACGAGG - Intronic
999299491 5:150482347-150482369 CAGAAAGAATGGATGGGATCAGG - Intergenic
999933703 5:156462084-156462106 CAAAAGAAATGGATGGGAGGTGG + Intronic
1000210616 5:159103911-159103933 CAGAAGGTCAGGGTGGGAGTGGG - Intergenic
1001089239 5:168725119-168725141 CAGAAGGACTACATGGCAGGAGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001567942 5:172712735-172712757 CAGAGACGCTGGATGGGAGGAGG - Intergenic
1002302446 5:178265008-178265030 CAGAAGGAATGGCTGGGGTGGGG + Intronic
1002321746 5:178380623-178380645 CAGAATGAGTGAATGGGAAGTGG + Intronic
1002474126 5:179454307-179454329 CTGATGGATTGGATGGGGGGCGG - Intergenic
1002628031 5:180546531-180546553 AAGAAATAATGGATGGGAGGAGG - Intronic
1002835933 6:865346-865368 CAGAATGACTGGAATGCAGGAGG + Intergenic
1003528673 6:6919870-6919892 CAGAAGCACTGGGTGGAAGTAGG - Intergenic
1003719123 6:8680818-8680840 CACAGGGAATGTATGGGAGGGGG + Intergenic
1004110306 6:12711429-12711451 CAGTTGGAGTGGATGGGAAGGGG + Intergenic
1005161695 6:22871527-22871549 CAGAAAGGCTGGAGGGGAGCTGG + Intergenic
1005458551 6:26045210-26045232 GAAAAGGACAGGATGGGCGGTGG + Intergenic
1006932061 6:37694517-37694539 CAGAAAGACTGCTGGGGAGGGGG + Intronic
1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG + Intergenic
1008774868 6:55026248-55026270 CAGAGGGAAAGGGTGGGAGGGGG - Intergenic
1010886519 6:81249798-81249820 CAGAGGGAAAGGATGGGAAGGGG - Intergenic
1011249150 6:85352678-85352700 CAGTGGGACAAGATGGGAGGTGG - Intergenic
1012427718 6:99132201-99132223 GGGAAGGGCTGGATGGGAGTGGG - Intergenic
1012824396 6:104128426-104128448 CAGAAGGAAAGGAAGGGAAGGGG + Intergenic
1012975796 6:105779782-105779804 GAGCAGGACTGGCAGGGAGGTGG + Intergenic
1013565127 6:111351204-111351226 AAGAAGGACAGGATGGGTTGAGG - Intronic
1014097864 6:117480101-117480123 AATAAGGACTGGATGGCAAGTGG + Intronic
1014255678 6:119158297-119158319 CAGAAGGCCGGGTTGGGTGGAGG - Intergenic
1014367753 6:120565155-120565177 GAGGAGGAGTGGGTGGGAGGAGG + Intergenic
1015751687 6:136566334-136566356 CAGAAGGCATGGGTGGGAGGAGG + Intronic
1015799540 6:137046304-137046326 CAGGAGGACAGGATGTGAGGTGG - Intergenic
1015882577 6:137883788-137883810 CATTTGTACTGGATGGGAGGTGG - Intergenic
1016324552 6:142885308-142885330 GAGAAGGAGGGGAAGGGAGGGGG - Intronic
1016739810 6:147515054-147515076 CAGAAGGAATTCTTGGGAGGAGG - Intronic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017727799 6:157287674-157287696 CAGAAGGGAGGGAAGGGAGGAGG - Intergenic
1018085846 6:160300518-160300540 CAGAGGAAGTGGGTGGGAGGAGG + Intergenic
1018884054 6:167917455-167917477 CAGAAGGACTAGAGGAGAGGAGG + Intronic
1018961232 6:168450490-168450512 GAGAAGGACTGGCTGGGAAGGGG - Intronic
1019119060 6:169789153-169789175 CACAATGGCTGGATGGGCGGTGG + Intergenic
1019141214 6:169945029-169945051 GAGAGGGACTTGGTGGGAGGTGG - Intergenic
1019215303 6:170439194-170439216 GAGAAGGGCTGGACTGGAGGTGG - Intergenic
1019720374 7:2566918-2566940 CAGAAGGAATGGGTGGGTGGGGG - Intronic
1020046719 7:5046082-5046104 CAGAGGGGCCGGACGGGAGGTGG + Exonic
1020503685 7:8956351-8956373 CAGGAAGAATGGATGGGAGTAGG - Intergenic
1020558822 7:9703007-9703029 CAGGGGGACAGGGTGGGAGGAGG + Intergenic
1021451006 7:20784237-20784259 CAAGAGGACTTGGTGGGAGGAGG + Intronic
1021576062 7:22107485-22107507 CAGAATCACAGGATGGGAGGAGG - Intergenic
1021774222 7:24036131-24036153 CAGAAGCGATGGATGGGTGGAGG + Intergenic
1022489231 7:30803989-30804011 CAGCAGGACTGAATGGGATTTGG - Intronic
1023432042 7:40104006-40104028 GAGAAGAACTGGGTGGGAGTGGG + Intergenic
1023558603 7:41449172-41449194 CAGGAGGAGTGGATGGGAATAGG + Intergenic
1023910027 7:44547251-44547273 CACAAGGACAGGATGGGGAGGGG + Intergenic
1024016909 7:45325520-45325542 CAGCAGGACTGGAAGGGGGAGGG + Intergenic
1024584920 7:50833705-50833727 CCGAAGGACAGGATGGGACTGGG + Intergenic
1024599338 7:50965834-50965856 GAGAAGGACTGGATGCCGGGTGG - Intergenic
1025945085 7:66099191-66099213 TAGAAGGAGTGGAGGAGAGGAGG + Intronic
1027450566 7:78326626-78326648 CAGAACGACAGAAGGGGAGGTGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029852185 7:103474470-103474492 CACATGGAGGGGATGGGAGGGGG - Intronic
1030093306 7:105876605-105876627 AGGAAGGGCGGGATGGGAGGAGG + Intergenic
1032262152 7:130346625-130346647 AGGGAGGACTGGCTGGGAGGAGG + Intronic
1033143991 7:138855257-138855279 CAGGAGGACTGGAAAAGAGGAGG - Intronic
1033813277 7:145042976-145042998 CATAAGGCTTGGATGGTAGGAGG + Intergenic
1035351164 7:158247324-158247346 GAGAAGGCCGTGATGGGAGGTGG + Intronic
1035702178 8:1644395-1644417 CAGGAAGACTGGCTGGGAGCGGG - Intronic
1036811441 8:11869607-11869629 CAGTAGGACTGCATGGGACCTGG + Intergenic
1037883743 8:22585649-22585671 CAGCAGGATGGGAGGGGAGGGGG - Intronic
1038200880 8:25411486-25411508 CATGTGGACTGGAAGGGAGGTGG - Exonic
1038301132 8:26350151-26350173 GAGAATCACTTGATGGGAGGAGG - Intronic
1038765434 8:30423542-30423564 AAGAAGAAATGGATGGGAAGTGG - Intronic
1038957434 8:32482769-32482791 CAGAAGGACTGGAGCTGTGGGGG + Intronic
1039073417 8:33666867-33666889 CAGATGAAGTGGGTGGGAGGGGG - Intergenic
1039440959 8:37595067-37595089 CAGAGGGGCTGGGTGGAAGGAGG + Intergenic
1039903878 8:41772430-41772452 GAGAAGAAATGGAGGGGAGGAGG - Intronic
1040573557 8:48630585-48630607 AAGGAGCACAGGATGGGAGGGGG - Intergenic
1040639703 8:49319190-49319212 CAGCAGAAATGCATGGGAGGTGG - Intergenic
1042184657 8:66124560-66124582 CAGAAGGGCTTCATGGGTGGGGG - Intergenic
1043045062 8:75312781-75312803 GAGAAGGAATGGAAGGAAGGAGG + Intergenic
1044441040 8:92223881-92223903 CATAAAGACTGGAAAGGAGGAGG - Intergenic
1044803773 8:95983755-95983777 GAGAGGGAATGGAGGGGAGGGGG + Intergenic
1044896936 8:96902572-96902594 CAGATGGATGGGATGGAAGGAGG - Intronic
1046395041 8:113631083-113631105 CAGGAGGAAAGGGTGGGAGGGGG + Intergenic
1046618608 8:116503688-116503710 CAGAATGACTGGTTGGGATAAGG + Intergenic
1048432449 8:134382739-134382761 GAGAAGGACTGGTAGGTAGGAGG - Intergenic
1048651728 8:136485557-136485579 CAGAAGGAAGCGATGGAAGGAGG + Intergenic
1048788121 8:138073578-138073600 TTGAATGACTGGATGGAAGGCGG + Intergenic
1049190467 8:141284768-141284790 AAGAAGGACTGAAGGGCAGGAGG + Intronic
1049240492 8:141535319-141535341 CAGAGGGACTGGGGAGGAGGGGG + Intergenic
1049683693 8:143930852-143930874 CAGAGGGGTGGGATGGGAGGAGG - Intronic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1050188596 9:3001187-3001209 GAGCAGGACTGTCTGGGAGGAGG + Intergenic
1050278415 9:4024621-4024643 CATAGGGAGTGCATGGGAGGAGG + Intronic
1052364315 9:27595186-27595208 CAGGACGACTAGATGGGAGAGGG + Intergenic
1052997103 9:34557015-34557037 CAGAAGGTCTGGCTGGGGCGGGG + Intronic
1053016112 9:34663239-34663261 CAGAAGAAATGGATGGGAATGGG + Intronic
1053309087 9:37004203-37004225 AATAAGAATTGGATGGGAGGTGG + Intronic
1053417843 9:37957952-37957974 CAGAGTGACTGGAAGGGAGTTGG + Intronic
1053562394 9:39209864-39209886 CAGAGGGACTAGAAAGGAGGAGG + Intronic
1053828200 9:42047856-42047878 CAGAGGGACTAGAAAGGAGGAGG + Intronic
1054134757 9:61409175-61409197 CAGAGGGACTAGAAAGGAGGAGG - Intergenic
1054453909 9:65420069-65420091 AAGAAGGGAGGGATGGGAGGTGG + Intergenic
1054602359 9:67139598-67139620 CAGAGGGACTAGAAAGGAGGAGG - Intergenic
1056281157 9:85042315-85042337 CAGAAGGACTAGAAGGGAAAAGG - Intergenic
1057075439 9:92135931-92135953 CTGAAGGAGTGGGAGGGAGGTGG + Intergenic
1059256848 9:112938644-112938666 CAGAAGGTCTGGGTGTGAGCAGG + Intergenic
1060402321 9:123356097-123356119 CAGGAGGCCTGGGTGGGAGGAGG + Intergenic
1060531146 9:124347640-124347662 CAGAAGGACTAGAGAGGAGGAGG - Intronic
1060828970 9:126702052-126702074 GAGGAGGACGGCATGGGAGGAGG + Intergenic
1060907088 9:127316312-127316334 CAGAAGGATTGCATGGGACCAGG + Intronic
1061038943 9:128128580-128128602 CGCAAGGACTGGAAGGAAGGTGG - Intergenic
1061233214 9:129326940-129326962 CAGCAGGGCTGGGTGGGAGTGGG + Intergenic
1061239178 9:129359212-129359234 CCCAAGGCCTGGTTGGGAGGTGG + Intergenic
1061803164 9:133123191-133123213 CAGAAGAAAGGGATGGGAGGAGG - Intronic
1062010461 9:134264174-134264196 CAGGAGGGCAGGATGGGAGACGG - Intergenic
1062328768 9:136026460-136026482 CAGAAGGAGAGGAGGAGAGGAGG + Intronic
1062384949 9:136305511-136305533 CTGAAGGCCTGGCAGGGAGGTGG - Intronic
1062403774 9:136383863-136383885 CAGGAGGAGGGGAGGGGAGGGGG - Intronic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1186080416 X:5924849-5924871 CAGAGGGAAAGGGTGGGAGGGGG + Intronic
1186559675 X:10598132-10598154 AAGAAGCACTGGAAGGCAGGTGG - Intronic
1186980023 X:14948693-14948715 CAGAATGAGTGGGTGGGTGGGGG + Intergenic
1187568769 X:20479033-20479055 CAGAAGGGAAGGGTGGGAGGGGG + Intergenic
1188986786 X:36775226-36775248 CAGCAGCACTGCATGGGTGGAGG - Intergenic
1189489751 X:41461166-41461188 CAGAGGGAAAGGGTGGGAGGGGG - Intronic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1192546032 X:72015212-72015234 CAAAAAGACTGGAGAGGAGGTGG - Intergenic
1192965846 X:76175899-76175921 CAGAAGGCTTGGATGGGGAGTGG + Intronic
1193654743 X:84186271-84186293 TATAAGGATGGGATGGGAGGTGG - Intronic
1194073005 X:89350772-89350794 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1195803485 X:108736761-108736783 GAGAAGGCCTGGAGGGGCGGAGG + Intergenic
1197364041 X:125542235-125542257 CAGAGGGAAAGGATGGGAAGAGG + Intergenic
1198132530 X:133711579-133711601 TGGAAGGAATGGATTGGAGGAGG - Intronic
1198395060 X:136212128-136212150 AAGCAGAACTGGGTGGGAGGAGG + Intergenic
1198591956 X:138193323-138193345 AAGAGTGACTGGATGGGAGAAGG + Intergenic
1199427577 X:147720692-147720714 TACAAGGAATGTATGGGAGGGGG + Intergenic
1199712487 X:150480024-150480046 CAGAAGCACAGGATGGGGAGGGG - Intronic
1200285944 X:154822464-154822486 CAGAAGGTTTAGATCGGAGGAGG - Intergenic
1200727245 Y:6686512-6686534 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1200728397 Y:6702287-6702309 CAGAAGGACTGGCAGGCAGGAGG + Intergenic
1201479008 Y:14417103-14417125 CAGAAGGTGAGGATGGGAGGAGG + Intergenic
1201573557 Y:15438671-15438693 CAAAAGGACTTGGTGAGAGGTGG - Intergenic