ID: 905779112

View in Genome Browser
Species Human (GRCh38)
Location 1:40692100-40692122
Sequence TTGGCGGAAGGCGACGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905779100_905779112 -1 Left 905779100 1:40692078-40692100 CCGGCCCGCGGGCTTTCTCCCAT 0: 1
1: 0
2: 0
3: 16
4: 92
Right 905779112 1:40692100-40692122 TTGGCGGAAGGCGACGGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 132
905779099_905779112 0 Left 905779099 1:40692077-40692099 CCCGGCCCGCGGGCTTTCTCCCA 0: 1
1: 0
2: 1
3: 13
4: 163
Right 905779112 1:40692100-40692122 TTGGCGGAAGGCGACGGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 132
905779098_905779112 9 Left 905779098 1:40692068-40692090 CCTCGTCGGCCCGGCCCGCGGGC 0: 1
1: 0
2: 8
3: 28
4: 263
Right 905779112 1:40692100-40692122 TTGGCGGAAGGCGACGGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 132
905779102_905779112 -5 Left 905779102 1:40692082-40692104 CCCGCGGGCTTTCTCCCATTGGC 0: 1
1: 0
2: 0
3: 12
4: 84
Right 905779112 1:40692100-40692122 TTGGCGGAAGGCGACGGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 132
905779095_905779112 16 Left 905779095 1:40692061-40692083 CCGTGTGCCTCGTCGGCCCGGCC 0: 1
1: 0
2: 0
3: 2
4: 77
Right 905779112 1:40692100-40692122 TTGGCGGAAGGCGACGGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 132
905779103_905779112 -6 Left 905779103 1:40692083-40692105 CCGCGGGCTTTCTCCCATTGGCG 0: 1
1: 0
2: 5
3: 5
4: 51
Right 905779112 1:40692100-40692122 TTGGCGGAAGGCGACGGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905779112 Original CRISPR TTGGCGGAAGGCGACGGCGG GGG Intronic
900051280 1:598917-598939 TTTGCGGAAGAACACGGCGGGGG + Intergenic
900414681 1:2529530-2529552 TTGGCGGAGAGCGCGGGCGGGGG + Exonic
901167959 1:7233283-7233305 TTGGCCGGAGGAGACTGCGGTGG + Intronic
903325452 1:22566372-22566394 ATGGGGGAAGGCGACGGTGCTGG + Intronic
903538686 1:24084286-24084308 ATGGCGGAAGGCGAGGGGGAAGG - Intronic
903907520 1:26696894-26696916 TTGGTGGAAGACGGCGGCCGCGG - Exonic
905212779 1:36385871-36385893 ATGGAGGGAGGCGGCGGCGGCGG - Exonic
905779112 1:40692100-40692122 TTGGCGGAAGGCGACGGCGGGGG + Intronic
907126659 1:52056436-52056458 GTGTCGGAAGGGGAGGGCGGGGG - Intronic
907883977 1:58576650-58576672 GTGGTTGAAGGCGCCGGCGGTGG + Exonic
909622500 1:77683477-77683499 CTGGCGGGCGGCGGCGGCGGCGG + Intergenic
910182987 1:84505964-84505986 CGGGAGGAAGGCGGCGGCGGCGG - Intronic
910449065 1:87328773-87328795 AGGGAGGAAGGCGGCGGCGGAGG + Exonic
914730408 1:150364715-150364737 ATGGCGGCCGGCGGCGGCGGAGG + Exonic
915021568 1:152784870-152784892 TTGGCGGAAGGCCAGGCCTGAGG - Intronic
916922680 1:169485721-169485743 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
919813048 1:201420984-201421006 TTGGAGGAAGGCAATGGTGGCGG - Intronic
922526676 1:226309348-226309370 TCGGCCGGAGGCGGCGGCGGAGG - Exonic
922749893 1:228065381-228065403 TTGGGGGAAGGCGAGGCCTGGGG + Intergenic
923141457 1:231163732-231163754 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
924527248 1:244863643-244863665 AAGGCGGAAGGCGGCGGAGGCGG - Exonic
1064230811 10:13528536-13528558 TGCGGGGAAGGCGGCGGCGGGGG + Intronic
1065660284 10:27998933-27998955 GGAGCGGAAGGCGGCGGCGGCGG - Intronic
1070800805 10:79243450-79243472 TAGCCGGACGGCGGCGGCGGTGG + Intronic
1074525784 10:114261931-114261953 ATGGCGGAAGGCAAAGGTGGGGG + Intronic
1077548061 11:3185037-3185059 GTGGCGGAAGGCGAAGGGGAAGG + Intergenic
1078168514 11:8911109-8911131 TTGGCGGAAGGCGGGAGAGGCGG - Intergenic
1078809780 11:14747037-14747059 ATGGTGGAAGGCAAAGGCGGAGG + Intronic
1080597940 11:33792209-33792231 ATGGCGGAAGGTGAAGGGGGAGG - Intergenic
1084892079 11:72241575-72241597 TGGGAGGAGGGCGACGACGGGGG - Intronic
1091866175 12:3839154-3839176 CAGGCGGCAGGCGGCGGCGGCGG - Intronic
1095432045 12:42144757-42144779 CGGGCGCAAGGCGGCGGCGGCGG - Exonic
1096700582 12:53380392-53380414 CGGGCGGGAGGCGGCGGCGGCGG + Intronic
1096826214 12:54280079-54280101 TGCGCAGAAGGCGGCGGCGGTGG - Exonic
1099405801 12:82260589-82260611 ATGGCGGAAGGCAAAGGAGGAGG - Intronic
1102112597 12:110376026-110376048 TTGGGGGAAGGCCACTGAGGAGG - Intronic
1113814910 13:113163129-113163151 TTGGGGGAAGGGGACGGCCGGGG - Intronic
1115121551 14:29942789-29942811 TTGGTGGAAGGTGAAGGGGGAGG - Intronic
1115587620 14:34830508-34830530 TTGGCGGCGGGGGATGGCGGGGG + Intronic
1123487716 15:20756059-20756081 TTGTGAGAAGGCGGCGGCGGCGG - Intergenic
1123544208 15:21325117-21325139 TTGTGAGAAGGCGGCGGCGGCGG - Intergenic
1127293752 15:57592130-57592152 ATGGGGGAACGGGACGGCGGCGG - Intronic
1128374788 15:67066732-67066754 GGGGCGGGAGGCGGCGGCGGAGG - Intronic
1129313050 15:74725663-74725685 GTGGCGGAGGGCGGCGGGGGTGG + Intergenic
1202952551 15_KI270727v1_random:52388-52410 TTGTGAGAAGGCGGCGGCGGCGG - Intergenic
1132674855 16:1117331-1117353 TTGGGGGAAGGCGGGGGCGCGGG - Intergenic
1136585226 16:31180235-31180257 AGGGCGCGAGGCGACGGCGGCGG + Intronic
1138105833 16:54286807-54286829 TTGGGGAAAGGCGAGGGAGGGGG - Intergenic
1140874398 16:79137681-79137703 TCGGGGGAAGGAGACGGAGGAGG - Intronic
1141683025 16:85555109-85555131 GCGGCTGAAGGCGGCGGCGGCGG - Intergenic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1147000512 17:37359057-37359079 TGGGCGGGAGGAGACGCCGGCGG + Exonic
1147015822 17:37490285-37490307 GGGTCGGAAGGCGACGGAGGAGG - Intronic
1147591850 17:41688984-41689006 CCTGCGGAAGGCGGCGGCGGCGG - Exonic
1152948944 17:83215159-83215181 TTTGCGGAAGAACACGGCGGAGG - Intergenic
1154464767 18:14632710-14632732 TAGGCGGAAGGTGATGGCTGTGG - Intergenic
1158404292 18:57147313-57147335 ATGGCGGACGGTGGCGGCGGCGG + Exonic
1162312434 19:9914854-9914876 CGGGCTGAGGGCGACGGCGGCGG - Intronic
1163154422 19:15432348-15432370 TGGACGGAAGGCGTCGGGGGCGG + Intronic
1166975112 19:46601290-46601312 GGGGCGGGAGGCGGCGGCGGCGG + Exonic
926101757 2:10122528-10122550 TCTCCGGAAGGCGCCGGCGGAGG + Exonic
927472317 2:23385557-23385579 CTGCCGGGAGGCGGCGGCGGCGG + Exonic
928127364 2:28625897-28625919 TTGGCGGTGGGCGCTGGCGGGGG - Intronic
933650223 2:84844382-84844404 ATGGCGGAAGGTGAAGGAGGAGG - Intronic
940274182 2:151921874-151921896 ATGGCGGAAGGCGAAGGGGAAGG - Intronic
940971976 2:159904801-159904823 TTGGCCGAGGGCGGCGGGGGCGG - Intergenic
944221809 2:197310746-197310768 TCGGCGGGAGGAGGCGGCGGCGG - Exonic
948068905 2:235104000-235104022 ATGGCGGAAGGCGAAGGTGAAGG + Intergenic
948227253 2:236320844-236320866 TGGGAGGAAGGCGATGGCGGGGG - Intergenic
948367389 2:237466016-237466038 TTGGGGGAAGGGGGCGGAGGTGG - Intergenic
948479433 2:238240637-238240659 CTGGCGGAGGGCGGCGTCGGGGG - Intronic
1170026249 20:11891535-11891557 GTGGCGGCGGGCGATGGCGGGGG + Intronic
1174386666 20:50191526-50191548 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
1175374498 20:58515038-58515060 TTTGGGGAAGGCGACGGCCAGGG - Intronic
1176034147 20:63028237-63028259 TTAGCGGAGGGCGCTGGCGGTGG + Intergenic
1176809770 21:13525673-13525695 TAGGCGGAAGGTGATGGCTGTGG + Intergenic
1177792784 21:25738216-25738238 TTGGGGGCAGGGGGCGGCGGCGG - Intronic
1182380415 22:29883208-29883230 TTGTGAGAAGGCGGCGGCGGCGG + Exonic
1184131555 22:42519637-42519659 TTGGGGGTTGGCGACGGCCGGGG - Intronic
1184557413 22:45240847-45240869 TTGGCGGGTGGTGGCGGCGGCGG - Intergenic
1203238666 22_KI270732v1_random:31725-31747 TTGGCAAAAAGCGGCGGCGGGGG - Intergenic
950940406 3:16885133-16885155 GTGGGGGAAGGCGGTGGCGGGGG + Intronic
954004205 3:47578822-47578844 GCGGCGGACGGCGGCGGCGGCGG - Exonic
954402876 3:50328194-50328216 CCTGCGGAAGGCGGCGGCGGCGG - Exonic
963289934 3:143477355-143477377 GTGGCGGGAGGGGGCGGCGGGGG - Intronic
970420794 4:15904204-15904226 ATGGCGGAAGGCGAAGGAGGAGG - Intergenic
981044585 4:140253253-140253275 GGGGTGGAAGGCGGCGGCGGCGG + Intergenic
982745809 4:159103385-159103407 ATGGGGGGAGGCGGCGGCGGCGG + Intergenic
983945527 4:173582291-173582313 TTGGCTGAAGGCCAGGGCAGTGG - Intergenic
984668011 4:182448860-182448882 CTGGCGGGAGGCGGCGGTGGCGG + Intronic
985445115 4:190017510-190017532 CTGGCCGCAGGCGACGGGGGTGG + Intergenic
985688569 5:1294771-1294793 CTGGCGGAAGGAGGGGGCGGCGG + Exonic
991587480 5:68215544-68215566 GGGGCGGAAGGCGAGGGCGGTGG + Intergenic
992105597 5:73447445-73447467 CGGGTGGAAGGCGGCGGCGGCGG + Exonic
993837689 5:92835325-92835347 CTGGCGGAGGGCGGGGGCGGGGG - Intergenic
995052721 5:107724736-107724758 TGGGCGGGAGGCGGCAGCGGTGG - Intergenic
995724624 5:115170109-115170131 TAGGGGGAAGGTGGCGGCGGAGG - Intronic
996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG + Exonic
998272401 5:140718634-140718656 GTGGCTGAAGGCGAAGGAGGTGG + Intergenic
998494109 5:142572209-142572231 TTGGCGGAAGGCTACAGCAGAGG - Intergenic
1001688745 5:173616414-173616436 ATGGCGGACGGCGGCGGCGGCGG - Exonic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002524234 5:179806655-179806677 GGGTCGGAAGGCGGCGGCGGCGG + Intronic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1012256694 6:97040908-97040930 ATGGTGGAAGGCGAAGGCGAAGG - Intronic
1012399930 6:98834671-98834693 CGGGCGGGAGGCGGCGGCGGCGG + Exonic
1015149264 6:130019968-130019990 GTGTCGGGAGGCGGCGGCGGCGG + Intronic
1017953496 6:159158743-159158765 ATGGCGGAAGGCGAAGGGGAAGG + Intergenic
1018613397 6:165663270-165663292 GGCGCGGAAGGCGGCGGCGGCGG - Intronic
1019248251 6:170724035-170724057 TTTGCGGAAGAACACGGCGGAGG - Intergenic
1019711823 7:2521328-2521350 CTGGCGGGAGGGGGCGGCGGGGG + Intronic
1020279761 7:6644219-6644241 GAGGCGGAAGGCGAGGGAGGAGG + Intronic
1033040970 7:137917911-137917933 CTGGTGGAAGGGGAGGGCGGGGG + Intronic
1035499848 8:83677-83699 TTTGCGGAAGAACACGGCGGGGG + Intergenic
1036756989 8:11477322-11477344 GTGGCTGAAGGCCACGGCTGAGG + Intergenic
1039454608 8:37698430-37698452 ATGGCAGGAGGCGGCGGCGGCGG - Exonic
1039884768 8:41648625-41648647 TTGGCGGAAGCCGGGGGTGGAGG - Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1046847148 8:118930404-118930426 TGGGGGGAAGGCGGGGGCGGCGG + Intronic
1048554007 8:135457708-135457730 CGGCCGGAAGGCGGCGGCGGCGG - Exonic
1049668388 8:143858950-143858972 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049668804 8:143860549-143860571 CTGGCGGCGGGCGGCGGCGGTGG + Exonic
1049669219 8:143862151-143862173 CTGGCGGCGGGCGGCGGCGGTGG + Exonic
1049669634 8:143863753-143863775 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049670044 8:143865346-143865368 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1054781938 9:69174014-69174036 GGGGCGGGAGGCGGCGGCGGCGG - Intronic
1057192592 9:93095971-93095993 GAGGCGGAAGCCGACGCCGGAGG + Intergenic
1203609032 Un_KI270748v1:79657-79679 TTTGCGGAAGAACACGGCGGAGG - Intergenic
1185641504 X:1591611-1591633 AGGGCGGGCGGCGACGGCGGTGG + Exonic
1185734796 X:2488669-2488691 TTGGGGGATGGCGTCAGCGGCGG - Exonic
1186209311 X:7232969-7232991 ATGGCGGAAGGTGATGGCGAAGG - Intronic
1186607965 X:11111347-11111369 TGAGAGGAAGGCGGCGGCGGCGG + Exonic
1187067461 X:15854718-15854740 TTGGCCGGCGGCGGCGGCGGCGG + Exonic
1187332581 X:18354396-18354418 TCCGCGGAAGGCGCCGGGGGCGG + Intronic
1189323075 X:40097813-40097835 TAGGCGGGCGGCGGCGGCGGAGG - Intronic
1189792733 X:44619240-44619262 TTGGGGGAAGGGGACAGAGGGGG - Intergenic
1196768859 X:119273388-119273410 TTAGAGGGAGGCGACGACGGCGG - Intergenic
1201687004 Y:16716116-16716138 TTGGGGGAAGGGGAAGGTGGAGG + Intergenic
1201904463 Y:19075977-19075999 TGGGAGGAAAGCGGCGGCGGTGG - Intergenic