ID: 905779396

View in Genome Browser
Species Human (GRCh38)
Location 1:40694429-40694451
Sequence TTGTAAACAAAAATGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 610}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905779396_905779400 -7 Left 905779396 1:40694429-40694451 CCCTCCCTCATTTTTGTTTACAA 0: 1
1: 0
2: 4
3: 37
4: 610
Right 905779400 1:40694445-40694467 TTTACAATAACGTTTCACTGTGG 0: 1
1: 0
2: 0
3: 12
4: 153
905779396_905779403 26 Left 905779396 1:40694429-40694451 CCCTCCCTCATTTTTGTTTACAA 0: 1
1: 0
2: 4
3: 37
4: 610
Right 905779403 1:40694478-40694500 CAAAGCTACAAGTGAAAATAGGG 0: 1
1: 0
2: 1
3: 24
4: 293
905779396_905779402 25 Left 905779396 1:40694429-40694451 CCCTCCCTCATTTTTGTTTACAA 0: 1
1: 0
2: 4
3: 37
4: 610
Right 905779402 1:40694477-40694499 GCAAAGCTACAAGTGAAAATAGG 0: 1
1: 0
2: 1
3: 15
4: 198
905779396_905779401 3 Left 905779396 1:40694429-40694451 CCCTCCCTCATTTTTGTTTACAA 0: 1
1: 0
2: 4
3: 37
4: 610
Right 905779401 1:40694455-40694477 CGTTTCACTGTGGAAGATAGAGG 0: 1
1: 0
2: 1
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905779396 Original CRISPR TTGTAAACAAAAATGAGGGA GGG (reversed) Intronic
900832039 1:4972457-4972479 TTTTAATCAAAATTCAGGGAAGG + Intergenic
904224372 1:29003086-29003108 TGTTAAACAAAAATTATGGAAGG - Intronic
904336479 1:29801507-29801529 TTGTAAGGAAGAAAGAGGGAAGG - Intergenic
905779396 1:40694429-40694451 TTGTAAACAAAAATGAGGGAGGG - Intronic
906034648 1:42742587-42742609 TTTGGAACAAGAATGAGGGAAGG - Intergenic
906462832 1:46049815-46049837 TTAAAAAAAAAAATGAGGAATGG + Intronic
907997465 1:59647416-59647438 TAGCAAGCAAAAATGATGGATGG - Intronic
908152675 1:61319651-61319673 TTGTCTACAAAAAGGAGCGAAGG + Intronic
908672754 1:66566325-66566347 TCTGAAACAAAAATGATGGATGG - Intronic
908728074 1:67198045-67198067 TTGTGAACAAGATAGAGGGAGGG + Intronic
908738425 1:67301869-67301891 TTGAAAAAAAAAATGAGGCCAGG + Intergenic
909736562 1:78969718-78969740 TTTTTAACAAAAATGAGGACTGG + Intronic
909852896 1:80491447-80491469 TTGTAAATAAAACTGAGTGTAGG + Intergenic
910135511 1:83963975-83963997 TTATACACACAACTGAGGGAAGG - Intronic
910562853 1:88611032-88611054 ATGTAAATAAAAATGAGGGAAGG - Intergenic
910704617 1:90115078-90115100 TTTTAAAAAAAAAAAAGGGAGGG - Intergenic
911140972 1:94502238-94502260 TTGTCATGAAAAATGAGAGAAGG - Intronic
911537936 1:99122963-99122985 TGGGAAACAAGAATGAGGAAAGG + Intergenic
911735777 1:101335159-101335181 GGGTAGACAAAAATGAGAGAAGG + Intergenic
911907740 1:103590768-103590790 TTTTGAACAAAAATGAGGACTGG - Intergenic
911959226 1:104278675-104278697 TTATAAGATAAAATGAGGGAGGG - Intergenic
911960705 1:104298614-104298636 TTTAAAACAAAAATTAGGGCTGG + Intergenic
912111333 1:106346343-106346365 TTTTTAACAAAAATGAGGATTGG - Intergenic
912128245 1:106568104-106568126 ATCTAAAGAAAAATGAGGCAAGG - Intergenic
912234125 1:107830427-107830449 AAGTAAGCAAAAATGAGGTAGGG + Intronic
913276504 1:117143551-117143573 TTGTCAAAAAAAGTGAGTGAAGG - Intergenic
914678349 1:149921042-149921064 TTTGAAACAAAATTGAGGTAAGG - Intergenic
914815728 1:151060552-151060574 AGGTAAACCAAACTGAGGGAGGG + Exonic
914964682 1:152244602-152244624 TGCTAAAGAAAAATGAAGGAAGG - Intergenic
915191291 1:154153087-154153109 TTTTAAAAAAAATTGAGGGAGGG - Intronic
916161361 1:161918729-161918751 TTGGAAACAAAAATGAGTTGTGG + Intronic
916282146 1:163063589-163063611 TAGTAAACAATAAAGAAGGAGGG + Intergenic
916661257 1:166924042-166924064 TTTTGCACAAAGATGAGGGAGGG + Intronic
917011297 1:170475744-170475766 TAGTAAACAAATATGATGAAAGG + Intergenic
917076993 1:171215723-171215745 TTCTTAACAAAAATGAGGACTGG - Intergenic
917132526 1:171757222-171757244 AAGTAAGCAAAAATGAGGAAGGG - Intergenic
917209711 1:172619397-172619419 TTTTTAACAAAAATGAGGACCGG + Intergenic
917334351 1:173912930-173912952 ATGTATACAAAAATGACTGAAGG + Intronic
917374036 1:174328963-174328985 AGGAAAACAAAATTGAGGGAAGG + Intronic
918120518 1:181535292-181535314 TTTTAAAGACAAATGGGGGAGGG - Intronic
918340568 1:183565060-183565082 TTCAAAATAAAAATGGGGGAAGG + Intronic
918532341 1:185537522-185537544 TTGTAAACAGGAAAAAGGGAAGG + Intergenic
918581427 1:186135265-186135287 TGGTAACCAAAAAGGAAGGAGGG - Intronic
918907540 1:190516802-190516824 TAATAAAAAAAAATGAGTGAGGG + Intergenic
919171259 1:193957380-193957402 TTGTAAAGAAAAAAGAGAAAGGG - Intergenic
919788632 1:201275976-201275998 TTGCAGACAAAAATGCTGGATGG + Intergenic
919961303 1:202472336-202472358 TTGTTAAAAAAAATGAGTGGTGG + Intronic
921290247 1:213650465-213650487 GTGTCAGGAAAAATGAGGGAGGG - Intergenic
921424883 1:214989764-214989786 GTTTAAAAAAAAAGGAGGGAAGG - Intergenic
921825059 1:219663210-219663232 ATGTGGACAAAAATGAGGGATGG - Intergenic
921833882 1:219758443-219758465 TTGTGAACAAAACTGTTGGAGGG - Intronic
922222778 1:223621172-223621194 TTATAAACAAAGATTAGGGCAGG + Intronic
922567964 1:226613373-226613395 TTTTTAACAAAAATGAGGACTGG - Intergenic
923907119 1:238397657-238397679 TTTTAAAGAACAATGAGGGCCGG + Intergenic
924039171 1:239966611-239966633 ATGGAAACAAAAAGGAAGGAAGG - Intergenic
1063825167 10:9888840-9888862 TTGTAAAGAAAAATGAGTGTAGG + Intergenic
1063961691 10:11311236-11311258 TTGTAAACTCACGTGAGGGATGG - Intronic
1065479297 10:26176481-26176503 TTTTAAAGAAAAATGTGAGATGG + Intronic
1065537296 10:26727661-26727683 TTGTAAAAAAAAAAGAGGCCAGG - Intronic
1066271247 10:33826121-33826143 TTGTAAAAAAAAAAAAGGGGGGG - Intergenic
1066579797 10:36867695-36867717 TTTTAAAGAAAAATGAGAGCTGG - Intergenic
1066665339 10:37777420-37777442 TTGTATTCCAAAAAGAGGGAGGG - Intronic
1068087372 10:52391310-52391332 TTGTAATAAAAATTGAAGGATGG + Intergenic
1068345458 10:55772239-55772261 TTGTGAATAAGAATGAGTGATGG + Intergenic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1069728478 10:70596266-70596288 TTGGAAACAAACATGGGGGTGGG - Intergenic
1070122769 10:73594752-73594774 TAGCAAACAAAAATTAGAGACGG + Intronic
1070805378 10:79267748-79267770 TTGTCAACACAAGTGAGAGACGG - Intronic
1070876229 10:79813544-79813566 TTGTGAATAAGAATGAGTGATGG + Intergenic
1071142561 10:82527804-82527826 TTGTAAACAGAAAGGAGAGACGG - Intronic
1071375355 10:84996757-84996779 ATATAAACAACAAGGAGGGAGGG - Intergenic
1071643159 10:87335717-87335739 TTGTGAATAAGAATGAGTGATGG + Intergenic
1071926373 10:90414683-90414705 TTTTAAACAAACATGAGGACTGG + Intergenic
1073373335 10:103010523-103010545 TTAGAAACAAAAATGAGGCCAGG - Intronic
1073716286 10:106111474-106111496 TAGTAACCAAATATGGGGGAGGG + Intergenic
1074165195 10:110868959-110868981 ATGCAAAAAAAAATGTGGGAGGG - Intergenic
1074328139 10:112473404-112473426 ATTTAAAAAAAAATGTGGGACGG - Intronic
1074750038 10:116576871-116576893 TTGTAAACTAAAAAGGGGCAGGG + Intergenic
1075793227 10:125100549-125100571 TTTTAAACAAAAATAAAAGAAGG + Intronic
1075853238 10:125605532-125605554 GTGAAAACAAAAAAGAGTGAAGG + Intronic
1076330578 10:129662101-129662123 TTGTAAATAAGAATGGGGGTGGG + Intronic
1077580148 11:3412258-3412280 TTTTAAACAAAAATGGGGCTGGG + Intergenic
1079831112 11:25269177-25269199 TATTAAACAAAAATTAGAGAAGG + Intergenic
1080203355 11:29699955-29699977 TTGTAGAAAAAAATGATTGAAGG - Intergenic
1080297499 11:30747235-30747257 TTGAAAAGAAAATTGGGGGAAGG + Intergenic
1080664289 11:34322001-34322023 TTGTTAGCAACAATGAAGGAAGG + Intronic
1081641316 11:44756293-44756315 GTGAGAACAAAAAGGAGGGAGGG + Intronic
1082729238 11:56774824-56774846 TTGTAAAAAAAAATGATGTGGGG - Intergenic
1082840691 11:57687248-57687270 TAGAAAAAAAAAATGTGGGAAGG - Intronic
1084237072 11:67795085-67795107 TTTTAAACAAAAATGGGGCTGGG + Intergenic
1084504468 11:69556562-69556584 TTGCAAACAGAAATCAGGGCCGG + Intergenic
1084835331 11:71797749-71797771 TTTTAAACAAAAATGGGGCTGGG - Intronic
1084852548 11:71954239-71954261 AAGTAAAAAAAAATAAGGGAAGG - Intronic
1084880321 11:72166482-72166504 TTTTTAACAAAAATGAGGACTGG - Intergenic
1084906461 11:72351869-72351891 TTTTAAAAAAAAATGAGGGGAGG - Intronic
1084932660 11:72569532-72569554 TTTAAAACAAAAATGAGGCTGGG + Intergenic
1085142557 11:74160568-74160590 TAGTTAACAAAGATTAGGGAAGG + Intronic
1086308962 11:85514624-85514646 TTGTAAAAATACATGAGGAATGG - Intronic
1086387078 11:86320279-86320301 TTGTAAAGAACAAAGAGGGCTGG + Intronic
1086491847 11:87363670-87363692 ATGTATATAAAAATGAGGAATGG - Intergenic
1087532244 11:99398552-99398574 AAGTAAACAAAAAATAGGGATGG - Intronic
1087673424 11:101131415-101131437 TTGTCAATAAAAAGGAGTGAAGG - Intergenic
1088003036 11:104905594-104905616 ATGTAAACAAAAAATAGTGAAGG - Intergenic
1088242306 11:107785013-107785035 TTTTAAAGATAAATAAGGGAAGG - Intergenic
1088320235 11:108547749-108547771 TACTAAACAAACATAAGGGAAGG - Intronic
1088623047 11:111706484-111706506 TTCAAAACAAAAATAAGGGCAGG + Intronic
1089047373 11:115514339-115514361 TTGTAAAGAAAGATGAAGGCAGG - Intergenic
1089445216 11:118546483-118546505 CTGTAAAAAAAAAGGAAGGAAGG + Intronic
1089916277 11:122159966-122159988 TTTTAACCAAAGATGTGGGAGGG - Intergenic
1090009364 11:123032638-123032660 TTCTAAACACAAATGAGGCGAGG + Intergenic
1092306067 12:7302395-7302417 TTGGCAACAACAATGAAGGATGG + Intergenic
1092563280 12:9638472-9638494 TTTTTAACAAAAATGAGGACTGG - Intergenic
1092746327 12:11675812-11675834 CTCTAAACAAAAAGGAAGGAAGG + Intronic
1093772013 12:23029267-23029289 GTTTAAAAAAAAATGAGGGTTGG - Intergenic
1093830727 12:23754194-23754216 TTGTGAAGGAAAACGAGGGAGGG + Intronic
1094301267 12:28967425-28967447 GTGTGGAGAAAAATGAGGGAGGG - Intergenic
1094367734 12:29701868-29701890 ATTTAAACAAAAATAAGGTAAGG + Intronic
1094503616 12:31041723-31041745 CAGAAAACAAAACTGAGGGAGGG - Intergenic
1094648120 12:32347245-32347267 TTTAAAAGAAAAATGAGGGCAGG - Intronic
1095135232 12:38592895-38592917 TTTTAAACAAAAATTAAGAATGG - Intergenic
1095582267 12:43813878-43813900 TTGTAAAAGAAAGTAAGGGAGGG - Intergenic
1095680574 12:44970949-44970971 TTTTAAACAAAAATAATGTAAGG + Intergenic
1097061359 12:56286683-56286705 TTGTTAATATAAAAGAGGGAGGG - Intronic
1097601510 12:61698783-61698805 TTTTTAACAAAAATGAGGACTGG + Intergenic
1097755530 12:63402979-63403001 TTGTAAAAGAAAATTAGTGAGGG + Intergenic
1099234461 12:80067132-80067154 TTCTAAACAAAAATGAATTAAGG + Intergenic
1099663711 12:85598673-85598695 CTGAAAATGAAAATGAGGGAAGG + Intergenic
1100395670 12:94184424-94184446 TTTCAAAAAAAAATGAGAGAGGG - Intronic
1100986261 12:100204133-100204155 CTTTAAAAAAAAATGGGGGAGGG + Intronic
1101015038 12:100491444-100491466 TTGTAAATAAAAATGAAGTCTGG - Intronic
1101214178 12:102564081-102564103 TTTTACACAGAAAGGAGGGAAGG - Intergenic
1101774262 12:107779370-107779392 CTGAAAAAAAAATTGAGGGAGGG + Intergenic
1102863618 12:116357192-116357214 TTATAAAAAAGAAAGAGGGAAGG + Intergenic
1103559276 12:121784077-121784099 GTGAAAAGAGAAATGAGGGAAGG - Intronic
1104125402 12:125841302-125841324 TGGTAAACAGGAATGAGAGAGGG + Intergenic
1104832560 12:131763829-131763851 TTTTAAAGAAAAATGAGGCCGGG + Intronic
1105473623 13:20712999-20713021 TTATAAAAAAGAAAGAGGGAGGG - Intronic
1106056044 13:26238215-26238237 TTATAAACCAAGATGAGGGCTGG - Intergenic
1107667639 13:42708477-42708499 TTGTAAAGGAAAAGAAGGGAGGG - Intergenic
1107778497 13:43873797-43873819 CTGTCAAGAAAAATGAGGCAGGG - Intronic
1108204019 13:48070493-48070515 TTTTTAACAAAAATGAGGACTGG + Intronic
1108278908 13:48841147-48841169 TTTTAAAAAAAAATTAGTGAAGG - Intergenic
1108530664 13:51324480-51324502 TAATAAACAAAAAAGAAGGAAGG + Intergenic
1108535462 13:51371977-51371999 TTGAAAATAAAAATGAGAAAAGG - Intronic
1109284030 13:60390801-60390823 TTCTAAATAAAAATGAAGAAAGG - Intergenic
1109865611 13:68259845-68259867 TTCTTAACAAAAATGAGGACTGG + Intergenic
1110095914 13:71520416-71520438 CTCTAAACAAGAATTAGGGAAGG + Intronic
1110256987 13:73443744-73443766 TTGTTAACAAAAATGAGGACTGG + Intergenic
1110328709 13:74246862-74246884 GTGTTAAAAAAGATGAGGGAGGG + Intergenic
1110498485 13:76197726-76197748 TTTAAAACAAAAATGGGTGAAGG - Intergenic
1110511164 13:76352735-76352757 TTTTAGACAAAATTGAGGGTAGG - Intergenic
1110907084 13:80904586-80904608 CTGTAAACAAAGATGAGAAAAGG + Intergenic
1111308786 13:86453180-86453202 TTGCAAGCAAAAATTAGGGAAGG + Intergenic
1111466254 13:88615173-88615195 TTGTAAATTAAAAAGAGGTAAGG - Intergenic
1111669846 13:91316877-91316899 TTATAAAGAAAAGTGAGGCAAGG + Intergenic
1114395459 14:22354999-22355021 GTATAAAAAAAAATGAAGGAAGG + Intergenic
1114746152 14:25149634-25149656 ATGTAAAGAAAAAAGGGGGAGGG + Intergenic
1114894464 14:26969827-26969849 TTCTAAAAAAAAATGAGGCTGGG + Intergenic
1116390156 14:44381695-44381717 TTTTAAACAAACATGAGGACTGG - Intergenic
1117118171 14:52538053-52538075 TAGTAAACAAAAGGGAAGGATGG - Intronic
1117403031 14:55374928-55374950 TTGAAAACAATAATGAGGGATGG - Intronic
1118110705 14:62715766-62715788 ATGTAAAGAAAAAGGAAGGAAGG + Intronic
1118999263 14:70866465-70866487 TTTTTAACAAAAATGAGGACTGG - Intergenic
1119231917 14:72986824-72986846 ATGTAAAGAAAAATCAGGGCCGG - Intronic
1119367088 14:74102063-74102085 TTGTAAACTAAAATGCTGGTTGG - Intronic
1119598849 14:75960847-75960869 TTGTTAAAAAGAATGAGTGAAGG - Intronic
1119607937 14:76036826-76036848 TTCTAAAAAAGAAGGAGGGAGGG - Intronic
1119964463 14:78898665-78898687 TTATAAACAAAAAGTAGAGATGG - Intronic
1120297933 14:82667895-82667917 TTGAAAAGAAAAATGGGGAAAGG - Intergenic
1120380150 14:83767276-83767298 TAGTGAAGAAAAATGAAGGAAGG + Intergenic
1120609114 14:86618625-86618647 TTAAAAAAAAAAATGAGGGTAGG - Intergenic
1120804891 14:88736815-88736837 CTATAAAAAAAAATTAGGGAAGG - Intronic
1120820745 14:88909895-88909917 TTGAGAACAAAAAGCAGGGAGGG + Intergenic
1121230207 14:92352034-92352056 TAGTAAACAGAAATGAGGAAGGG + Intronic
1122455420 14:101846661-101846683 TTGTTACCAAAAATGAGGGCTGG + Intronic
1123766122 15:23480037-23480059 TTTTTAACAAAAATGAGGACTGG + Intergenic
1124114070 15:26823548-26823570 TTGTAACCTAAAAGCAGGGATGG + Intronic
1124514986 15:30360235-30360257 TTTAAAGCAAAAATGTGGGAGGG + Intergenic
1124551646 15:30686402-30686424 TTGTAGCCAACAATGAAGGAGGG + Intronic
1124727936 15:32170527-32170549 TTTAAAGCAAAAATGTGGGAGGG - Intronic
1125062395 15:35439955-35439977 TTTTTAACAAAAATGAGGACTGG + Intronic
1125677276 15:41509155-41509177 TTGACTACAAAAATGGGGGATGG + Intronic
1126288633 15:47045555-47045577 TTTTAAACAAAATTGTGAGATGG - Intergenic
1128183164 15:65622696-65622718 TTTTATACAAGAATGAAGGAGGG - Intronic
1128194534 15:65740174-65740196 TGGTAAACAAAATAGAGGAACGG + Intronic
1128648334 15:69393117-69393139 TTGGAATCAAAAAGGAGGAAGGG + Intronic
1128917347 15:71575671-71575693 TTAGAGACAATAATGAGGGAAGG - Intronic
1129011252 15:72419682-72419704 ATGCAAAGAAAAAGGAGGGATGG + Intergenic
1129293245 15:74584634-74584656 TTGGAGACAAAGATGAGAGATGG - Intronic
1129874798 15:78967005-78967027 TTTTAAAAAAAAATGAGGCTGGG + Intronic
1130164373 15:81437477-81437499 TGGGAAAGGAAAATGAGGGATGG - Intergenic
1130389760 15:83445381-83445403 TTCTGAACAAAAGTGAAGGAAGG + Intergenic
1131721649 15:95175113-95175135 CTGTAAATAAAAATATGGGAGGG + Intergenic
1132321470 15:100928755-100928777 TTGTAAACAAACATGAGCTGAGG - Intronic
1133348678 16:5087501-5087523 TTTTAAACAAAAATGGGGTTGGG + Intronic
1133649377 16:7796614-7796636 TTGTTAACTAAAAAGAGGTAAGG - Intergenic
1134862503 16:17573190-17573212 TTGAAAACAAACATGAGGCCAGG + Intergenic
1134909895 16:18015925-18015947 CTGTGAACAAATTTGAGGGAGGG - Intergenic
1135176479 16:20234134-20234156 TTTTAAATAAAAATGAGAAATGG + Intergenic
1135945416 16:26860626-26860648 TGGTCAACAGGAATGAGGGAGGG + Intergenic
1136121766 16:28141166-28141188 CTGTAAACAAATGTGAGTGAGGG - Intronic
1136988501 16:35136792-35136814 GTGTAAAACAAATTGAGGGAAGG + Intergenic
1137942643 16:52703972-52703994 GTGTAAACAAGATTGAGGGTAGG - Intergenic
1138444298 16:57053823-57053845 TTGAAAACCCAAATGAGGAACGG - Intronic
1138918151 16:61493586-61493608 TTTTGAAAAAAAATAAGGGATGG + Intergenic
1139658385 16:68403204-68403226 TTGGAAAGAAAAATGAAGCAGGG - Intronic
1139828350 16:69775775-69775797 TTTTAAACAAGAACTAGGGAGGG - Intronic
1140345510 16:74209233-74209255 TAGGAAACTAACATGAGGGAGGG + Intergenic
1140703580 16:77605259-77605281 TTTGAAACAAAGATTAGGGAGGG + Intergenic
1140775550 16:78246058-78246080 CTGCAAAAAAGAATGAGGGAAGG - Intronic
1140902588 16:79383406-79383428 GTTTAAAAAAAAATGAAGGATGG + Intergenic
1141059784 16:80855380-80855402 TTGTAAATGAAAAAGAGAGATGG + Intergenic
1141863029 16:86730936-86730958 CTTTAAAAAAAAGTGAGGGAGGG - Intergenic
1142427874 16:90010334-90010356 TTGTGAAAAAAAATGAGGCCAGG - Intronic
1203143320 16_KI270728v1_random:1783411-1783433 CTGTCGACAAAAATGAGGAATGG - Intergenic
1142810090 17:2391930-2391952 TTGGAAATAAAAGTGAGGCACGG - Intronic
1142932660 17:3300128-3300150 TTAAAAAAAAAAAAGAGGGAAGG - Intergenic
1143062597 17:4214834-4214856 TTGAAAAGAAAAATGACAGAAGG + Intronic
1143519002 17:7435103-7435125 TCGCAAAAAATAATGAGGGATGG - Intergenic
1143843048 17:9749981-9750003 TTGAAAACAAAAAAGGGGGGTGG - Intergenic
1144013991 17:11176477-11176499 TAGTAAAAAAAAATGAGAGGTGG + Intergenic
1144886283 17:18464741-18464763 TTGTCAAAAAAAAAGAAGGAAGG + Intergenic
1145408575 17:22634052-22634074 TTGTGAATAAGAATGAGTGATGG + Intergenic
1145764671 17:27450174-27450196 TTGAATAAACAAATGAGGGAGGG - Intergenic
1146039268 17:29435334-29435356 TTTTTAACAAAAATGAGGACTGG - Intronic
1146362265 17:32186659-32186681 TTTAAAACAAAAATGGGGGCCGG - Intronic
1146389073 17:32404502-32404524 TTGGAAACAATAATTAAGGAGGG + Intergenic
1149464365 17:56864006-56864028 TTGTATTGAAAAATGAAGGAGGG + Exonic
1149879767 17:60277551-60277573 TTGTAAACTAAAATGTGGTAAGG + Intronic
1150191254 17:63242290-63242312 TTGTAAACAAAAAATACAGAAGG + Intronic
1150803931 17:68303853-68303875 TAGTTAACAAAAATGGGGAAAGG + Intronic
1151032018 17:70752470-70752492 TTGTCAACAAAACTGAGTAAAGG + Intergenic
1151061499 17:71099878-71099900 TTGTAGACAAATATGAATGAAGG + Intergenic
1153420757 18:4902263-4902285 TTATAAACAAAAAGGAAGAAAGG - Intergenic
1153439544 18:5101406-5101428 TTGTTGACTAAACTGAGGGAAGG - Intergenic
1153447117 18:5186551-5186573 TGGTAAACCAAAATGAGGAATGG + Intronic
1153585834 18:6619362-6619384 TTATAAACCACAATGAGGGCTGG + Intergenic
1154089910 18:11348327-11348349 TTGTAAACAAAAGAGAGTGGAGG + Intergenic
1154942149 18:21124700-21124722 TTAAAAAAAAAAATGAGGGCAGG - Intergenic
1155190485 18:23424962-23424984 TTTAAAAGAAGAATGAGGGATGG + Intronic
1155480324 18:26279733-26279755 TTGTCAACAAAAATAAGTAATGG + Intronic
1155765891 18:29632025-29632047 TTGTACACAAAAATGTGTTAAGG - Intergenic
1155774672 18:29745622-29745644 TTTTCAGCAAAAATGAGGGCAGG + Intergenic
1156566325 18:38195656-38195678 CTGTAAACAGAAATCAAGGAAGG - Intergenic
1156698616 18:39797011-39797033 TTTTTAACAAACATGAGGAATGG - Intergenic
1158152006 18:54383938-54383960 TTTTAAACAAAAATGATGACTGG - Intronic
1158641173 18:59205446-59205468 TTTTAAACAAAAATGAGGACTGG + Intergenic
1158989386 18:62853186-62853208 TTGTAAATATACATAAGGGAAGG - Intronic
1159004185 18:62998318-62998340 TTGTATTCTAAAATGATGGAAGG - Intergenic
1159043524 18:63346946-63346968 TCATAAAAAAAAATGAGGGTAGG + Intronic
1159143108 18:64420971-64420993 TTTTAAACAAATATGAGGCTTGG - Intergenic
1159382366 18:67677075-67677097 ATGCATACAAACATGAGGGAGGG - Intergenic
1159420748 18:68216418-68216440 ATAAAAAAAAAAATGAGGGAAGG - Intergenic
1159546223 18:69842207-69842229 GTGTAAGCAAAAATGTGAGAAGG + Exonic
1159712144 18:71774059-71774081 CTGGAAACTAAAATGGGGGAGGG - Intronic
1162082783 19:8228721-8228743 TTATAAAAAAAAATCAGTGAAGG + Intronic
1164927420 19:32140963-32140985 TGGAAAACAAAAATCAGTGAGGG - Intergenic
1165168521 19:33873681-33873703 TTGGAAACAAAGGGGAGGGAGGG - Intergenic
1165769797 19:38372867-38372889 TTTTAAACAAAAATGATGGCCGG - Intergenic
1165872691 19:38984366-38984388 TTTTAAACAAAAACGATGGCCGG + Intergenic
1166335643 19:42105154-42105176 TTTGAAACAAAAATTAGGTATGG - Intronic
1166539134 19:43594122-43594144 TTGAAAACAAAACTGATGGTGGG + Intronic
1167309208 19:48727192-48727214 TTGTAAACTATGATGAGGGTTGG - Intronic
925884262 2:8380981-8381003 TTATTAACAAAAGTGAGGGGTGG + Intergenic
926682247 2:15672856-15672878 TTGTAAAGAAAGAAGAGGAAAGG - Intergenic
927248487 2:20977587-20977609 TTGGAAACAAAAATGAAAAATGG + Intergenic
928242031 2:29594881-29594903 TTCTAAACAAAAATGGGGGGTGG + Intronic
928677778 2:33666657-33666679 GTGTAAAAAAAAATTATGGAAGG - Intergenic
928833739 2:35519018-35519040 TTTTTAACAAAAATGAGGACTGG - Intergenic
928838754 2:35579794-35579816 ATGTGAACATAAATTAGGGAGGG + Intergenic
928840645 2:35600324-35600346 TTGTAAATAAAGATGGGGGAGGG + Intergenic
929560924 2:42955873-42955895 ATGTAGACAAAGATGAAGGAGGG - Intergenic
929999103 2:46849051-46849073 TTTTAAAAAAAAATGAAGAAAGG + Intronic
930734247 2:54758999-54759021 TTGAAAACAAAAAATAGGGATGG + Intronic
931071649 2:58658336-58658358 TAGTGAGCAGAAATGAGGGAGGG + Intergenic
931244558 2:60481312-60481334 TTGAAAACAAAAATGAAGCAGGG + Intronic
931394468 2:61873993-61874015 TTGTTAAGAAAAATGAGGTCAGG - Intronic
931685995 2:64794139-64794161 TTGTAAACTAAATTCAGTGAGGG - Intergenic
932027250 2:68147720-68147742 TTTTAAAGAAAAATGAGTAAAGG - Intronic
932171679 2:69563264-69563286 TTGCAAGGAAAAGTGAGGGAAGG + Intronic
932389921 2:71378652-71378674 TGGTAAAAAAAAATTAGGAAAGG + Intronic
932880822 2:75500239-75500261 TTTTCAACAAAACTGAAGGAAGG + Intronic
932917113 2:75871677-75871699 TTCTAAAATAAAATGAGAGACGG + Intergenic
933260456 2:80126168-80126190 CTGAAAAGAAAAATGAGGCAAGG + Intronic
933762137 2:85679621-85679643 AAGAAAAGAAAAATGAGGGAAGG - Intergenic
933817798 2:86082129-86082151 TTATAAAGAAAAATGAGGCCAGG - Intronic
934146404 2:89098957-89098979 TTGAAAACAGGAATTAGGGAGGG - Intergenic
934222863 2:90101618-90101640 TTGAAAACAGGAATTAGGGAGGG + Intergenic
935178324 2:100668701-100668723 TTGTGAACAAAAAAGCGAGAGGG - Intergenic
935454807 2:103254922-103254944 TTCTTAAAAAAAATTAGGGAGGG - Intergenic
935695959 2:105771269-105771291 TAGTAAAAAAACATGAGGGCTGG + Intronic
936174920 2:110211294-110211316 GTGTAAACATAACTGAGGTAAGG - Intergenic
936445965 2:112595501-112595523 TTCAAAACAAAAATGAAGGCAGG - Intergenic
937621004 2:123985342-123985364 TTCTCAACAAAAATCAGGAAGGG + Intergenic
937727794 2:125187573-125187595 TTTTTAACAAAAATGAGGACTGG - Intergenic
939051796 2:137316388-137316410 ATATGTACAAAAATGAGGGAGGG - Intronic
939542909 2:143515192-143515214 TTGTAAAGAAAAGGGAGGGTGGG - Intronic
940991682 2:160103622-160103644 TTGCAAACAAAAATCATGCATGG + Intronic
941183346 2:162288366-162288388 TTGAAAAGAAAAATAAGAGAAGG + Intronic
941359751 2:164537448-164537470 GTATAAACTAAAAGGAGGGAGGG + Intronic
942171344 2:173292423-173292445 TTTTTAACAAAAATGAGGACTGG - Intergenic
942696288 2:178650384-178650406 ATCTAAACAAAAATAAGAGAAGG - Intronic
942839218 2:180339543-180339565 TTTTTAACAAAAATGAGGACTGG + Intergenic
942982998 2:182105058-182105080 TTGTAAAAAAAAATGAGGGGTGG + Intronic
943094060 2:183407265-183407287 TTGAAAACAACATTCAGGGATGG + Intergenic
943141131 2:183983476-183983498 TTGAAAATAAAAATGAGGCCTGG + Intergenic
943153197 2:184139205-184139227 TTGTAAAGAAAAATGGGGTTTGG - Intergenic
943863807 2:192902054-192902076 ATTTAAACAAAAAAGGGGGAGGG - Intergenic
943984866 2:194605817-194605839 CTTTAAAAAAAAATGGGGGAAGG + Intergenic
943997898 2:194795573-194795595 TTGGCAATAAAAAAGAGGGAAGG - Intergenic
944090693 2:195907283-195907305 TTGTAAATAAAAAGCAGGAAAGG - Intronic
944276797 2:197848289-197848311 TTATGAAGAAAAATCAGGGAAGG + Intronic
944761335 2:202818198-202818220 AAGTAAACAGAAATGAGTGAAGG + Intronic
945011784 2:205471657-205471679 TAGAAAATAAAAATGAGGGCCGG - Intronic
945346186 2:208719904-208719926 TTGTAAAAAAAAATGAAATAAGG + Intronic
945356122 2:208841881-208841903 TTATAAACAAAAATTTGAGAAGG + Intronic
945361531 2:208900765-208900787 TTGGGAACAGAGATGAGGGAGGG - Intergenic
945438197 2:209844539-209844561 TTGGAAAGAAAAAGGAAGGAAGG - Intronic
946217670 2:218198223-218198245 TTCTAAATAAAAAGAAGGGAGGG + Intergenic
946294748 2:218775094-218775116 TTAAAAAAAAAAATGAGGGCTGG - Intergenic
946297364 2:218795766-218795788 TTTTTAACAAAAATGAGGACTGG - Intronic
946566637 2:220972678-220972700 TTGGAAACACAAATGAGATAAGG - Intergenic
1170048290 20:12111380-12111402 TTGTAAATAAAATTGAAGCAAGG + Intergenic
1170222067 20:13951713-13951735 TTTTTAACAAAAATGAGGACTGG + Intronic
1170324381 20:15140044-15140066 TTGTATAGAAAAATGTGGGTGGG + Intronic
1170363126 20:15569081-15569103 TTGTAGAGAAGGATGAGGGAGGG + Intronic
1171176526 20:23054208-23054230 TTGTGAAAAAAAATCAGGGATGG + Intergenic
1171373038 20:24673966-24673988 TGGGAAACAAAGATGAGGAAGGG + Intergenic
1171726679 20:28628312-28628334 TGGTAAACAAAAAAGAGCAAGGG + Intergenic
1172052686 20:32131012-32131034 TTTTAAAAAAAAATGACAGAGGG + Intronic
1172370538 20:34386865-34386887 GTGGAAACAAAAATGTGGAAAGG - Intronic
1172700122 20:36848147-36848169 CTCTAAATAAAAATGAGAGAGGG + Intronic
1175060503 20:56238021-56238043 TTGTACAGAAAAATGTGGAATGG - Intergenic
1175376546 20:58529927-58529949 TTGTGAAAAAAAAGGAAGGAAGG - Intergenic
1176765059 21:13008525-13008547 TTGTGAACAAATATAATGGATGG - Intergenic
1177904906 21:26963891-26963913 ATGTAAACAAAGATGCTGGAGGG - Intronic
1178466689 21:32854710-32854732 TTTTTAACAAAAATGAGGACTGG - Intergenic
1179314007 21:40225238-40225260 TTGTAAACAGAAATGAAGGCAGG - Intronic
1184910213 22:47527150-47527172 TTGTAACCAAAGATCAGGGTGGG + Intergenic
949144643 3:683174-683196 TTGAAAACATCAATGAGGGGAGG - Intergenic
949627999 3:5889454-5889476 TTCTAAAGAAACATGAGAGAGGG + Intergenic
949793493 3:7819976-7819998 TTGTACACAAAAATGCGCAAAGG - Intergenic
949952455 3:9240484-9240506 TTGGAAAGAAAGATGAGGCAAGG - Intronic
951673307 3:25208983-25209005 TTGCAAACAAACATGAAGCATGG + Intronic
952218048 3:31297146-31297168 TTTTAAAAAAAAAGGAGGTATGG + Intergenic
952344167 3:32468552-32468574 CTATAAACAAAAAATAGGGAAGG - Intronic
952637235 3:35546662-35546684 TTTTTAACAAAAATGAGGACTGG - Intergenic
952662068 3:35863750-35863772 TTGAAAACAAAAATGTAGGCTGG - Intergenic
955375441 3:58392075-58392097 TTTTAAACAAAGATGAGAGTAGG + Intronic
955547423 3:60045967-60045989 TTGTAACCAAAAATTAGAGTTGG - Intronic
955613162 3:60779197-60779219 TTTTTAACAAAAATGAGGACTGG + Intronic
955680143 3:61491745-61491767 TTGTAAACAAAATCAAGAGATGG - Intergenic
956142714 3:66161900-66161922 TTGAAAAGAAAAATGAACGATGG + Intronic
957703239 3:83745713-83745735 TTCTAAACAAAAGTTAGGTAAGG - Intergenic
958536486 3:95411005-95411027 TTTTTAACAAAAATGAGGATGGG + Intergenic
958696387 3:97532948-97532970 TTATAAACAAAAATTCGGCATGG + Intronic
959556807 3:107729021-107729043 TTTTAAACAATACTGAGGGCGGG + Intronic
959628086 3:108475911-108475933 TTGAAAACAGAAATGAGAGATGG - Intronic
960055888 3:113276125-113276147 TTGTAGACAAAGATCAGGGCAGG + Intronic
960306404 3:116066898-116066920 TTGCAAAAAAAAATGGGGGCAGG - Intronic
961301813 3:125926685-125926707 TTTTAAACAAAAATGGGGCTGGG - Intergenic
961886654 3:130101153-130101175 TTTTAAACAAAAATGGGGCTGGG + Intronic
962346114 3:134620096-134620118 TTGCAAACACAAATGAGAGTGGG - Intronic
962427753 3:135287359-135287381 TGGTAAAAAAAAATGAGTAAAGG - Intergenic
962488918 3:135871954-135871976 TTATAAACAAAACTTAGGGTTGG - Intergenic
962906190 3:139805236-139805258 TGGGACACTAAAATGAGGGATGG - Intergenic
963229720 3:142896731-142896753 TTGAAAACAAAAAGAAGAGATGG - Intergenic
963310693 3:143707096-143707118 TTGCAAACAAAATTTTGGGATGG - Intronic
963616270 3:147542175-147542197 TTGTAAACAAAAAGGGGGGTTGG + Intergenic
963688603 3:148470319-148470341 TTGGAAAAAAAAATGGTGGAGGG + Intergenic
963755883 3:149234843-149234865 TTGTAAAGAAGTATGGGGGAGGG + Intergenic
963959931 3:151298454-151298476 TAGTAAACAAGAAGAAGGGATGG - Intronic
964158380 3:153614882-153614904 ATGAAAAGAAAAATCAGGGAAGG + Intergenic
965362405 3:167757356-167757378 TTATAAACAAACATGAGTAAAGG + Intronic
965412035 3:168344313-168344335 TTGGGGTCAAAAATGAGGGACGG - Intergenic
965444728 3:168761266-168761288 ATGTAAACAAAAGAGAGGAAAGG - Intergenic
965681092 3:171252386-171252408 ATGTAATTAAAAATGAGGGGAGG + Intronic
965682106 3:171262173-171262195 TTCTAAACAAAACGAAGGGAAGG - Intronic
966148890 3:176844372-176844394 GTGTAGAAAAAAATGTGGGAAGG + Intergenic
966523572 3:180898292-180898314 TTTTTAACAAAAATGAGGACTGG + Intronic
966579294 3:181541623-181541645 TGGAAAAAAAAAATGAGGTAAGG + Intergenic
966587804 3:181646983-181647005 TTTTAAACAAAATTGTTGGAGGG + Intergenic
966983267 3:185156724-185156746 TTGTAAACAAAAATTAAAGAAGG + Intergenic
967673749 3:192271143-192271165 TGGTAACCAAAAATGATGCATGG - Intronic
968995821 4:3945170-3945192 TTTTAAACAAAAATGGGGCTGGG + Intergenic
970035790 4:11734522-11734544 TTGTAAACAAAAATGTTAGCAGG - Intergenic
970465892 4:16322692-16322714 TGGTAAAGAAAAATGAAGCAAGG - Intergenic
970469208 4:16359200-16359222 TTATTAACAAAAATGATAGAGGG - Intergenic
970628498 4:17916160-17916182 AAGAAAACAAAAATTAGGGAAGG - Intronic
970681843 4:18517786-18517808 TTACAAACAAAAATGAAGTATGG + Intergenic
970813024 4:20118063-20118085 ATGAAAAGAAAAATGAGGAAAGG + Intergenic
971109969 4:23573820-23573842 TTTTTAACAAAAATGAGGATTGG - Intergenic
972024353 4:34358602-34358624 TTGTTAATAAAAATGAGGACTGG - Intergenic
973581404 4:52347962-52347984 TTGTAAACAAGAATGATCTAGGG + Intergenic
973760614 4:54111673-54111695 TTTTAAAAAAAAATTAGAGATGG + Intronic
973777371 4:54255799-54255821 TTTAAAAAAAAAAGGAGGGAAGG - Intronic
973848364 4:54935902-54935924 TTGCCAGCAAAAATGAGGCATGG - Intergenic
975614344 4:76231508-76231530 TTTTTAACAAAAATGAGGACTGG - Intronic
975621732 4:76303481-76303503 TTATAAAGAGAAATGAAGGATGG - Intronic
975943632 4:79678165-79678187 TTATAAAAAAAAATAAGGAAAGG + Intergenic
976920254 4:90432276-90432298 TTGTTCAAAAAAATGAGAGATGG + Intronic
977171388 4:93767115-93767137 TTGGAAAGCAAAATGAGAGAAGG + Intronic
977334363 4:95677507-95677529 TTACAAAGAAAAATCAGGGAAGG - Intergenic
978328746 4:107588123-107588145 TTTTTAACAAAAATGAGGACTGG - Intergenic
978639549 4:110853625-110853647 GTGCAAAAAAAAATTAGGGATGG - Intergenic
979086921 4:116424703-116424725 TTGCCAACCAAAATGAGTGATGG - Intergenic
979128306 4:117005777-117005799 TGGTTAGCAAAAATGAAGGAGGG + Intergenic
980380786 4:132012383-132012405 TGATATAAAAAAATGAGGGAAGG + Intergenic
980722790 4:136719691-136719713 TTTTTAACAAAAATGAGGACTGG + Intergenic
980724709 4:136743222-136743244 TTGAAAACAGAAATTTGGGAGGG + Intergenic
981173044 4:141646962-141646984 TTTAAAACAAAAATGAATGAGGG + Intronic
981255736 4:142659096-142659118 TTTTTAACAAAAATGAGGACTGG + Intronic
981310038 4:143288851-143288873 ATGTGAATAAAAAGGAGGGAGGG - Intergenic
981324347 4:143428746-143428768 TTTTTAACAAAAATGAGGACTGG - Intronic
981428246 4:144628822-144628844 TTTTAAAAAGAAATGAGGTAAGG + Intergenic
982102878 4:151985518-151985540 TTGTGAACAAAGAAGAGGAATGG + Intergenic
982424010 4:155235441-155235463 ATGAAAATAAAAATGAGGGTTGG - Intergenic
982477816 4:155874131-155874153 TTTTAAACAAAATTGAGGATTGG - Intronic
982970815 4:161983364-161983386 TTGTAAACAAAAGCTAGGAAGGG - Intronic
984205393 4:176781730-176781752 TTGTAAACAAAGACAAGGGAAGG + Intronic
984435512 4:179705565-179705587 TTGTAGAATAGAATGAGGGATGG - Intergenic
984497524 4:180517033-180517055 TATTAAAAAAAAATGAGAGAAGG + Intergenic
984981514 4:185286478-185286500 TTACACAGAAAAATGAGGGAAGG + Intronic
985306899 4:188553390-188553412 TTGTTAACAAAAATAAAAGAGGG - Intergenic
985860052 5:2463820-2463842 TTCTCAACACAAATAAGGGATGG + Intergenic
986353839 5:6904910-6904932 TTGTTAACAAAAATGCTGGCTGG - Intergenic
988046060 5:25955313-25955335 TTGTAAAAAAAAAAAAAGGAAGG - Intergenic
988256033 5:28821355-28821377 TTCAAAATAAAAATGATGGATGG + Intergenic
988931300 5:36038020-36038042 TTGTAAATAAGAAAGAGGGTGGG + Intronic
989148441 5:38272362-38272384 TTTTAAAGACAAATGGGGGAAGG - Intronic
989182173 5:38589301-38589323 TTGTAAAAAAACATGGGGAAAGG - Intronic
989268349 5:39503538-39503560 TTATAAACAAAAATTGGGGGTGG + Intergenic
990470235 5:56108586-56108608 ATGTATACAAATATGAGTGAGGG + Intronic
990588437 5:57236595-57236617 TTTTAAAAAAAAATGGGGGCTGG - Intronic
990588632 5:57239038-57239060 TGGTAAACAGAATTAAGGGAAGG + Intronic
990688678 5:58337442-58337464 TTGTCAACAAACCTGAAGGATGG + Intergenic
990988807 5:61665049-61665071 TGGAAAAAAAAAATAAGGGAGGG + Intronic
992261352 5:74973666-74973688 GTGTAAACAAAAATTATGGGAGG - Intergenic
992833366 5:80616915-80616937 TTTTATACAGAAATGGGGGAAGG + Intergenic
993146632 5:84102243-84102265 TTGAAAACAGAAATGAGACAAGG + Intronic
993496096 5:88610739-88610761 GTGTAAACACAAATGAGAAAAGG - Intergenic
994090013 5:95801508-95801530 TTGTAAACAAAAAATATTGAGGG - Intronic
994295030 5:98080579-98080601 TTGGGAACAGAGATGAGGGAGGG - Intergenic
994715902 5:103321201-103321223 ATGTAAACAAAAATGAGGCTGGG - Intergenic
995006999 5:107211100-107211122 TTGGTAACAAGAATGATGGATGG - Intergenic
995217782 5:109614866-109614888 TTGTAAAAATTGATGAGGGATGG + Intergenic
995320601 5:110829665-110829687 TTTTTAACAAAAATGAGGACTGG + Intergenic
995563463 5:113408342-113408364 TTCAAAAGAAAAAAGAGGGAAGG + Intronic
996106330 5:119508415-119508437 TTATAAACAAAAATAAGGAAAGG - Intronic
996194849 5:120591823-120591845 TTGTAAATAAAAATGCAGAAGGG + Intronic
996459286 5:123722958-123722980 GTGTAACCAAGAATGAGTGAGGG - Intergenic
996574402 5:124965939-124965961 TTCTTAACAAAAATGAGGACTGG + Intergenic
996638237 5:125721208-125721230 TTTTTAACCAAAATTAGGGATGG - Intergenic
997269888 5:132527564-132527586 CTGCAAACAAAAAATAGGGAAGG + Intergenic
997333068 5:133081392-133081414 CAGTAAACACAAAAGAGGGAGGG - Intronic
997396878 5:133568049-133568071 TTTCAGACAAAAATGGGGGAGGG + Intronic
997632619 5:135380220-135380242 CTGTATACAAAGGTGAGGGAGGG + Intronic
998027727 5:138834301-138834323 TTATACACAAAAATGAGTGGTGG - Intronic
1000770071 5:165341986-165342008 ATGTTAACAACAATGAGGAAAGG + Intergenic
1000892541 5:166816633-166816655 TATTCAACAAAAATGAAGGAAGG - Intergenic
1001446169 5:171785685-171785707 TGAAAAATAAAAATGAGGGAAGG + Intergenic
1002977877 6:2103288-2103310 TTGAACTCAGAAATGAGGGAAGG + Intronic
1003306490 6:4933615-4933637 TTTTAAACAAAGATGGGAGAAGG + Intronic
1003656369 6:8014181-8014203 TGGTAAACAAATTTGAGGTATGG - Exonic
1003750572 6:9050445-9050467 TTGTTCACAGAAATCAGGGATGG - Intergenic
1004409318 6:15366039-15366061 GTGTAAACAAAAATGGGGTTGGG - Intronic
1004521786 6:16367789-16367811 AAGTAAACAAAAATGTGGTATGG + Intronic
1004714962 6:18208094-18208116 TTATGAAAAAAAGTGAGGGATGG - Intronic
1004822500 6:19382810-19382832 TTGTCACCACAAATAAGGGAAGG - Intergenic
1004890656 6:20097405-20097427 TTGTAATCAAAAATCTGTGAGGG + Intergenic
1007732973 6:43961992-43962014 TTGAAATCAAAACTGAAGGAGGG + Intergenic
1008139857 6:47819723-47819745 ATGCAAACATAAATGAGGAATGG + Intronic
1008371921 6:50742296-50742318 CAGTAAACAGAACTGAGGGAAGG + Intronic
1008725258 6:54409943-54409965 TTGTAACCAAAAAAGCGGTAGGG - Intergenic
1008818679 6:55604082-55604104 TTTTAAAGAAAAAAAAGGGAAGG - Intergenic
1009044238 6:58218397-58218419 TTGTTAATAAAAATGAGTCAGGG + Intergenic
1009044440 6:58221071-58221093 TGGTAAAGAGAAATTAGGGAGGG - Intergenic
1009220265 6:60975315-60975337 TGGTAAAGAGAAATTAGGGAGGG - Intergenic
1009632089 6:66213113-66213135 TTTTGAACAAAAATGAGGCCTGG + Intergenic
1010106048 6:72169534-72169556 TAGAAACCAAAAATGAGGGATGG + Intronic
1010453511 6:76029439-76029461 TTTTTAACAAAAATGAGGACTGG + Intronic
1010819683 6:80398694-80398716 TTGAAAAAAAAAAATAGGGAGGG + Intergenic
1010884920 6:81224483-81224505 TTGTAAATAAACATGTGGAATGG - Intergenic
1010919252 6:81661592-81661614 TTGTAATTTAAAATGAGTGATGG - Intronic
1011590994 6:88970821-88970843 TTTTTAACAAAAATGAGGACTGG + Intergenic
1012480015 6:99656180-99656202 TTGAAAACAAAAAAAAGGCAGGG + Intergenic
1012673415 6:102085698-102085720 TTGTAAATATATATGAGGCAAGG + Intergenic
1013412618 6:109895155-109895177 TTTTAAACAAAATTGTGGAAAGG + Intergenic
1013477253 6:110520555-110520577 TTGGAAACATAAAAGAGGAAAGG + Intergenic
1013546425 6:111162114-111162136 TTTTTAACAAAAATGAGGACTGG - Intronic
1013849506 6:114497066-114497088 TTGTAATCAAGATAGAGGGAGGG + Intergenic
1014002501 6:116380471-116380493 TTTTATACAAAAAAGAGGAAAGG + Intronic
1014961434 6:127691021-127691043 TTATAAGCAAAAATGCAGGAGGG + Intergenic
1015088423 6:129325135-129325157 ATTTACACAAAAATGTGGGAGGG - Intronic
1015116011 6:129650281-129650303 TTGTAGAAAAAAGGGAGGGAAGG + Intronic
1015813221 6:137181570-137181592 TTTTTAACAAAAATGAGGACTGG - Intergenic
1016685419 6:146876541-146876563 TTTTCAACAGACATGAGGGATGG + Intergenic
1017559413 6:155610765-155610787 TTTTCAACAAAAATGAGGACTGG - Intergenic
1017632181 6:156407215-156407237 TTGCAAAAAAAAATTAGAGAGGG + Intergenic
1017645698 6:156538206-156538228 TTGCAAACAAAAGCCAGGGAGGG - Intergenic
1017947892 6:159110468-159110490 TTGCAAACAAAATTGTGAGAAGG + Intergenic
1018219440 6:161563571-161563593 TTGTGAACACAAATCAGAGAAGG + Intronic
1018730128 6:166643686-166643708 TGGTAAACAAAATTGAAGGCAGG - Intronic
1019105976 6:169667424-169667446 TTGGAAACAAAAATGAAACAAGG + Intronic
1019127309 6:169849416-169849438 TTGCAAACAAAAGTGAGAGTCGG - Intergenic
1019234754 6:170601369-170601391 TTGTAAACAGAAATGAGGCTGGG - Intergenic
1019633483 7:2063031-2063053 CTAGAAAGAAAAATGAGGGAAGG + Intronic
1019634997 7:2070775-2070797 TTGGAAACAGGAATGTGGGATGG + Intronic
1020227447 7:6291292-6291314 TCTCAAACAAAAAAGAGGGAAGG + Intergenic
1020421445 7:8010914-8010936 TAGAAAAAAAAAATGAGGTAGGG - Intronic
1020555589 7:9665448-9665470 TTTTTAACAAAAATGAGGACTGG - Intergenic
1020701028 7:11483731-11483753 TTGGAAACAAAAGTGAGAGAAGG - Intronic
1020956398 7:14744743-14744765 TTTTTAACAAAAATGAGGACTGG + Intronic
1022322350 7:29298857-29298879 TTTTTAACAAAAATGAGGACTGG - Intronic
1022601102 7:31760646-31760668 TTTTAAACAAAAATAAGTGTTGG + Intronic
1022732720 7:33045751-33045773 TTAAAAAAAAAAATGAGGGCCGG - Intronic
1023719089 7:43074400-43074422 TTTTTAACAAAAATGAGGACTGG - Intergenic
1024398204 7:48893333-48893355 TTTTTAACAAAAATGAGGATTGG + Intergenic
1027420143 7:78010911-78010933 TTGTTAACAAAAATAAGGACTGG + Intergenic
1027568380 7:79829061-79829083 ATATAAACAAAGATGAGTGATGG + Intergenic
1027569859 7:79851670-79851692 TTCAAAATAAAAATGAGGGCTGG - Intergenic
1028151123 7:87373542-87373564 TTTTAAAAAAAATTGTGGGAAGG + Intronic
1028475370 7:91247889-91247911 TGAGAAACAAAAATGTGGGAAGG - Intergenic
1029380407 7:100210677-100210699 GTGAACACAAACATGAGGGAGGG - Intronic
1029692111 7:102189392-102189414 TTTTAAAAAAAAAAGAGGTAGGG + Intronic
1030539441 7:110811425-110811447 TCATAAACAAATATAAGGGATGG + Intronic
1030930204 7:115513354-115513376 TTGTAAATAAAAAAGAGAGAAGG - Intergenic
1031298105 7:120030334-120030356 TTTTAAACAGTAATGAGGCAGGG - Intergenic
1031678677 7:124643667-124643689 ATGTAAACAAAAGTGGGGGCTGG + Intergenic
1032686008 7:134234476-134234498 TTGGAAACAACAATGAAGAAAGG - Intronic
1033865984 7:145691145-145691167 TTATTAGCAAAAATGAGGGCTGG + Intergenic
1034156982 7:148964053-148964075 TTGTGAATAAATATGAGGGCTGG - Intergenic
1034989183 7:155536881-155536903 ATTTAAATAAAAATGAGTGATGG + Intergenic
1035445053 7:158935457-158935479 TTGTAAACACTAGTGAGAGAAGG - Intronic
1036297065 8:7545953-7545975 TTGAAAACAAAACTTAGGAATGG - Intergenic
1036325504 8:7775066-7775088 TTGAAAACAAAACTTAGGAATGG + Intergenic
1036616164 8:10389526-10389548 TTTTAACAAAAAATGAGGCAGGG + Intronic
1037393018 8:18414559-18414581 TTAAAAAAAAAAATGATGGAAGG - Intergenic
1038023575 8:23570212-23570234 TTGTAAATAAAAAGGGGGAAAGG - Intronic
1038452389 8:27648309-27648331 TTAAAAACAAAAAGGAGGCAGGG + Intronic
1039090054 8:33818395-33818417 ACAAAAACAAAAATGAGGGAAGG - Intergenic
1040432517 8:47357772-47357794 TTCTGAAAAAAAATTAGGGAAGG + Intronic
1040758290 8:50807572-50807594 TTTTTAACAAAAATGAGGACTGG + Intergenic
1040898963 8:52397300-52397322 ATGTAAAAATAAATGAGTGAAGG - Intronic
1040919836 8:52604147-52604169 TTTTTAACAAAAATGAGGAGTGG + Intergenic
1041371649 8:57167154-57167176 CTGAAAGAAAAAATGAGGGAGGG - Intergenic
1041483455 8:58348630-58348652 TTCAAAATAAAAATGAGGGCTGG + Intergenic
1041904580 8:63018350-63018372 TTTTAAATCAAAATGAGGAAAGG - Intronic
1041912067 8:63099511-63099533 TTTTTAACAAAAATGAGGGCCGG + Intergenic
1042817149 8:72890073-72890095 TTGGAAAGAAAAAAGAAGGATGG + Intronic
1043268222 8:78294006-78294028 TTGTACAAAAATATTAGGGAGGG + Intergenic
1043868337 8:85400801-85400823 TTGTAAACAAATATCTGGGATGG + Intronic
1044552576 8:93528676-93528698 TAGTAATGAAAAATAAGGGAAGG + Intergenic
1045024023 8:98069436-98069458 TTATAAATAAAGATGAGAGAAGG - Intronic
1046213938 8:111117217-111117239 TTGGAGACAAAAGGGAGGGAGGG + Intergenic
1046269362 8:111873424-111873446 TTGTAGTGAAAAATGTGGGAGGG + Intergenic
1046374102 8:113352995-113353017 TTGCAAGCTAAAATGATGGAAGG + Intronic
1046796802 8:118382218-118382240 TTGGGAACAGAAAGGAGGGAGGG - Intronic
1047291522 8:123535139-123535161 CTTTAAACAAAAATGACGAATGG + Intronic
1048175944 8:132152976-132152998 TTTTAAACAAAAATGAGTATTGG + Intronic
1048467658 8:134680482-134680504 TTTTTAAAAAAAATGAGGGATGG + Intronic
1048894023 8:138972618-138972640 TTATCACCAAAAAAGAGGGAGGG - Intergenic
1049520920 8:143090163-143090185 ATTTAAAAAAAAATGAGGCAGGG + Intergenic
1050334713 9:4579445-4579467 TTACAACCAAAAAAGAGGGAGGG - Intronic
1050343563 9:4664080-4664102 TTGTAAACAAAAATAAGCATGGG - Exonic
1050407617 9:5326872-5326894 TTGATAACAGAAATGAGGAAGGG + Intergenic
1050414614 9:5402929-5402951 TTGAAAACAGAAATGAGCAAGGG + Intronic
1050508803 9:6372977-6372999 TTTTTAACAAAAATGAGGACTGG - Intergenic
1050920389 9:11194380-11194402 TGGTAAACAAAATTGAAGGCTGG - Intergenic
1052215428 9:25961251-25961273 TTTTAACCAAAAATGAGGACTGG - Intergenic
1052684620 9:31739643-31739665 GTTTACACAAAAATGAGAGAGGG - Intergenic
1052948703 9:34190205-34190227 TCTTAAACAAAAATCACGGAAGG + Intronic
1053023851 9:34714759-34714781 TTGTAGAAAAAAAGGAGAGATGG + Intergenic
1053260346 9:36657877-36657899 TTTTAAACAAAAAAGAAGGCCGG - Intronic
1053723060 9:40968791-40968813 TGGTAAACAAAAAAGAGCAAGGG - Intergenic
1054342907 9:63883205-63883227 TGGTAAACAAAAAAGAGCAAGGG + Intergenic
1055141668 9:72883389-72883411 TTGTAGAAAAATATGAGAGAAGG - Intergenic
1055206776 9:73740531-73740553 TTTTAAACGGAAATGAGGAAAGG + Intergenic
1055794251 9:79957338-79957360 TATTAAAAAAAAATGAGGCAAGG + Intergenic
1055906503 9:81300540-81300562 TTTTAAACAAAATTGAAGGTTGG + Intergenic
1057395812 9:94679020-94679042 GGGAAAACAAAAATGAGGGAGGG + Intergenic
1057471154 9:95357839-95357861 TTGTAAACGAAAACAAGGGCTGG - Intergenic
1057595003 9:96408234-96408256 TTTTAAAAAACAATGTGGGAAGG + Intronic
1058282133 9:103128654-103128676 TTTTTAACAAAAATGAGGACTGG - Intergenic
1058339457 9:103876578-103876600 TTGAAAACATAAATAAGGAAGGG + Intergenic
1058508727 9:105693590-105693612 TTGTCAAATAAAATGAGGAACGG - Intergenic
1058855540 9:109058298-109058320 TTAAAAAGAAAAATGAGGGCTGG - Intronic
1059242132 9:112815698-112815720 TTGTAAACCAAACTGATGGAAGG - Intronic
1059498718 9:114731976-114731998 TTGTACAGGAAAATGAAGGAAGG + Intergenic
1059874020 9:118612675-118612697 GTGGAAACAAATATGAGGAATGG - Intergenic
1060013315 9:120063811-120063833 TTGTTAACAAAAATAAAGCAGGG - Intergenic
1060844925 9:126828477-126828499 TTGAAAATAAAAATGAAGGCTGG - Intronic
1185549240 X:970153-970175 CTGTTGACAAAAATGAGGAATGG + Intergenic
1185687647 X:1942452-1942474 TTGTAAACCAAAATGATGTTTGG - Intergenic
1186899797 X:14042041-14042063 TTTTAATTAAAAATGAGTGAGGG - Intergenic
1187733377 X:22279413-22279435 GTTTAAACACAAATGAGCGATGG - Intergenic
1188046929 X:25436354-25436376 TTGCAAAGAAAAATGTGGGTGGG - Intergenic
1188096967 X:26035157-26035179 TTTTAAAAATAAAGGAGGGAAGG - Intergenic
1188173472 X:26958356-26958378 GTGAAAAAAAAAAGGAGGGAGGG + Intergenic
1188186382 X:27120533-27120555 TAGAAAACAGGAATGAGGGAGGG - Intergenic
1188407288 X:29827492-29827514 CTATGAACAAAAATGAGAGAGGG + Intronic
1188516778 X:30996178-30996200 TTGTAAAGAATAATAAGGAAAGG + Intergenic
1188669115 X:32861514-32861536 CTGTTTATAAAAATGAGGGAAGG + Intronic
1188936651 X:36184567-36184589 TTGCAACCAAAAATGAAAGAAGG + Intergenic
1189361619 X:40357945-40357967 TTTTAAAGAAAAATTAGAGATGG + Intergenic
1189593515 X:42540444-42540466 TTGTGAACAAAAATGATGATTGG - Intergenic
1189616641 X:42790584-42790606 TTTTAAACAAAAATGAGGACTGG - Intergenic
1189632558 X:42970325-42970347 TTTTTAACAAAAATGAGGACTGG - Intergenic
1189773854 X:44452505-44452527 TTGTAAAAGAGAATGAGGGATGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190490955 X:50982423-50982445 TTTTTAACAAAAATGAGGACTGG + Intergenic
1190718865 X:53130165-53130187 TTGGAAACAAAAATTATGTAGGG - Intergenic
1190723079 X:53167316-53167338 TTGGAAGAAAAAATAAGGGATGG + Intergenic
1192442939 X:71188456-71188478 TTGTAAACAAGAATAAGGCTGGG - Intergenic
1192443929 X:71195933-71195955 TTGTAAACAATAATAAGGCTGGG + Intergenic
1192681251 X:73255870-73255892 TTTTTAACAAAAATGAGGACTGG - Intergenic
1193347847 X:80424670-80424692 TTTTTAACAAAAATGAGGACTGG - Intronic
1193408510 X:81134208-81134230 TTGTAACCAAAATTGAGAAATGG - Intronic
1193445201 X:81592995-81593017 TTGGAAACAAAAAAAAGGCAGGG - Intergenic
1194013820 X:88594758-88594780 TTGGAAAAATAAATGGGGGAAGG + Intergenic
1194066499 X:89268012-89268034 TTCTTAACAAAAATGAGGACTGG - Intergenic
1194085075 X:89516379-89516401 AGGAAAACAAAAATTAGGGAGGG - Intergenic
1194436059 X:93869600-93869622 TTTTTAACAAAAATGAGGACTGG - Intergenic
1194809961 X:98377096-98377118 TTTTAACCAAAAATGAGGACTGG - Intergenic
1195472563 X:105247917-105247939 TTATAAAAAAAAATTAGAGAAGG - Intronic
1195627309 X:107017623-107017645 TATGAAACAAAAAGGAGGGAAGG + Intergenic
1196002611 X:110802932-110802954 TTGAAAAAAAAAATGTGGGCAGG - Intergenic
1196038841 X:111178512-111178534 TTGTAAAAATAAATAAGAGAAGG + Intronic
1196111771 X:111954185-111954207 TTGTAAACAAAAATGAGTGGGGG + Intronic
1196195653 X:112836272-112836294 TTGTTAACAAGAATGGGGGAGGG + Intronic
1196469738 X:116011831-116011853 TTGGGAACAGAAATTAGGGAGGG - Intergenic
1197038552 X:121907312-121907334 TTTTTAACAAAAATGAGGACTGG + Intergenic
1197163135 X:123345816-123345838 TGGGGAACAAAAATCAGGGAAGG + Intronic
1197189861 X:123634167-123634189 TTGTATATAAATATGGGGGAAGG + Intronic
1197365898 X:125564106-125564128 TTTTTAACAAAAATGAGGACTGG - Intergenic
1197396446 X:125933128-125933150 TTTTTAACAAAAATGAGGACTGG - Intergenic
1197800502 X:130342756-130342778 ATGTAAATGAAAATGTGGGAAGG + Intronic
1198632912 X:138661661-138661683 TGGTAAAAGAAAATGAGAGAAGG + Intronic
1198859925 X:141058176-141058198 ATGGAAAAAAAAATGAGGTAAGG + Intergenic
1198871157 X:141178182-141178204 TTTAAAACAAAAATTAGGGCCGG + Intergenic
1198902768 X:141529214-141529236 ATGGAAAAAAAAATGAGGTAAGG - Intergenic
1198939564 X:141938513-141938535 TTTTTAACAAAAATGAGGACTGG + Intergenic
1199234060 X:145470847-145470869 TTTTAAACAAACATGAGGACTGG + Intergenic
1199540067 X:148948774-148948796 AAGTAAGCAAAAATGAGGAAGGG - Intronic
1200023552 X:153233876-153233898 TGGTAAACAAATATTAGGAAAGG - Intergenic
1200437723 Y:3172263-3172285 AGGAAAACAAAAATTAGGGAGGG - Intergenic
1200720668 Y:6602133-6602155 TTCTTAACAAAAATGAGGACTGG - Intergenic
1200768539 Y:7102400-7102422 CTGTGAAGAAAAATCAGGGACGG - Intergenic
1201633123 Y:16092216-16092238 ATGGAAAGAAAAATGAAGGAAGG + Intergenic
1201796007 Y:17896951-17896973 TGGAAAACAAAAAAGAGGCAGGG + Intergenic
1201805548 Y:18009034-18009056 TGGAAAACAAAAAAGAGGCAGGG - Intergenic
1202087324 Y:21152646-21152668 TTATAAACAAAAATGAAGATCGG - Intergenic