ID: 905782103

View in Genome Browser
Species Human (GRCh38)
Location 1:40720931-40720953
Sequence TTGAATCCCCACTATGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1331
Summary {0: 1, 1: 1, 2: 21, 3: 207, 4: 1101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905782102_905782103 6 Left 905782102 1:40720902-40720924 CCTGTGTTTGTTCATTCAGTAGA 0: 1
1: 0
2: 5
3: 69
4: 1587
Right 905782103 1:40720931-40720953 TTGAATCCCCACTATGTGCAAGG 0: 1
1: 1
2: 21
3: 207
4: 1101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905782103 Original CRISPR TTGAATCCCCACTATGTGCA AGG Intronic
900929965 1:5730215-5730237 TTGAATCCCTCCTATGTGCCAGG - Intergenic
901002141 1:6154197-6154219 CTGCATACCCACTGTGTGCAGGG - Intronic
901046530 1:6399510-6399532 TTGAGTACCTACTATGTGCTAGG - Intergenic
901459150 1:9381331-9381353 TTGAACGCCTACTATGTGCCGGG - Intergenic
901667318 1:10833710-10833732 TTGAACACCTACTATGTGCCAGG + Intergenic
901763114 1:11483344-11483366 TTAAATACCTACTATGTGCCAGG + Intronic
902108451 1:14057846-14057868 TTGAAGACCTACTATGTGCCAGG - Intergenic
902503465 1:16925271-16925293 TTGAGTGCCTACTATGTGCCAGG + Intronic
902520837 1:17015000-17015022 TTGAGTACCTACTATGTGAAAGG - Intergenic
902627617 1:17685683-17685705 TTGAGTCCCTACTATGTGTCTGG - Intronic
902711813 1:18245690-18245712 TTGAGTGCCTACTATGTGCCAGG + Intronic
902772313 1:18652313-18652335 TTGAGAACCCACTATGTGCCAGG + Intronic
902824382 1:18962951-18962973 TTGAATCCCTGGTATGTGCCAGG + Intergenic
902937945 1:19778182-19778204 TTGAGTGCCTACTATGTGCTAGG + Intronic
902938170 1:19779743-19779765 TTGAGCCCCTACTATGTGCTGGG - Intronic
903020575 1:20390951-20390973 TTGAGTGCCTACTATGTGCCAGG - Intergenic
903174973 1:21575351-21575373 TGGAATCCCTACAATGTGCCAGG - Intronic
903287111 1:22284267-22284289 CTGAATCCCTACTATGGGCCTGG + Intergenic
903352503 1:22726323-22726345 TTAAGTCCCCACTAAGTGCCAGG + Intronic
903577574 1:24348216-24348238 TTGAAGGCCCACTATGTGCCAGG + Intronic
903926273 1:26833084-26833106 TTGACCCCCTACTATGTGCCAGG + Intronic
904208162 1:28868447-28868469 TCGAGGCCCCACTATGTGCCAGG - Intergenic
904258043 1:29269449-29269471 CTGAATGCCCACTTTGTGCTGGG + Intronic
904288219 1:29467375-29467397 TTGAGTGCCCACCATGAGCAGGG + Intergenic
904476022 1:30765113-30765135 TTGAATGCCTGCTATGTGCCAGG + Intergenic
904542269 1:31240874-31240896 TGAAATACCCACTATGTGCCAGG + Intergenic
904560925 1:31396839-31396861 ATGGAGCCCTACTATGTGCAGGG + Intergenic
904665680 1:32119467-32119489 TTAAGTGCCCACTATGTGCAAGG + Intronic
904780041 1:32939560-32939582 TTGATTTCCTATTATGTGCAAGG - Intronic
904846977 1:33427238-33427260 TTGAGTGCTCACTATGTGCTAGG - Intronic
904947109 1:34207437-34207459 TTGAGTCCTTACTATGTGCAGGG + Intronic
905004127 1:34696688-34696710 ATGAATACCAACTATGTGCTAGG - Intergenic
905241726 1:36585963-36585985 TTGAGTGCCCACTATGTGCCAGG + Intergenic
905290066 1:36915375-36915397 TTGAATGCCAATTATGTGCCAGG - Intronic
905292919 1:36935209-36935231 TTGAACCCCTACTATGTGTCAGG - Intronic
905336348 1:37247396-37247418 TTGAGTGCCTACTATGTGCCAGG + Intergenic
905418449 1:37821346-37821368 TTGAGTCCTTACTATGTGTAAGG - Intronic
905519300 1:38585852-38585874 TTGAGTGCCTACTATGTGCCAGG - Intergenic
905606585 1:39306055-39306077 TTGAATACCTGCTATGTGCTAGG - Intronic
905709555 1:40089558-40089580 TCGAATACCCACTATGCACAAGG + Intronic
905782103 1:40720931-40720953 TTGAATCCCCACTATGTGCAAGG + Intronic
905791566 1:40792321-40792343 CTGAATCCCCACTGTGCCCAGGG - Intronic
905807524 1:40887565-40887587 TTGAATGCCTACTATGTTCTAGG + Intergenic
905890948 1:41518033-41518055 TTGAGTGCCCACTATGTGTCAGG - Intronic
905996706 1:42387587-42387609 TTGAATGCCCACTCTGTGCCAGG + Intronic
906212638 1:44020721-44020743 GTGAGTCCCCACTATGTGCCAGG + Intronic
906266901 1:44438518-44438540 TTGAATACCTACTAGGTGCCAGG + Intronic
906267220 1:44441783-44441805 TTGAGTACCTACTATGTGCTAGG + Intronic
906272322 1:44489513-44489535 TTGAGTTCCCACTATGTGCCAGG + Intronic
906303277 1:44699333-44699355 TTGAATACCTACTGTGTGCTAGG + Intronic
906365700 1:45207364-45207386 TTGAGCACCCACTATGTGCCAGG - Intronic
906420980 1:45666526-45666548 TTGAATCCTTACCATATGCATGG - Intronic
906610885 1:47201468-47201490 AGGAATGCCCACTATGTGCCAGG + Intergenic
906645181 1:47469763-47469785 CTGAGTACCCACTATGTGCCAGG + Intergenic
906874726 1:49525109-49525131 CTGAATGCCAACTATGTGCCAGG + Intronic
906935747 1:50212712-50212734 CTGAATCCCTTCTATGTACAAGG + Intergenic
906937038 1:50223510-50223532 TTGAATATCCACTATTTGCCAGG + Intergenic
906946909 1:50302164-50302186 TTGAGTACCCACTATATGCCAGG - Intergenic
907172198 1:52478831-52478853 TTGAGTGCCTACTTTGTGCAAGG + Intronic
907194624 1:52676484-52676506 TTAACTGCCCACTGTGTGCAGGG - Intergenic
907313102 1:53551173-53551195 TTGAGCCCTCACTATGTGCCCGG + Intronic
907322500 1:53614095-53614117 TTGAATGCCTACTATATGCCAGG + Intronic
907388426 1:54140745-54140767 TTGAGTACCTACTATGTGCCAGG + Intronic
907391670 1:54162228-54162250 TTGAGTACCTACTATGTGCCAGG + Intronic
907489286 1:54798709-54798731 TTGAACACCTACTATGTGCCAGG - Intronic
907551150 1:55305751-55305773 CTGAGTACCTACTATGTGCAAGG - Intergenic
907679115 1:56547268-56547290 TTGAACTCCCACTATGTGCCAGG - Intronic
907725021 1:57011872-57011894 TTGAATACCTCCTATGTGCCAGG - Intronic
907803113 1:57791223-57791245 TTGAATTCCCACTATGCCCTAGG + Intronic
907849137 1:58237180-58237202 TTGAACCCCTACTGTGTGCAAGG - Intronic
907919936 1:58903039-58903061 TTGAATACCTACTGTGTGCCAGG - Intergenic
907925952 1:58955355-58955377 TTGAGTACCCACTATGTGGCAGG - Intergenic
908045635 1:60165160-60165182 TTGAGTCCCAACTATGTGTCGGG - Intergenic
908056041 1:60288338-60288360 ATGAATACCTACTATGTGCTAGG + Intergenic
908104153 1:60824256-60824278 TTGAGTACTCACTATGTGCCTGG - Intergenic
908228335 1:62078791-62078813 TTGAGTCCCTACTATGTTCCAGG + Intronic
908228345 1:62078832-62078854 TTGAGTCCCTACTATGTTCCAGG - Intronic
908261778 1:62344711-62344733 TTGGGTGCCCACTATGTGCCAGG + Intergenic
908560280 1:65299574-65299596 TTGAACCCTCACTATATGCCAGG + Intronic
908735407 1:67271206-67271228 TTGAACACCTACTATGTGCCAGG - Intergenic
908814113 1:68014043-68014065 TTGAGTGCCTACTATGTGCCAGG + Intergenic
908897521 1:68917164-68917186 TTGACTGCTTACTATGTGCAAGG + Intergenic
908987094 1:70037762-70037784 TTTAATACCTACTATGTGCCAGG + Intronic
909107399 1:71429945-71429967 TTGACTGCCTACTATGTTCAAGG + Intronic
909244142 1:73255537-73255559 TTGAGTGCCTACTATGTGCCAGG - Intergenic
909274020 1:73661822-73661844 TTGAATTCCTGCTATGTGCCAGG - Intergenic
909508604 1:76424445-76424467 TTGAACACCCACAATGTGCTTGG - Intronic
909547610 1:76865296-76865318 TTGAGTACCTACTATGTGCCAGG - Intergenic
909850908 1:80462597-80462619 ATGAGTCCTCACTATTTGCATGG - Intergenic
910072615 1:83237249-83237271 TTGAGTACCTACTATGTGCAAGG + Intergenic
910109049 1:83662330-83662352 TTGAGTGCCTACTATATGCAAGG - Intergenic
910155425 1:84212782-84212804 TTGAATACCTACTATATGCCAGG - Intronic
910245637 1:85135413-85135435 TTGAATGCCTTCTATGTGCCAGG + Intergenic
910255859 1:85246715-85246737 TTGAGTGCCTACTATGTGCCAGG + Intergenic
910591698 1:88933320-88933342 TTGAACTCCTACTATGTGCCAGG - Intergenic
910672902 1:89790935-89790957 CTGAATGCCCGTTATGTGCAGGG + Intronic
910789608 1:91037552-91037574 TTGAATTCCCCCTGTGTGCCTGG + Intergenic
910886457 1:91968500-91968522 CTGAATCCCTACTATGTGAACGG - Intronic
911056366 1:93711691-93711713 TTGAGTCTCTACTATGTGCCAGG - Intronic
911396134 1:97313175-97313197 TTGAATGCCTACTATGTGTCAGG - Intronic
911661846 1:100510237-100510259 TTGAATACCTTCTATGTGCCTGG + Intronic
911692630 1:100851655-100851677 TTGATTATCCACTATGTGCCAGG + Intergenic
911707311 1:101028202-101028224 TTTAATACCTATTATGTGCAAGG - Intergenic
912210031 1:107547135-107547157 CTGAGTGTCCACTATGTGCAAGG + Intergenic
912304733 1:108555912-108555934 TTGAATACCCACTAGGTACTGGG + Intergenic
912370408 1:109169656-109169678 GTGACTCCCCACTATGTGCCAGG + Intronic
912777049 1:112512263-112512285 TTGCATACCTACTATGTGCCAGG + Intronic
912882508 1:113430284-113430306 TTGAATACCTAGTATGTGCCAGG - Intronic
913053555 1:115137609-115137631 TTGAGTGCCTACTATGTGCTGGG + Intergenic
913359905 1:117968901-117968923 TTGAGTACCCACTATGTGCCTGG + Intronic
914334583 1:146702806-146702828 TTGAGTACCCACCATGTGCCAGG + Intergenic
914402832 1:147339540-147339562 TTGAGTACCTACTATGTGCATGG - Intergenic
914972889 1:152327171-152327193 TTGTATACCCATTATGTGCTAGG + Intergenic
915523970 1:156464992-156465014 TTGAGTGCCTACTATGTGCCAGG + Exonic
915687341 1:157646932-157646954 TTGAATGCCAGCTATGTGCCAGG + Intergenic
916040558 1:160957617-160957639 TTGAAGGCCCACTGTGTGCCAGG - Intergenic
916314652 1:163435967-163435989 ATTTATCCCCACTGTGTGCAGGG + Intergenic
916608705 1:166368578-166368600 TTGAATCCCCACTAGGTACAAGG + Intergenic
916742336 1:167657136-167657158 TTGAGTGCTTACTATGTGCAAGG - Intronic
916984517 1:170176534-170176556 TTTAATGCCTACTATGTGCCAGG + Intergenic
917018846 1:170564048-170564070 TTGAATGCCTATTGTGTGCAGGG - Intergenic
917049823 1:170908438-170908460 TTGAAACCTCAGTATGTGCAAGG - Intergenic
917253443 1:173088343-173088365 ATGCTTTCCCACTATGTGCAAGG + Intergenic
917296735 1:173527578-173527600 TTGGATGCCCACTATGTCCCAGG + Intronic
917332269 1:173893681-173893703 TTGAATGCTTACTATGTGCCAGG + Exonic
917654249 1:177110582-177110604 TGGAGTACCTACTATGTGCAAGG + Intronic
917966887 1:180184419-180184441 TTGAGTACTCACTATGTGCTAGG + Intronic
918118461 1:181517013-181517035 CTGAATACCCACTGTGTGCCAGG + Intronic
918185737 1:182126169-182126191 TTGAATACCTACTATGTCCCTGG + Intergenic
918238966 1:182605008-182605030 TTGAACACCTACTATGTGCTAGG + Intergenic
918479146 1:184958630-184958652 TTGAGTGCCTACTATGTGCCAGG - Intronic
919113632 1:193252826-193252848 CTGAATGCCTACTATGTGCAAGG - Exonic
920179995 1:204126715-204126737 TTGAGTGCCCACTACGTGCCAGG + Exonic
920291330 1:204925174-204925196 TTGAATGCCAGCTATGTGCCAGG + Intronic
920459588 1:206128965-206128987 TTGAGTACCCATTATGTGCCAGG - Intergenic
920739627 1:208568244-208568266 TTGAGAGCCTACTATGTGCAAGG - Intergenic
920818008 1:209353522-209353544 TTGAATACCTACTGTGTGCTAGG + Intergenic
921099471 1:211915950-211915972 TTGTACCCCTACTATGTGCCAGG + Intergenic
921103823 1:211955662-211955684 TTTAATGCCTACTATGTACAAGG + Intronic
921114919 1:212080968-212080990 TTGAACACCCAGTATGTGCTGGG + Intronic
921176313 1:212597914-212597936 TTGAATGCCTACCATGTGCCAGG - Intronic
921347749 1:214204228-214204250 TTGAATACTTCCTATGTGCAAGG - Intergenic
921469517 1:215531967-215531989 TTGAATTCCTCCTATGTGCCAGG + Intergenic
921710054 1:218365013-218365035 TTGAATACCCCCTATGTCCCTGG + Intronic
921916342 1:220614715-220614737 TTGAGTACCTGCTATGTGCAAGG - Intronic
922085326 1:222341382-222341404 TTGAACACCTACTATGTGCTAGG + Intergenic
922228893 1:223668509-223668531 TTGAGTCCCTACTATGTTCCAGG - Intergenic
922355340 1:224769812-224769834 TTGAATCCATACCATGTGCCAGG + Intergenic
922536534 1:226385220-226385242 TTGAATGCCTCCTATGTGCCAGG - Intronic
922953357 1:229578077-229578099 TTGAGTCCCCACTATGAGCAAGG + Intergenic
923160377 1:231309742-231309764 TTGATCACCCACTATGTGCTAGG - Intergenic
923330669 1:232921152-232921174 TTGAATACCTACTATGTGCTGGG - Intergenic
923637319 1:235712519-235712541 TTGAATACCCATTATGTGCAAGG - Intronic
924273568 1:242360993-242361015 TTGAATGCCCACTATGTACCTGG - Intronic
924698260 1:246422864-246422886 CTGAACCCCTACTATGTGCCAGG + Intronic
1062783825 10:243253-243275 TTGAGTACTCACTATGTGCTAGG - Intronic
1063060648 10:2547926-2547948 TTGAATACCAACTATGTGCTAGG - Intergenic
1063441141 10:6074328-6074350 TTGAGTACCTACTATGTGCCAGG + Intergenic
1064044782 10:12003117-12003139 TTGAATTCCTACTATGTGCTAGG + Intronic
1064264301 10:13812493-13812515 TTGAATGCCTACTATGTACAGGG + Intronic
1064452778 10:15458417-15458439 TTGAGTACCCACTATATGCCAGG + Intergenic
1064825908 10:19400521-19400543 TTTAATACCTACTATGTGCTAGG - Intronic
1064828436 10:19433041-19433063 TTGAACACTTACTATGTGCAGGG + Intronic
1065277850 10:24104029-24104051 ATGAATCCCCACAATGTGTGGGG - Intronic
1065844352 10:29733219-29733241 TTGAATAGCAACTATGTGCTAGG + Intronic
1066444853 10:35472928-35472950 TTGAGTCTCCACTATATGCTAGG - Intronic
1066597531 10:37067707-37067729 TTGGATACAAACTATGTGCAGGG - Intergenic
1066618327 10:37318826-37318848 TTGAATTTACACTATGTGCCTGG - Intronic
1066711149 10:38235663-38235685 CTGAATGCCCACTATGTACCTGG + Intergenic
1067347328 10:45446033-45446055 TTGGGTACCTACTATGTGCAAGG - Exonic
1067375189 10:45721207-45721229 TTGAGTGCCCACTGTGGGCAGGG - Intergenic
1067378540 10:45751308-45751330 TTGAGTGCCCACTGTGGGCAGGG + Intronic
1067713237 10:48667089-48667111 TTGAAGACTCACTATGTGCTGGG + Intergenic
1067733621 10:48832105-48832127 TTTATTCCACTCTATGTGCATGG - Intronic
1067886235 10:50091988-50092010 TTGAGTGCCCACTGTGGGCAGGG + Intronic
1067998074 10:51298848-51298870 TTGCATGCCTACTATGTGCCAGG - Intronic
1068574807 10:58673358-58673380 TTGAATTCCTACCATGTGCAAGG + Intronic
1069045159 10:63735624-63735646 TTGAATTCCTTCTATGTGAAAGG + Intergenic
1069658485 10:70107720-70107742 TTGAAACCCCACTCTCTGCAGGG + Intronic
1069745351 10:70711586-70711608 TTGAGTACCCACTATGTGCCAGG - Intronic
1069908298 10:71745109-71745131 CTGAATGGCCACTATGTGCCAGG + Intronic
1070076672 10:73143104-73143126 TTGAATGCCTCCTATGTGCCAGG - Intronic
1070644168 10:78189956-78189978 TTGAGCACCCACTATGTGCCAGG + Intergenic
1070671424 10:78380199-78380221 TTGAAGGCCCACTCTGTGCCAGG - Intergenic
1070825852 10:79390374-79390396 TTGAATGCTCTCTATGTGCCAGG - Intronic
1070829594 10:79410357-79410379 TTGAGTACCTACTATGTGCCAGG - Intronic
1070906370 10:80077156-80077178 TTGAACACCTACTATGTTCAAGG - Intergenic
1071241151 10:83706462-83706484 TTTAATGTCCACTATTTGCAAGG + Intergenic
1071264774 10:83955129-83955151 ATGAGTACCTACTATGTGCAAGG - Intergenic
1071380525 10:85054753-85054775 TTGAGTGCCCACTAAGTGCCAGG - Intergenic
1071397252 10:85236562-85236584 TTGAGTGCCCACTAGGTGCTAGG + Intergenic
1071539299 10:86465996-86466018 TGGAATCACCAATATGTGAATGG + Intronic
1071777659 10:88807109-88807131 TTGAGTTCCTACTATGTGCTGGG + Intronic
1071780226 10:88836320-88836342 TTGAATGCCTACCATGTGCCAGG - Intronic
1071815658 10:89230181-89230203 TTGAGTACCAACTATGTGCCAGG + Intronic
1071940978 10:90591675-90591697 TTGAGTACCCAGTATGTGCTAGG + Intergenic
1071984076 10:91033315-91033337 TTGACTGCCCACTATGTGCCAGG + Intergenic
1072301135 10:94063443-94063465 TAGAATGCCTACTATGTGCCAGG - Intronic
1072314705 10:94190657-94190679 TTGAACACCTACTATGTGCCAGG - Intronic
1072445867 10:95497901-95497923 TTGAGTGCCTACTATGTGCCAGG - Intronic
1072460685 10:95615954-95615976 TTGAGTACCTACTATGTGCAAGG - Intronic
1072543792 10:96418560-96418582 TTGAATACCTACTAGGTGCCAGG + Intronic
1072758530 10:98037111-98037133 TGGAATGCTCACTATGTGCCAGG - Intergenic
1072769993 10:98129887-98129909 TAGTATACCTACTATGTGCAAGG + Intergenic
1072859902 10:98992561-98992583 TTGAGTACCTACTATGTACAAGG + Intronic
1073028533 10:100506454-100506476 TTGAATGCCTACTATGAGTAGGG + Intronic
1073264890 10:102221040-102221062 TTGAGTGCCCACTATGTGCCAGG + Intergenic
1073489704 10:103844830-103844852 TTGAATTCCCATTTTGTGCCAGG - Intronic
1073546959 10:104357588-104357610 TTGAATCCCTACTATTTGCCAGG + Intronic
1073579910 10:104656014-104656036 TGGAGTCCCCTCTATGTGCCAGG + Intronic
1073652259 10:105373965-105373987 TGGAATGCCTACTATGTGCTAGG + Intergenic
1073937541 10:108651684-108651706 TTGAGGTCCCACTATGTGCAGGG - Intergenic
1074344246 10:112666542-112666564 TTGAATCCCCACTGTGTGCCAGG - Intronic
1074365701 10:112855811-112855833 TTGATTTCCTACTATGTGCCAGG - Intergenic
1074883469 10:117676531-117676553 TTGAGTACCTACTATGTGCCAGG - Intergenic
1074887825 10:117708424-117708446 TTGGGTCCCCACTTTGTTCATGG - Intergenic
1074946322 10:118284157-118284179 CTGAATACCTACTATGTGCAAGG - Intergenic
1075022033 10:118959169-118959191 TTAAATGCCAACTATGTGTATGG - Intergenic
1075365073 10:121879519-121879541 TTGAGTCCCTACTATGTGCCAGG - Intronic
1075639967 10:124057420-124057442 TTAAACACCTACTATGTGCAGGG + Intronic
1075675115 10:124290758-124290780 CTGAATGCCTACTATGTGCCAGG - Intergenic
1076125110 10:127967922-127967944 TTGAATACCTACTATGTGCAAGG + Intronic
1078379460 11:10827204-10827226 CTGAATGCCTACTATGTGCCAGG + Intronic
1078466980 11:11557675-11557697 TTGCATCCCTACTATATGGAAGG + Intronic
1078784497 11:14475343-14475365 CTGAATACCCACTAAGTGCTAGG - Intronic
1078806717 11:14713049-14713071 TTGAATACCAATTATGTGTAAGG + Intronic
1079017562 11:16882137-16882159 TGGAATACCTACTATGTGCCAGG - Intronic
1079336264 11:19573435-19573457 TTGAGTCCATACTATGTGCTTGG - Intronic
1079479771 11:20866913-20866935 TTGAATGTCCACTCTGTGCCAGG - Intronic
1079541167 11:21577197-21577219 TTGAAAACCCACTATATGGAAGG - Intergenic
1079597635 11:22270519-22270541 TTGAACACCTACCATGTGCAAGG - Intronic
1079621574 11:22562010-22562032 TTGAAGCCTCACTCTGTGCCAGG + Intergenic
1079922182 11:26446784-26446806 TTGAACCCCCATGATGTGCTAGG - Intronic
1079954682 11:26848276-26848298 TTGAATGCCTACAATGTGCTAGG - Intergenic
1080046508 11:27814222-27814244 TTGAGTGTCCACTATGTGCTAGG + Intergenic
1080178041 11:29391170-29391192 TTGAATGCCTACTATGTGTCAGG + Intergenic
1080281072 11:30557149-30557171 TTGAATTCCTGCTATGTGCCAGG - Intronic
1080541093 11:33266107-33266129 TTGAACGTCCACTAAGTGCAAGG + Intronic
1080573878 11:33580684-33580706 TTGAGCACCTACTATGTGCAGGG + Intronic
1080633165 11:34099015-34099037 TTGAGTGCCTACTATGTGCCAGG - Intronic
1080703161 11:34662751-34662773 TTGAGTGCCTGCTATGTGCACGG + Intergenic
1080869473 11:36225016-36225038 TTGAGTGCCTACTATGTGCCAGG + Intronic
1081329069 11:41782086-41782108 TTGAAACACTACTATGTGCTAGG + Intergenic
1081436856 11:43036294-43036316 TTGAATGCCTACTATGGGCCAGG + Intergenic
1081662751 11:44898062-44898084 TTGAGGACCCACTATGTGCCAGG + Intronic
1081719126 11:45273696-45273718 TTGCATACCTGCTATGTGCAAGG - Intronic
1081730578 11:45369245-45369267 CTGAATACCTACTATGTGCCAGG - Intergenic
1081928836 11:46853585-46853607 TTGAATACCTACTACGGGCAAGG - Intergenic
1082786063 11:57317537-57317559 TTAAGTCCCTACTATGTGCTGGG - Intronic
1082863952 11:57881483-57881505 TTAAATGCCTACCATGTGCAAGG + Intergenic
1083251225 11:61468615-61468637 TTGAATCTTTACTAAGTGCAGGG + Intronic
1084009676 11:66340596-66340618 TTGAGCCCCCATTATGTGCCAGG + Intronic
1084059565 11:66661571-66661593 TTGAATTCCTACTATGAGCTAGG - Intronic
1084114560 11:67034527-67034549 TTGAATGCCTACTATGTGCTAGG - Intronic
1085045455 11:73350268-73350290 CTGAGTGCCCACTATGTGCCAGG + Intronic
1085137188 11:74102310-74102332 TTGAATACCCAGTATGTGCCAGG + Intronic
1085267576 11:75246412-75246434 TTGAGACCCTACTATGTGCCAGG + Intergenic
1085325319 11:75602029-75602051 TTGAATACCTATTATGTGCCAGG - Intronic
1085524966 11:77158848-77158870 TTGGACACCCACTATGTGCCAGG + Intronic
1085536966 11:77227559-77227581 CTGAGTCCACACTTTGTGCAAGG - Intronic
1085876755 11:80416753-80416775 TTGAATACCTTCTATGTGCCAGG + Intergenic
1085892222 11:80594223-80594245 TTGGATACAAACTATGTGCAGGG + Intergenic
1086177613 11:83910846-83910868 TTGAGAACCCACTATGTGTATGG + Intronic
1086182663 11:83972803-83972825 TTGGATACCCACTCTGTGCCAGG + Intronic
1086204258 11:84239124-84239146 TTGAAATCCCACTACATGCATGG + Intronic
1086334691 11:85788173-85788195 TTGAACCCTAACTATGTGCCTGG + Intronic
1086492427 11:87368984-87369006 TGGAACACCCACTATGTGCCAGG - Intergenic
1086768704 11:90732785-90732807 TTGAGTCCCTACTATGTGTCAGG - Intergenic
1086926470 11:92645871-92645893 TGGAATACCCACCATGTACAAGG - Intronic
1087117050 11:94536655-94536677 TTGAATGCCAATTATGTGCCAGG - Intergenic
1087281799 11:96219169-96219191 TTGAGTGCCCAGTATGTGAAGGG - Intronic
1087500889 11:98952179-98952201 TTTTATACCCACTATGTGCTAGG - Intergenic
1087703918 11:101467402-101467424 TTACATACCCACTATGTGCCAGG + Intronic
1087758883 11:102084657-102084679 TTGAATACCAATTCTGTGCAAGG + Intergenic
1087767545 11:102172635-102172657 TTGAATACAAACTATGTGCCAGG + Intronic
1088155232 11:106794841-106794863 TTGAATGCCTAATATGTGCTAGG - Intronic
1088214124 11:107489298-107489320 CTGAATGCCCACTGTGTGCCAGG - Intergenic
1088262379 11:107956297-107956319 CTGAATGCCCACTATGTGCTAGG + Intronic
1088394635 11:109352892-109352914 TAGAATCCACATTATGTCCAAGG + Intergenic
1088556175 11:111063598-111063620 TTGAATGCCCACTTTGGGCCAGG + Intergenic
1088558428 11:111087176-111087198 TTGAATACCTACAATGTGCCAGG + Intergenic
1088650108 11:111950006-111950028 TTGAGTCCCTACTATCTGCCAGG - Intronic
1088675535 11:112188847-112188869 TTGAGTCCCTACTATCTGCCAGG - Intronic
1088709033 11:112490066-112490088 TTGAATACCTACTATGTACTAGG + Intergenic
1088838716 11:113603881-113603903 TTGAATTCCTACTATGTGCCAGG - Intergenic
1088851184 11:113704822-113704844 CTGAATTCCCACTTTGTGCCAGG - Intronic
1088950907 11:114568958-114568980 TTAAATCCCTACCATGTGCCAGG - Intergenic
1089102733 11:115977169-115977191 TTGAATACTCACTATGTGTTTGG - Intergenic
1089321721 11:117631001-117631023 TTGAGTGCCCACTATGTGCCAGG - Intronic
1089426699 11:118382882-118382904 TTGAATACCTACTATATGCCAGG + Intronic
1089550070 11:119267723-119267745 TTGAGTGCCTACTATGTGCTAGG - Intronic
1090204980 11:124879124-124879146 CTGAATGCCTACTATGTGCCTGG - Intronic
1090470582 11:126977629-126977651 TCGAACACCCACTATGTGCCAGG - Intronic
1090529955 11:127580228-127580250 TTGAATTATCACTATGTGCCAGG - Intergenic
1090903848 11:131056430-131056452 CTGAGTACCTACTATGTGCAGGG + Intergenic
1091011514 11:132005601-132005623 TAGAATCCCCACTATCTGTCAGG - Intronic
1091205855 11:133820594-133820616 GTGAATACCTACTATGTGCCAGG - Intergenic
1091294335 11:134462360-134462382 TTGAATACTTACTATGTGCCAGG + Intergenic
1091392491 12:134208-134230 TTGAAGGCCCACTATGTGCTGGG + Intronic
1091610958 12:2008504-2008526 TTGAATCTCTATTATGTACAAGG - Intronic
1093211546 12:16314740-16314762 TTGAATGCCCACCATGTCAATGG - Intergenic
1093525318 12:20098501-20098523 TTGAATGTCCACTATATGCCAGG - Intergenic
1093609864 12:21141094-21141116 TTGAATATCTACTCTGTGCAAGG + Intronic
1095573809 12:43711763-43711785 TTGAGTACCTACTATGTGCCAGG + Intergenic
1095909158 12:47408372-47408394 TTGAGTGCTCACTATGTGCCAGG - Intergenic
1095943801 12:47742342-47742364 TTGAGACCCTACTATGTGCCAGG - Intronic
1096691963 12:53326905-53326927 TTGAGTGCCTACTCTGTGCAAGG - Exonic
1096759436 12:53828119-53828141 TTGAGAGCCTACTATGTGCAGGG + Intergenic
1096813154 12:54184270-54184292 TTGAAAACCTACTATGTGCTCGG - Intronic
1096968145 12:55645029-55645051 CTGAATACCTACTATGTGCCAGG + Intergenic
1097204124 12:57305803-57305825 TTGAGTGCCTGCTATGTGCAAGG + Intronic
1097306111 12:58071000-58071022 TTGAGTACCCACTATGTTCCTGG - Intergenic
1097400481 12:59122487-59122509 TTGACTACCCATTATGTGCAAGG - Intergenic
1097526516 12:60743730-60743752 TTGAAAGCCCATTATGTTCAAGG - Intergenic
1097659302 12:62411385-62411407 TTGAGTGTCCACTATGTGCCAGG + Intronic
1097865265 12:64554850-64554872 TTGAGCCTCCACTATGTGCCAGG - Intergenic
1098133521 12:67376975-67376997 GTGAGTGCTCACTATGTGCAAGG + Intergenic
1098357682 12:69626885-69626907 TTGAACCCCCACTACATGCTCGG + Intergenic
1098465260 12:70779677-70779699 TTAAATACCTACTATGTGCCAGG - Intronic
1098581838 12:72109110-72109132 TTGATTGCCTACTATGTGCTAGG + Intronic
1098945529 12:76585146-76585168 ATGAATGCCTACTGTGTGCAAGG + Intergenic
1099237880 12:80103671-80103693 TTGAATGCCAACTATGTGCAAGG - Intergenic
1099274082 12:80553056-80553078 TTGAATGCCTACAATGTCCAAGG - Intronic
1100001456 12:89841608-89841630 TTGAATACCTACTTTGTGCTAGG - Intergenic
1100009135 12:89932968-89932990 TTTAATTCCTACTATGTGTAAGG - Intergenic
1100169881 12:91962386-91962408 TTGAATCTTTACTATGTACAAGG - Intergenic
1100356580 12:93836761-93836783 GTGAGTGCCTACTATGTGCAAGG + Intronic
1100559320 12:95731967-95731989 CTGAATGCCTACTATGTGCCAGG - Intronic
1100708728 12:97230699-97230721 TTGAGTGCCTACTATGTGCCTGG + Intergenic
1100959685 12:99948550-99948572 TTGAATTCCCAATATGTGCAAGG - Intronic
1101385581 12:104254440-104254462 TTGAGTGCCAACTATGTGCCAGG + Intronic
1101421230 12:104552881-104552903 TTGAGTACCTACTATGTGCTAGG - Intronic
1101485551 12:105155088-105155110 TTGAATTCCTACTATTTGCCAGG + Intronic
1101627687 12:106461641-106461663 CTGAATACCCACTATGTGCCAGG - Intronic
1102182880 12:110925416-110925438 TTTGAGCCCCACTATGTACAGGG + Intergenic
1102218465 12:111178639-111178661 TTAAATACCTACTATGTGCCTGG + Intronic
1102251857 12:111392947-111392969 TTGAGCCCCTACTATGTGCTAGG - Intergenic
1102477198 12:113196290-113196312 TTGTGTCCCCACTGTGTGCCTGG - Intronic
1102556127 12:113727808-113727830 TGGAATGGTCACTATGTGCAAGG + Intergenic
1102629586 12:114266216-114266238 TTGAGTACCAACTATGTGAAAGG + Intergenic
1102989376 12:117303779-117303801 TTGAATCCTGAGTTTGTGCAGGG + Intronic
1103088292 12:118079092-118079114 TTGAACCCCTGCTATGTGCCAGG - Intronic
1103144139 12:118579629-118579651 TTGAATGCCCAATTTGTGCTAGG + Intergenic
1103177875 12:118880167-118880189 TTGAGTGCCTACTATGTGCCTGG - Intergenic
1103225902 12:119287614-119287636 TTGAATGCCTACTATGTTCCAGG - Intergenic
1103260443 12:119583859-119583881 TTGAACACCTACTATGTGCCAGG + Intergenic
1103322183 12:120098672-120098694 TTGAGTGCCTACTATGTGCCAGG - Intronic
1103754741 12:123195657-123195679 TGGAATACCCACTAGGTGCTAGG + Intronic
1104031995 12:125071498-125071520 TTGCATCTCCACCTTGTGCAGGG - Intronic
1104143631 12:126011251-126011273 CTGCATCCCTACTATGTGCAAGG - Intergenic
1104492670 12:129208502-129208524 TCAAATCCCCACTAAGTGCTAGG - Intronic
1104616635 12:130275835-130275857 TTTAATCCACACCATGAGCAAGG - Intergenic
1104640560 12:130464372-130464394 CTGAATACCTACTATGTGCCAGG + Intronic
1104640572 12:130464468-130464490 CTGAATACCTACTATGTGCCAGG + Intronic
1104640584 12:130464566-130464588 CTGAATACCTACTATGTGCTTGG + Intronic
1104764984 12:131324247-131324269 TTGACTCCCCACGACATGCAGGG - Intergenic
1104816390 12:131648396-131648418 TTGCACTTCCACTATGTGCAAGG + Intergenic
1104846679 12:131850542-131850564 TTGAGGGCCCACTCTGTGCAGGG - Intronic
1106397620 13:29396390-29396412 CTGAATGCCCACTATATGCCAGG - Intronic
1106424096 13:29609380-29609402 TTGAACCCTCGCTATGTGCCAGG - Intergenic
1106606379 13:31233071-31233093 CTGAATACCTACTATGTTCAAGG - Intronic
1106675021 13:31949280-31949302 TTGAATGCACACTGTGTGCCTGG - Intergenic
1106683621 13:32033662-32033684 TTGAATACCTACTATGTGCCAGG + Intronic
1106755562 13:32819930-32819952 TTACATCCCCACTATGTGCTTGG - Intergenic
1106764898 13:32903816-32903838 TTGGATCCACACTCTGTGCCAGG + Intergenic
1107047036 13:36004401-36004423 TTGAGCCCCCACTATGTGCCAGG - Intronic
1107540455 13:41384550-41384572 TTGAGTGCCTACTATGTGCCAGG + Intergenic
1107684412 13:42882210-42882232 TTGAATCACTACTATGTGCTAGG + Intergenic
1107966275 13:45601141-45601163 TTGATTCCCCACTCTGTCCTTGG + Intronic
1108042878 13:46355723-46355745 TTGAAGACCTACTATGTGCCAGG + Intronic
1108214036 13:48166348-48166370 TTGAACACCTACTATGTGCCAGG - Intergenic
1108401666 13:50051295-50051317 TTGAATATCTACTATGTGCCAGG + Intergenic
1108563714 13:51673104-51673126 TAGAATCCTTACTATGTTCAAGG - Intronic
1108564944 13:51687208-51687230 TTGAACACCTACTATGTGCCAGG + Intronic
1109051642 13:57490485-57490507 TTGAGTCTCTACTGTGTGCAAGG - Intergenic
1109231727 13:59765716-59765738 TTAAATACCTACTATGTGTAAGG + Intronic
1109325375 13:60861095-60861117 TTGAGCCCCAACTATGTGCTAGG - Intergenic
1110283191 13:73719403-73719425 TTGAATGCCCACAATGTCCTAGG - Intronic
1112097801 13:96153495-96153517 TTTCATCCCCGCTATGTGAAAGG + Intronic
1112133124 13:96545964-96545986 TTGAGTGCCCACTATGTGCCAGG - Intronic
1112186784 13:97135440-97135462 TTGAATGCTTACTATGTGCCAGG - Intergenic
1112286170 13:98106340-98106362 TTGAATGCTGACTATGTGCCAGG - Intergenic
1112585827 13:100717856-100717878 TTGAATGCCTACTATGTGCGGGG + Intergenic
1112615632 13:101002145-101002167 TTGACTCCCTACTATGTGCCAGG - Intergenic
1112644180 13:101310719-101310741 TTGAGGACCCACTATGTGCTAGG - Intronic
1113436376 13:110294864-110294886 TTGTACACCCACTATGTGCCAGG - Intronic
1113817632 13:113185317-113185339 TTGAATGCCTACTAGGTGCAAGG - Intronic
1114517663 14:23310168-23310190 TTGAAGCCACACTGTTTGCATGG + Exonic
1114534903 14:23416726-23416748 CTGAATGCCTACTATGTGCCAGG + Intronic
1114538512 14:23437998-23438020 TTGAGTGCCTACTATGTGCCAGG + Intergenic
1114786485 14:25605845-25605867 TTGACTGCCTACTATGTGCTGGG - Intergenic
1115376359 14:32681109-32681131 TTGAGGGCCTACTATGTGCATGG + Intronic
1115737640 14:36351824-36351846 TTTAGTGCCCACTATGTGCAGGG + Intergenic
1115795657 14:36932510-36932532 TTGAGTGCCTACTATGTGCTGGG + Intronic
1116426998 14:44803180-44803202 TTGAATGCTCACTGTGTGCGAGG - Intergenic
1116638693 14:47432945-47432967 TTGAATACCTACCATGTGCCAGG + Intronic
1116829931 14:49708660-49708682 TTGAGTGCCTACTATATGCAAGG - Intronic
1117284679 14:54275666-54275688 TTGAGTGCCTACTATGTGCTGGG + Intergenic
1117430873 14:55659395-55659417 TCAATTTCCCACTATGTGCATGG - Intronic
1117533435 14:56681147-56681169 TTGCATGCCTACTATGTGCCAGG - Intronic
1117980518 14:61338209-61338231 CTGAATCCCAAACATGTGCAGGG - Intronic
1118136786 14:63037384-63037406 TTGAGTACCTACTATGTGCTAGG - Intronic
1118334063 14:64836761-64836783 TTGAGTACCTACCATGTGCAAGG - Intronic
1118602097 14:67477991-67478013 TTGAATGCTTACTATGTGCTGGG - Intronic
1118661540 14:68019004-68019026 TTGAATGCTTACTATATGCAAGG - Intronic
1118919641 14:70138339-70138361 TTGAGTCCCTACTATGTGCCAGG - Intronic
1119045286 14:71313640-71313662 TTGAGTGCCTACTATGTGCCAGG + Intergenic
1119210318 14:72826639-72826661 ATGAACACCTACTATGTGCAAGG + Intronic
1119570665 14:75668445-75668467 CTGAGTCCCTACTATGTGCCAGG - Intronic
1119612852 14:76078488-76078510 TGGAACACCCACTATGTGAAAGG - Intronic
1119660241 14:76445998-76446020 TTGAGCCCTCACTATGTGCTTGG + Intronic
1119689538 14:76660626-76660648 TTGAATACCTACTATGTGCCGGG - Intergenic
1119847109 14:77838847-77838869 TTGAATGCCTACTATGTTCCAGG + Intronic
1119894810 14:78211091-78211113 TTGAATACTCACTATGTGCCAGG - Intergenic
1119926098 14:78495468-78495490 TTGAACACACACTATGTGCCAGG + Intronic
1119940672 14:78637764-78637786 TTGAATGCCTGCTATGTGCCAGG - Intronic
1119999538 14:79287036-79287058 TTGAAGCTCCTCTTTGTGCAAGG - Intronic
1120038795 14:79728932-79728954 TTGAACACCTACTATGTGCCAGG + Intronic
1120323949 14:83002065-83002087 TTGAGTCCCTACTATGTGCCTGG + Intergenic
1120522651 14:85542837-85542859 TTGAGTCCTCACTGTGTGCCAGG + Intronic
1120549966 14:85858428-85858450 TTGAATATCCATTATGTGCCAGG + Intergenic
1120885226 14:89446731-89446753 TTGAATGCCTACTATGTGCCAGG - Intronic
1120918124 14:89728094-89728116 TTGAATGCCTACTATGTGTCAGG - Intergenic
1120931503 14:89853381-89853403 TTGAGTACCTACTATGTGCCAGG + Intronic
1121202118 14:92126859-92126881 TTGAACAACCACTATGTGCAGGG + Intronic
1121827266 14:97020630-97020652 TTGAGCCCCCACCATGTGCCAGG - Intergenic
1122848842 14:104515778-104515800 CTGAATGCCCACTATGTGCCAGG + Intronic
1123999357 15:25741812-25741834 TTGAGTACCCACTATGTGTCAGG - Intronic
1124395003 15:29293598-29293620 TTGCATCCCCACTCTCTGCCTGG - Intronic
1124851645 15:33345244-33345266 TTGAGTAGCCACTATGTGCCAGG + Intronic
1125009116 15:34850989-34851011 TTGAATGCCAACTCTGTGCCAGG - Intergenic
1125069659 15:35537935-35537957 TTGAATGCCTACTATATGCCTGG - Intronic
1125100405 15:35905935-35905957 TTGAACACCCACTATATGCCAGG - Intergenic
1125260588 15:37820347-37820369 TTAAATACCTACTATGTGCCAGG + Intergenic
1125441761 15:39710870-39710892 TTGAATACCAACTATGAGCCAGG - Intronic
1125956792 15:43796018-43796040 TTGAGTACCCACAATGTGCTAGG - Intronic
1126229760 15:46311045-46311067 CTGAACACCCACTGTGTGCAAGG + Intergenic
1126852980 15:52809582-52809604 TTCACTGCCCACTATGTGCTGGG + Intergenic
1126858710 15:52863301-52863323 TTGAATGCCTACTATGTGCTAGG + Intergenic
1127051518 15:55088975-55088997 TTGAGTGCCTACTATGTGCTAGG - Intergenic
1127141692 15:55984454-55984476 CTGAATACCCACTCTGTGCCAGG - Intronic
1127630567 15:60823519-60823541 TTGAGTGCCCACTGTGTGCCAGG - Intronic
1127641828 15:60923387-60923409 TTGAGGGCCCACTATGTGCCAGG - Intronic
1127714240 15:61633086-61633108 TTGAATCCCTATTATGTTCTAGG - Intergenic
1127722561 15:61717235-61717257 TTGAGTCTCTACTATGTGCCAGG - Intergenic
1127738303 15:61869473-61869495 TTGAGTACATACTATGTGCAAGG - Intronic
1127755434 15:62087429-62087451 TTGAGCACCCACTATTTGCAAGG + Intergenic
1127761173 15:62140434-62140456 TTGAATACCTACTATGTACCAGG + Intergenic
1128176502 15:65561014-65561036 CTGAATACCTACAATGTGCAAGG - Intronic
1128206768 15:65859479-65859501 TTGAGTACCTACTATGTGCTGGG - Intronic
1128304764 15:66591068-66591090 TTGAATGCCTACTATGTGTTAGG - Intronic
1128321510 15:66698007-66698029 TTGAGTGCCCACTATGTGACAGG + Intergenic
1128595144 15:68938900-68938922 TTGAATGATCACTATGTGCCAGG - Intronic
1128643954 15:69361269-69361291 TTGACTGCCTACTATGTGCAAGG + Intronic
1128652649 15:69430376-69430398 TTGAGTACCTACTATGTGCCAGG + Intronic
1128972846 15:72123041-72123063 TTGAACCTCTACTATGTGCCAGG + Intronic
1129197867 15:73981866-73981888 ATGAATCCCCACCCTGTGGAGGG - Exonic
1129952364 15:79603188-79603210 TTGAAGACCTACTATGTGCCAGG + Intergenic
1130207623 15:81892194-81892216 TCCAATCCCCACTTTGTTCAAGG - Intergenic
1130346377 15:83049834-83049856 TTGAATGCCCATCATATGCATGG - Intronic
1130696298 15:86135042-86135064 CTGAATGCCTACTCTGTGCAAGG - Intergenic
1131737951 15:95354270-95354292 TTGATTACCTACTATGTGCTAGG - Intergenic
1131774291 15:95777183-95777205 TTGAAATCCTACTATGTGCCAGG + Intergenic
1132110298 15:99097762-99097784 TTGAGTCCCCTCTGTGTGCCTGG - Intergenic
1132232707 15:100196032-100196054 TTGAACACCTACTATGTGCAGGG - Intronic
1132668427 16:1092247-1092269 TTGAGTGCCGACTGTGTGCAGGG - Intronic
1133087382 16:3375549-3375571 GTGAAGCCCCACTGTGTGCTTGG + Intronic
1133169382 16:3971771-3971793 TAACATCCCCATTATGTGCAGGG + Intronic
1133521242 16:6559756-6559778 TTGAACACCTACTATGTGCCAGG + Intronic
1133602303 16:7351365-7351387 ATTAATCACCACTACGTGCAAGG + Intronic
1133837871 16:9382510-9382532 TTGAATACCTACTAAGTGCCAGG - Intergenic
1133842547 16:9423104-9423126 TTGAGTGCCTACTATGTGCTAGG - Intergenic
1134017370 16:10898559-10898581 TTGAGTCCCCACTGTGTGCCAGG + Intronic
1134041983 16:11076061-11076083 TAGAATCCCCACCAGCTGCAGGG - Intronic
1134051337 16:11139879-11139901 TTGAATGCCAACTATGTGCTAGG + Intronic
1134174197 16:11992717-11992739 TTGAGTGCCCACTGTGTGCGAGG - Intronic
1134316312 16:13122118-13122140 TTGAGCCCCTACTATGGGCAAGG - Intronic
1134616166 16:15652520-15652542 TTGAATACCTACTAAGTGCTGGG - Intronic
1134760810 16:16713307-16713329 TTGAGACCCCACTGTGGGCAAGG + Intergenic
1134838480 16:17382095-17382117 TTGGACACCCACTATGTGCTGGG + Intronic
1134985248 16:18645866-18645888 TTGAGACCCCACTGTGGGCAAGG - Intergenic
1135042683 16:19130054-19130076 TTGAATGCTAACTATGTGCCAGG + Intronic
1135075814 16:19392742-19392764 TTGAATACCTACTATGTGCCAGG + Intergenic
1135341639 16:21653436-21653458 CTGAATCACCACTAAGTGCTGGG - Intronic
1135390231 16:22086695-22086717 TTGAATGCTTACTATGTGCTTGG - Intronic
1135543220 16:23348354-23348376 TTGAATGCCTACTATATGCCAGG - Intronic
1135656249 16:24252930-24252952 TCGAGTGCCTACTATGTGCAAGG - Intergenic
1136023031 16:27452001-27452023 TTGAGTGCCTACTATGTGCCAGG - Exonic
1136048154 16:27631756-27631778 TTGAGTACCCACTATGTGCCAGG + Intronic
1136230222 16:28881312-28881334 TTGAATTCCTACTGTGTGCCAGG - Intronic
1136427855 16:30181178-30181200 TTGAGTGCCTACTATGTGCTGGG - Intergenic
1136459228 16:30399340-30399362 TTGAATGCCTACTGTGTGCTAGG - Exonic
1136640056 16:31556774-31556796 GTGAATCCCTAGTATGTGAAAGG + Intergenic
1136664707 16:31799760-31799782 GTGAATCCCTAGTATGTGAAAGG - Intergenic
1137234351 16:46601902-46601924 TTGAGTACCTACTATGTGCAGGG - Intronic
1137251056 16:46741225-46741247 TTGAGCACCCACTATGTGCTGGG - Intronic
1137368383 16:47881154-47881176 TTGAATACCCATTATGTGTGAGG - Intergenic
1137577973 16:49616141-49616163 TTGAATACCTACTGTGTGCCAGG - Intronic
1137627759 16:49920381-49920403 TTGAACACCTACTATGTGCTGGG + Intergenic
1137769541 16:51004847-51004869 TTGAGTTCCTACTATGTGCCAGG - Intergenic
1138646298 16:58427706-58427728 TTCAATGCCTACTATGTGCCAGG - Intergenic
1138867424 16:60839842-60839864 TTGAATACCTACTATGTGCTAGG + Intergenic
1139527631 16:67526596-67526618 TTGAACTCCCACTATGAGCCAGG + Intronic
1139616097 16:68093627-68093649 TTGAGTACCTATTATGTGCAAGG + Intronic
1139999039 16:71008426-71008448 TTGAGTACCCACCATGTGCCAGG - Intronic
1140058647 16:71547946-71547968 TTGAGTGCCTACTATGTGCCAGG - Intronic
1140144448 16:72292408-72292430 TTGAATTCCTACTATGTGCAAGG - Intergenic
1140212165 16:72978863-72978885 TTGAGTGCCTACTATGTGCCAGG + Intronic
1140239131 16:73185236-73185258 TTGAACACCTACTATGTGCCGGG + Intergenic
1140275594 16:73505944-73505966 TTGAGTTCCTACTGTGTGCAAGG + Intergenic
1140571007 16:76106176-76106198 TTGAATGCCTGCTATGTGCCAGG + Intergenic
1140800099 16:78479222-78479244 TTGAATACCTACTATGTGTCTGG + Intronic
1140987735 16:80174863-80174885 TTGATTGCCTACTATGTGCTAGG + Intergenic
1141191726 16:81829938-81829960 TGGCATCCCCACTAGGTGCCAGG + Intronic
1141597036 16:85103750-85103772 CTGAATACCCACTAGGTGCCAGG + Intronic
1141731050 16:85823203-85823225 TTGAGTACCTACCATGTGCAAGG + Intergenic
1141836155 16:86540975-86540997 TTGAATCCCTCCTTTGGGCATGG - Intronic
1143013221 17:3877683-3877705 TTGATTGCCTACTATGTGCCAGG + Intronic
1143777745 17:9210358-9210380 CTGAATGCCAACTGTGTGCATGG - Intronic
1144455842 17:15417743-15417765 TTGAATGCTCACTATCTGCCAGG - Intergenic
1144776929 17:17789519-17789541 TTGTGCCCCCACTATGTTCATGG + Intronic
1145248145 17:21283406-21283428 GTGGCTCCCCACTCTGTGCATGG + Intergenic
1145250150 17:21293063-21293085 GTGAATACCTACTATGTGCTGGG - Intronic
1146205463 17:30901385-30901407 TTGAATGCCTACTTTGGGCAAGG - Intronic
1146455185 17:33004247-33004269 CTGAAGCCCCACTCTGTGCCAGG - Intergenic
1146473509 17:33143408-33143430 TTGAACACCTACTATGTGCCAGG + Intronic
1146712275 17:35052691-35052713 TTGAATGCCCACTATGTGCAGGG + Intronic
1146852107 17:36231162-36231184 TTGAGCCCCCACTATGTGCCAGG + Intronic
1146868016 17:36355032-36355054 TTGAGCCCCCACTATGTGCCAGG + Intronic
1147070891 17:37955650-37955672 TTGAGCCCCCACTATGTGCCAGG + Intergenic
1147082417 17:38035176-38035198 TTGAGCCCCCACTATGTGCCAGG + Intronic
1147098361 17:38159143-38159165 TTGAGCCCCCACTATGTGCCAGG + Intergenic
1147166747 17:38597478-38597500 TTGAATGTCTACTATGTGCCAGG + Intronic
1147488170 17:40838906-40838928 TTGAATGCCCAGTGTGTGCCAGG + Intergenic
1148187326 17:45654159-45654181 TTGAATGCCCACTGTGTGCAAGG + Intergenic
1148735907 17:49864763-49864785 TTGATTCAGCACTATGTGCTGGG + Intergenic
1149003604 17:51781795-51781817 TTGAATTCTTACTATGTGCTAGG + Intronic
1149394508 17:56225580-56225602 TTGAGTGCCTACTATGTGCAAGG - Intronic
1149403548 17:56323764-56323786 TTGAATGCCTTCTATGTGCCAGG + Intronic
1149434051 17:56618446-56618468 TTGAATCCCTACTATGTGCCAGG + Intergenic
1149529848 17:57386485-57386507 TTGAATGCCTACCATGTGCTAGG + Intronic
1149605204 17:57919622-57919644 TTGAAAACTTACTATGTGCATGG - Intronic
1150079898 17:62228156-62228178 TTGAGCCCCCACTATGTGCCAGG + Intergenic
1150240305 17:63626229-63626251 TTGAATGCCTCCTATGTGCCAGG + Intronic
1150244694 17:63665541-63665563 TTGAATTCCCACTATGTGTAAGG + Intronic
1150940559 17:69688674-69688696 TTTAATACCAACTATCTGCATGG - Intergenic
1150971600 17:70034627-70034649 TTGAGTGTCTACTATGTGCAAGG + Intergenic
1151392052 17:73793969-73793991 TTTCAGCCCAACTATGTGCAAGG - Intergenic
1151616953 17:75219590-75219612 TTGAGTCCCTACTATTTGCAAGG + Intronic
1152107375 17:78338609-78338631 TTGAGCCCCCACTATGTGTCAGG + Intergenic
1153225244 18:2894900-2894922 TTGAGTGCCTACGATGTGCAAGG + Intronic
1153256131 18:3173316-3173338 TTGAATACCCACTCTGTGGCAGG + Intronic
1153427272 18:4979455-4979477 CTGAATGCCCACTATATGCCAGG - Intergenic
1155236426 18:23824109-23824131 TTGAATACTTACTATATGCAAGG + Intronic
1155539547 18:26854041-26854063 TTGAATACATACTATGTGCCAGG + Exonic
1155991595 18:32284583-32284605 ATGAGTCCCCACTGTGTGCCAGG + Intronic
1156650925 18:39226729-39226751 TCAAATGCCAACTATGTGCATGG + Intergenic
1156869083 18:41923797-41923819 TTGAGTACCTACTATGTGCTAGG - Intergenic
1157277268 18:46320306-46320328 TTGAGTCCCTACTGTGTGCCAGG + Intergenic
1157399508 18:47375725-47375747 TCGATTGCCTACTATGTGCATGG + Intergenic
1157440787 18:47710097-47710119 TTGAATCTCTACTATGTGCCAGG + Intergenic
1157539680 18:48491540-48491562 TTTAGTACCCACTATGTGCTAGG + Intergenic
1157690063 18:49674345-49674367 TTGAATACCCGCTATTTGCAGGG + Intergenic
1157959923 18:52141905-52141927 TTGAATCCCTACTGTGTGCCAGG - Intergenic
1157982445 18:52396943-52396965 TTGAGTACCCACTATATGCTTGG - Intronic
1158658315 18:59360590-59360612 TGGAATCTTCACTCTGTGCAAGG - Intergenic
1158675609 18:59515331-59515353 TTAAATGCCTACTATGTGCCAGG + Intronic
1158826679 18:61228357-61228379 TTGAACACCTACTATGTGCCAGG + Intergenic
1158835763 18:61330360-61330382 TTGAGTACCCACTAAATGCAAGG - Intergenic
1158847921 18:61464016-61464038 TTGAATCCCTAATATCTGCCGGG - Intronic
1159571543 18:70119860-70119882 TTGAGAGCTCACTATGTGCAAGG + Intronic
1160255803 18:77247833-77247855 TTGAGTGCCTACTATGTGCCAGG - Intergenic
1160587816 18:79922458-79922480 TTGAATCCCCAGAATGTCCTAGG - Intronic
1161248418 19:3267786-3267808 CTGAAACCCCTCTCTGTGCAGGG + Intronic
1161414573 19:4138593-4138615 TTGAAACCCTACTAAGTGCCAGG + Intergenic
1161609463 19:5233302-5233324 TTGAACACCTACTATGTGCCAGG + Intronic
1161859355 19:6786184-6786206 TTGATTCCGTACTATGTGCCAGG - Intronic
1162996415 19:14338726-14338748 TTGAGTGCCTACTATGTGCCAGG - Intergenic
1163534042 19:17866811-17866833 TTGAGTCCCTACTTTGTGCAGGG + Intergenic
1164136953 19:22424933-22424955 TTGAATGCACTCTATGTGCAAGG + Intronic
1164155394 19:22593311-22593333 TTGAGTACCTACTATGTGCAAGG + Intergenic
1164171832 19:22731988-22732010 CTCAATCCCCTCTATGGGCAAGG - Intergenic
1164455955 19:28406941-28406963 TTGACTCCCCAGTATTTGCAGGG - Intergenic
1164490305 19:28705514-28705536 TTGAGTACCTACTATGTGCAGGG - Intergenic
1165221481 19:34320274-34320296 GTGAATGCCCACTTTGTGCCAGG + Intronic
1165747818 19:38240758-38240780 TGGAACCCTCACTATGAGCAAGG + Intergenic
1165908295 19:39207260-39207282 TTGAGTCCTTACTATGTGCCAGG - Intergenic
1166015417 19:39975919-39975941 TTGAACACCCACTATGTGCCAGG + Intronic
1166988583 19:46677350-46677372 TTGAGTGCCCACGATGTGCCAGG - Intronic
1167092526 19:47354398-47354420 TTGAGTCCCTGCTATGTGCCAGG - Intronic
1167419184 19:49393278-49393300 TTGAGTCCCCACCACGTGCCAGG + Intronic
1167551545 19:50164319-50164341 TTGAACACCTACTATGTGCCAGG + Intergenic
1167649565 19:50721939-50721961 TTGAACACCTACTATGTGCTAGG + Intergenic
1167701215 19:51047261-51047283 TTGAGTTCTCACTCTGTGCAAGG + Intergenic
925005098 2:436972-436994 TAGAGTTCCCACTGTGTGCATGG + Intergenic
925005101 2:436996-437018 TAGAGTTCCCACTGTGTGCATGG + Intergenic
925005130 2:437299-437321 ATGAGCTCCCACTATGTGCATGG + Intergenic
925005136 2:437348-437370 TAGAGTTCCCACTGTGTGCATGG + Intergenic
925115260 2:1373253-1373275 ATGAATACCTACTTTGTGCAGGG + Intergenic
925505602 2:4559788-4559810 TTTAATGCCTACTATGTGCCAGG + Intergenic
925753986 2:7116346-7116368 TTGAACACCTACTATGTGCAGGG + Intergenic
926273747 2:11387868-11387890 TTTACTCCCCACTGTGTGCCAGG - Intergenic
926356492 2:12045494-12045516 TTGAGTACCCAGTATGTGCCAGG + Intergenic
926382151 2:12301557-12301579 TTGGATCCCTACTATGTGCTAGG + Intergenic
926567061 2:14487795-14487817 TTGAATCACCAATTTGTGCTTGG - Intergenic
926682056 2:15671638-15671660 ATGAAGCCCTACTATGTGCTAGG - Intergenic
926857692 2:17274686-17274708 TTGAATGCCAACTATGTGCCAGG + Intergenic
927187661 2:20493423-20493445 TTGAATCCCTACTATGTGCCAGG + Intergenic
927260379 2:21082279-21082301 TTAAATACCAACTATGTGCTAGG + Intergenic
928151636 2:28835571-28835593 TTGACTACCCACTATGTGCCAGG - Intronic
928200598 2:29245507-29245529 TGGAGCCCCTACTATGTGCAGGG - Intronic
928200621 2:29245637-29245659 TGGAGCCCCTACTATGTGCAGGG - Intronic
928200651 2:29245799-29245821 TAGAGCCCCTACTATGTGCAGGG - Intronic
928200662 2:29245865-29245887 ATGAAGCCCTACTGTGTGCAGGG - Intronic
928233990 2:29524202-29524224 TAGAACCCCTACTATGTGCTAGG + Intronic
928377942 2:30791363-30791385 TTGAATACCTACTATGTGCCAGG - Intronic
928647823 2:33373753-33373775 TTGAATGCCTACTATGTACTAGG + Intronic
928945693 2:36770160-36770182 TGGAATGCCCACTATGTGTCAGG + Intronic
929417692 2:41760627-41760649 TTGAATGCCCATTATGTGCATGG - Intergenic
929448820 2:42022789-42022811 TTGAGCCCCCACTATGTGCCAGG + Intergenic
929569117 2:43008947-43008969 TTGAGTGCCTACTATGTGCTAGG + Intergenic
929920856 2:46170541-46170563 TTGAATACCTACTATGTGCCAGG - Intronic
930197357 2:48522830-48522852 TTCAATCCCTACTCTGTGCATGG - Intergenic
931165433 2:59742077-59742099 CTGAGTTCCTACTATGTGCATGG + Intergenic
931256647 2:60580018-60580040 TTGAATGCCTACTATGGGCAAGG + Intergenic
931994677 2:67828626-67828648 TTGAGTCCTCACTGTGTGCTAGG + Intergenic
932071648 2:68626527-68626549 TTGATTACCCTCTATGTGCCAGG - Intronic
932119547 2:69085598-69085620 TTTAATGCCTACTATGTGCCAGG + Intronic
932193878 2:69765957-69765979 TTGCAGGCCCGCTATGTGCAAGG + Intronic
932205049 2:69872937-69872959 TTGTGTCCCCACCATGTGCTTGG + Intronic
932239838 2:70147929-70147951 TTGCATGCCTACTATGTGCCAGG - Intergenic
932633364 2:73366341-73366363 TTGAAGGCCCACTCTGAGCAGGG - Intergenic
932733869 2:74240497-74240519 CTGAATCCCTATTATATGCAAGG - Intronic
932790564 2:74651060-74651082 TTGAATGCCTACTATGTTCTAGG - Intergenic
932929595 2:76018334-76018356 TTCAATCCCTACAATGTGCCAGG - Intergenic
933307134 2:80615394-80615416 TTGCATCCCTACTATGTAAAAGG + Intronic
933668941 2:84988343-84988365 TTGAATACTTACTATGTGCCAGG + Intronic
933940268 2:87239416-87239438 CTGAATGCCCACTCTGTGCAGGG + Intergenic
934481460 2:94650019-94650041 TAGAATACCCACAGTGTGCAAGG - Intergenic
934743532 2:96743155-96743177 TAGAACCCCTACTATGTGCTGGG - Intergenic
935554092 2:104488288-104488310 TTGAGTGCCTACTATGTGCCAGG - Intergenic
936352870 2:111726360-111726382 CTGAATGCCCACTCTGTGCAGGG - Intergenic
937644936 2:124255859-124255881 TTGAGTACCTACTATGTGCCTGG - Intronic
937833516 2:126448098-126448120 TTGAATGCCTACTATATGAAAGG - Intergenic
938098515 2:128479342-128479364 TTGAACCCCTACTGTGTGCCGGG - Intergenic
938983318 2:136547549-136547571 TTGAATAACTACTATGTGCCTGG + Intergenic
939007753 2:136809000-136809022 TTGAATACCTTCTATGTGCTGGG + Intronic
939073823 2:137576405-137576427 TCTAATTCCCACTATGTGAAGGG - Intronic
939165370 2:138635963-138635985 TTGAGTGCCTACTATGTGAAAGG - Intergenic
940133503 2:150410424-150410446 TTGAATACCAACTATGTTCCAGG - Intergenic
940135134 2:150426893-150426915 CTGACTCCCCACTGTGTGCCAGG - Intergenic
940261840 2:151789035-151789057 TTGAGTCACAACTATGTGCTTGG + Intronic
940282911 2:152005935-152005957 TTGAATGCTGACTATGTGCCAGG - Intronic
940522230 2:154765503-154765525 CTGAGTGCCAACTATGTGCAAGG - Intronic
940633999 2:156275162-156275184 TTGAACACCTACTATGTGCCAGG + Intergenic
940682944 2:156808760-156808782 TTGAATACCCACCATGTGCCAGG + Intergenic
940739331 2:157489262-157489284 TTGAATGCCTACTATGTGCTGGG + Intergenic
940749059 2:157603357-157603379 CTGACTGCCCACTATGTGCATGG + Intronic
940772481 2:157854128-157854150 TTGAATACTAACTATGTGCTAGG - Intronic
940984368 2:160037991-160038013 TTGAACACCTACTATGTGCCAGG - Intronic
941323579 2:164085392-164085414 TGGAATGCCTACTACGTGCAGGG + Intergenic
941543830 2:166820425-166820447 CTGAATGCCCACAATGGGCAAGG + Intergenic
941782374 2:169459120-169459142 TTGAACACCCACTATGTGATAGG + Intergenic
942116252 2:172732013-172732035 TTGAACACTCACTATGTGCTTGG + Intergenic
942255298 2:174091083-174091105 TTGAGCACCCACTATGTGCCAGG - Intronic
942347776 2:175020934-175020956 TTGAGTGTCCACTATGTGCCTGG + Intergenic
942439905 2:176021915-176021937 TTGAATACCTACTATGTGTCAGG - Intergenic
942654398 2:178199696-178199718 CTGAATGTCCACTATGTACAAGG - Intronic
943638150 2:190328517-190328539 TTGAATCAACACTCTGAGCATGG - Intronic
943664490 2:190594536-190594558 TTGAATACCTACCATGTGCAAGG - Intergenic
943824724 2:192374852-192374874 CTGAATTCCTACTATGTACAAGG + Intergenic
944298620 2:198096058-198096080 TTGGATGCCTACTATGTGCAAGG + Intronic
944365395 2:198913246-198913268 TTGAAGCCCTACTATGTACTAGG + Intergenic
944367615 2:198942625-198942647 TTGAATGCCTACTATGTGAGGGG + Intergenic
944668510 2:201976137-201976159 TTGAAGACCTACTATGTGCTAGG + Intergenic
944998312 2:205319696-205319718 TTGAATGTACACTATGAGCAAGG - Intronic
945093565 2:206198543-206198565 TTGAATGTCCACTCTGTGCAAGG - Intronic
945845811 2:214943395-214943417 TTGGACCCCCACAAAGTGCAGGG + Intronic
945854705 2:215055155-215055177 TTGAATACCCAGTATGTGCCAGG + Intronic
946446807 2:219747047-219747069 TTGAGTGCCCACAATGTGCCTGG + Intergenic
946581622 2:221134201-221134223 TTGAATTCCTTCTATGTGCCAGG - Intergenic
946984303 2:225254969-225254991 CTGAATATCTACTATGTGCAGGG - Intergenic
946993659 2:225365346-225365368 TGGAATTCCTACTATGTGCTAGG + Intergenic
947037111 2:225872109-225872131 ATGAATCCCCACAATGTGAAAGG + Intergenic
947100859 2:226619906-226619928 TTGAACTCCTACTATGTGCCAGG - Intergenic
947994142 2:234512740-234512762 TTGAACCCCCACTTTGTTCTTGG + Intergenic
1168755462 20:313968-313990 TTGAATCCTTACTATGTCCCAGG + Intergenic
1168934582 20:1652893-1652915 TTGGATACCTACTATGTGCCAGG - Intronic
1168989522 20:2082340-2082362 TTGAGTGCCTACAATGTGCAAGG + Intergenic
1169778195 20:9279237-9279259 TTGAATGCTTCCTATGTGCAAGG + Intronic
1169950522 20:11038375-11038397 TTGAGCACCTACTATGTGCAAGG - Intergenic
1170095512 20:12641818-12641840 TTGAGTTCCCACTGTGTACATGG + Intergenic
1170261779 20:14416694-14416716 TTGAGTACCCACTATGTGCCAGG + Intronic
1170746267 20:19101678-19101700 TTGACTTCCTACTGTGTGCAAGG - Intergenic
1170901300 20:20465927-20465949 TTGAAACTCCAGTATCTGCAAGG + Intronic
1171331274 20:24340694-24340716 TTGAGTCCCCACCATATGCCAGG - Intergenic
1171966858 20:31537001-31537023 TTGATTGCCTACTACGTGCAAGG - Intronic
1172038548 20:32027862-32027884 TTGAACACCTACTATGTGCCAGG - Intronic
1172042654 20:32056882-32056904 TTGAGGCCCTACTATGTGCCAGG - Intronic
1172102169 20:32491544-32491566 ATGCATCCCTACTGTGTGCAGGG - Intronic
1172155461 20:32820623-32820645 TTGAATGCCCACTAGGTGTTGGG + Intronic
1172164517 20:32890892-32890914 TTAACTGCCCACTATGTGCCAGG - Intronic
1172750887 20:37250349-37250371 TAGAATACCCACTCTGTGCCAGG - Intergenic
1172784139 20:37455074-37455096 TTGAATCACTGCCATGTGCAAGG - Intergenic
1172803190 20:37592572-37592594 CTGAATGCTCACTATGTGCCAGG - Intergenic
1172817107 20:37696120-37696142 TTGAACACCTACTGTGTGCAAGG + Intronic
1172852413 20:37976236-37976258 TTGAATGCCTAGTATGTGCCAGG - Intergenic
1172899637 20:38325080-38325102 TTGAATGCCCACCATGTGCCTGG + Intronic
1172963622 20:38817041-38817063 TTGAATACCTACCATGTGCTGGG + Intronic
1173006312 20:39142305-39142327 TTGAATGCCTACTAAGTGCTGGG - Intergenic
1173036920 20:39420736-39420758 TTGAGCCCCAACTATGTGCCAGG - Intergenic
1173037229 20:39424027-39424049 TTGAACCCTTACTATGTGCCTGG - Intergenic
1173414529 20:42844109-42844131 TTGAATGCCAACTATGTGCCAGG + Intronic
1173518644 20:43682905-43682927 GTGAAGACCCACTGTGTGCAAGG - Intronic
1173559324 20:43991514-43991536 TTGAGGGCCTACTATGTGCAAGG + Intronic
1173595011 20:44253275-44253297 TTGAGTGCCTACTATGTGCCAGG - Intronic
1173843411 20:46173761-46173783 TTGAACACCTACTATGTGCCAGG + Exonic
1173866502 20:46315920-46315942 TTGAGTACCTACTATGTGCCAGG - Intergenic
1173909477 20:46654053-46654075 TTACATTCCCACGATGTGCAAGG + Intronic
1174205428 20:48834861-48834883 TTGAGTGCTCACTCTGTGCAAGG + Intergenic
1174505015 20:51011762-51011784 CTGAATACCTACTATGTGCCAGG - Intronic
1174693305 20:52531403-52531425 TTGAAGACCTACTATGTGCCAGG + Intergenic
1174923315 20:54728613-54728635 TTGAGCACCTACTATGTGCAAGG - Intergenic
1175028315 20:55927021-55927043 TAGAGAACCCACTATGTGCAAGG + Intergenic
1175310979 20:58011426-58011448 TTGAGTCCCTACTGTGTGCCAGG + Intergenic
1175389181 20:58615618-58615640 TGGGATCCCCACTGTCTGCAGGG + Intergenic
1175477887 20:59289664-59289686 TTGAGTCTCCACTATGTGCCAGG - Intergenic
1176894887 21:14365520-14365542 TTGAAAGCCCACAATGTGCCAGG + Intergenic
1176991401 21:15501557-15501579 TTGAGTACCTACTATGTGCCTGG + Intergenic
1177186165 21:17799802-17799824 TTGAGTACCCACTATGTGCCCGG - Intronic
1178010231 21:28276475-28276497 TTGAATACCCTCTATATGCCAGG + Intergenic
1178607707 21:34054109-34054131 TTGAATGCCAACTATGTGCCAGG - Intergenic
1178958704 21:37044831-37044853 TTGAATACCTACTATGTGCCAGG + Intergenic
1179078946 21:38152230-38152252 TAGAATTCCCGCTATGTGCCAGG + Intronic
1179665529 21:42909508-42909530 TGGAATATCTACTATGTGCAAGG + Intronic
1179707398 21:43189831-43189853 TTGAGTCCCTGCTATGTGCTAGG + Intergenic
1181365249 22:22371516-22371538 CTGAATACCTACTATGTGCCAGG + Intergenic
1181772897 22:25139556-25139578 TTGCATGCCTACTATGTGCTGGG + Intronic
1181882986 22:25996246-25996268 TTGAGCCCCTACTATGTGCAAGG - Intronic
1181918803 22:26302963-26302985 TTGAGTGCCCACTCTGTGCCAGG + Intronic
1181997872 22:26897419-26897441 TTGAGCACCTACTATGTGCAAGG + Intergenic
1182067293 22:27439558-27439580 TTGAGTGCCTACTGTGTGCAAGG - Intergenic
1182167192 22:28188011-28188033 TTGAGTGCCTACTATGTGCTAGG + Intronic
1182576693 22:31277639-31277661 TTGAATGCCTACTGTGTGCTAGG + Intronic
1182730162 22:32482771-32482793 TTGAATACCTGCTATGTGCTAGG + Intronic
1182770567 22:32793074-32793096 TTGAATACCTACTATGTACAAGG - Intronic
1182790363 22:32947380-32947402 TTGAATACCTACTGTGTGCCAGG - Intronic
1182799713 22:33021907-33021929 TTGAACCTCTACTATGTGCTAGG - Intronic
1182991855 22:34775900-34775922 TTGCATATTCACTATGTGCAGGG - Intergenic
1183134448 22:35872978-35873000 TTGAATGCCGACTATTTGCCAGG - Intronic
1183367370 22:37414107-37414129 TTGAACCTCTACTATGTGCCAGG + Intronic
1183480195 22:38059648-38059670 TTGCATGTCCACTATGTGCCAGG - Intronic
1183555523 22:38523618-38523640 TTGAACACCCACTGTGTGCCTGG - Intronic
1183608340 22:38880234-38880256 TTGGATACCTACTGTGTGCAGGG - Intergenic
1183682126 22:39338084-39338106 TTGAACACCCACTATGTTCCAGG - Intergenic
1183973941 22:41499210-41499232 TTGAATCTCCAGTATGTGCCAGG + Intronic
1184135817 22:42549279-42549301 TTGAGGCCCTACTGTGTGCAAGG + Intergenic
1184185284 22:42860695-42860717 TTGAATGCATACTATGTGCCAGG - Intronic
1184272102 22:43390347-43390369 TTGAACACCTACTATGTGCCGGG - Intergenic
1184359808 22:44008443-44008465 CTGGATGCCTACTATGTGCAAGG + Intronic
1184493587 22:44824537-44824559 TTGAAGCCCTACTATGTGCCGGG - Intronic
1184627288 22:45745718-45745740 CTGAATGCCTACTATGTGCCAGG - Intronic
1184940854 22:47763849-47763871 TTGAATACTCACTTTGTGCTGGG - Intergenic
1184984639 22:48121351-48121373 TTGAATGCCTACTATGTGTCAGG - Intergenic
1185408367 22:50670569-50670591 TTGAATACACAGTATTTGCAGGG - Intergenic
949401663 3:3671085-3671107 TTGAGTCCCCACGAAGTGCTCGG - Intergenic
949482858 3:4510583-4510605 CTGAATACCTACTATGTGCTAGG + Intronic
949590566 3:5490173-5490195 TAGAACCCTCACTATGTGCCTGG + Intergenic
949862510 3:8519048-8519070 TTGAGGAGCCACTATGTGCAAGG + Intronic
949982316 3:9509456-9509478 CTGCATGCCCACTATGTGCCAGG + Intronic
950198159 3:11024003-11024025 TTGAATACCTACTATGTGCCTGG + Intronic
950233950 3:11302069-11302091 TTGAATACCCTCAGTGTGCAAGG + Intronic
950272844 3:11632859-11632881 TTTAATACCCATTATGTGCCAGG - Intronic
950539473 3:13601641-13601663 TTGAACACCCACCATGTGCCAGG + Intronic
950711408 3:14815527-14815549 TTGAGTACCAACTATGTGCCAGG - Intergenic
950862933 3:16166278-16166300 TTGAATTTCTACTATGTGCCAGG - Intergenic
951038630 3:17963357-17963379 CTGAATACCTACTATGTGCTAGG - Intronic
951355291 3:21659736-21659758 TTGAATACCTACTATGTGTTAGG - Intronic
951469240 3:23037660-23037682 TTGAACTCCCACTATGTACCAGG + Intergenic
951605398 3:24428237-24428259 TTGAGTACCTACTATGTGCCTGG + Intronic
951693673 3:25423568-25423590 TTGAATACCTACCATGTGCCAGG - Intronic
951882091 3:27489388-27489410 TTTGATGCCCACTATGTGCCAGG - Intergenic
952143291 3:30503061-30503083 TTGAGTTCCTACTATGTGCCAGG - Intergenic
952193906 3:31052516-31052538 TTGAGTGCCCACAATGTGCCAGG - Intergenic
952207063 3:31190838-31190860 TTGAATACCTACTATGTTCTAGG - Intergenic
952293858 3:32043685-32043707 TTGAGTTCCTACTATGTGTAGGG - Intronic
952300299 3:32098886-32098908 TTGAGTGCCCACTCTGTGCTAGG + Intergenic
952354670 3:32572937-32572959 ATGAATGCCTACTATGTGCCAGG + Intergenic
952539791 3:34355933-34355955 TAGAATACCCACTATGTGCCAGG - Intergenic
952602572 3:35102909-35102931 TTGAAACTTCACTGTGTGCATGG - Intergenic
953131443 3:40143169-40143191 TTGAGGGCCCACTATGTGCCAGG - Intronic
953134593 3:40171765-40171787 TTGAGCTTCCACTATGTGCAAGG + Intronic
953274992 3:41486249-41486271 TTGAATACCTACTATGAGCCAGG - Intronic
954959480 3:54551330-54551352 CTGAATGCCCACTGTGTGCCAGG - Intronic
955065260 3:55528474-55528496 CTGAATACCTACTATGTGCTGGG + Intronic
955152669 3:56383535-56383557 TTGAGTATCCACTATGTGCCAGG - Intronic
955188319 3:56736191-56736213 TTGAGTACCCAGTATGTGCCAGG + Intronic
955369296 3:58337380-58337402 TTAAATGCCTACTATGTGCCAGG + Intronic
955826543 3:62953147-62953169 TTAAATACCCACAAAGTGCAGGG - Intergenic
956046735 3:65203633-65203655 TTGAACTCCCACTATGTACTAGG + Intergenic
956090649 3:65663047-65663069 TTGAATTCCCAGTATGTGCTAGG - Intronic
956230662 3:67012440-67012462 TTGAGTGCCTACTATGTGCTAGG - Intergenic
956320883 3:67995099-67995121 TTGAATGCTTACTATGTGCTTGG - Intergenic
956565115 3:70627488-70627510 TTGAAGTCCTACTGTGTGCAAGG - Intergenic
956582325 3:70828054-70828076 TTGAACACCTACTATGTGCATGG - Intergenic
956697490 3:71930941-71930963 TTGAGTGCCTACAATGTGCATGG - Intergenic
957246407 3:77722092-77722114 TTGAATGCCTACTATGTGCTGGG - Intergenic
959159531 3:102706606-102706628 CTGAGTCCCCACTATGTTCCAGG + Intergenic
959297867 3:104560288-104560310 TTGAGTGCCTACTATGTGCCAGG + Intergenic
959348294 3:105227642-105227664 TTGAGCACCTACTATGTGCAAGG - Intergenic
959397426 3:105858340-105858362 TTGAATACCTGCTATGTGCAAGG + Intronic
959510854 3:107210076-107210098 TTGTGTCCCCACTGTATGCAGGG - Intergenic
959555371 3:107711354-107711376 TTTAATACCTACTATGTGCCAGG - Intronic
959610115 3:108284492-108284514 TTGAATGTCTACTATGTGCTAGG + Intergenic
959678636 3:109066637-109066659 TGGAATGACCACTATGTGCAAGG - Intronic
959834652 3:110904446-110904468 TTGAATGTCCACTATATGCATGG + Intergenic
959995829 3:112679366-112679388 TTGTATCCCCACAAGGTGGAAGG + Intergenic
960203189 3:114862924-114862946 TTGAATACATACTATGTGCCAGG + Intronic
960612696 3:119569554-119569576 TTGAGTGCCTACTATGTGCCTGG + Intergenic
960639632 3:119813257-119813279 CTGAATGCCCACTCTGTGCTGGG - Intronic
960827079 3:121799555-121799577 TTGAATTCCTACTGTGTGCAAGG + Intronic
960854080 3:122085433-122085455 TCGAATACCCACTGTGTGCCAGG + Intronic
960854261 3:122086643-122086665 TCGAATACCCACTGTGTGCCAGG - Intronic
960888630 3:122421970-122421992 TTGAATGTCTACTATGTGCAAGG + Exonic
960906555 3:122607509-122607531 TTGAGTCCTTATTATGTGCAAGG - Intronic
960951705 3:123003109-123003131 TTGAATGTCCAGTAAGTGCACGG + Intronic
961108013 3:124258656-124258678 TTGAACACCTACTATGTGCCAGG + Intronic
961528721 3:127526421-127526443 TTGAACACCTACTATGTGCCAGG + Intergenic
962284746 3:134076359-134076381 GAGAATCCCCACCATCTGCATGG - Intronic
962379547 3:134886672-134886694 TTGAGTACTCACTATGTGCTGGG + Intronic
962456497 3:135570005-135570027 TTTAATACCTACTATATGCAAGG + Intergenic
962585350 3:136837482-136837504 TTGAATTTCCACCATTTGCAAGG + Intronic
962675974 3:137758985-137759007 TTGAACACCTACTATGTGCCAGG - Intergenic
962908891 3:139829773-139829795 TTTGATTCCCACTCTGTGCATGG + Intergenic
962934682 3:140068996-140069018 TTGAATACCTACTATGTGGCAGG - Intronic
963378534 3:144500771-144500793 TTGAGTACCTACTCTGTGCAAGG - Intergenic
963402129 3:144812131-144812153 TTGAATTCATACTATGTACAAGG - Intergenic
963631934 3:147744218-147744240 TTGAGTCCCTACTATGTGCTGGG + Intergenic
963704927 3:148674939-148674961 TTGAGTACCTACTATGTGCCAGG + Intergenic
964144786 3:153446662-153446684 TTGAATCCCCTCTGTGGGGATGG - Intergenic
964206389 3:154179617-154179639 GTGAATGCCTACTATGTGCCAGG - Intronic
964434811 3:156640421-156640443 TTGAATGCCTACTATATGCTAGG - Intergenic
964722538 3:159781611-159781633 TTGAATGCCCACTATGTGTTAGG + Intronic
964793600 3:160475039-160475061 TTGGATTCTCACTATGTGCCAGG - Intronic
965250030 3:166331210-166331232 TTGAATACCTATTATGTGCCAGG - Intergenic
965601986 3:170463833-170463855 TTGAATACACACTATATGCCAGG + Exonic
965622106 3:170652076-170652098 TTCAATGCCCACTATATGCCAGG - Intronic
965707124 3:171520409-171520431 TTGTCTACCCACTATGTGCTGGG - Intergenic
965743217 3:171898565-171898587 CTGAATGCCTACTATGTGCCAGG + Intronic
965788978 3:172367289-172367311 TTGAATTACTACTATGTGCTGGG + Intronic
965805980 3:172542377-172542399 TTGAATGCTCACTAAGTGCCAGG + Intergenic
966013563 3:175112681-175112703 TTGAATGCCTACTCTGTACATGG + Intronic
966343805 3:178955664-178955686 TTGAGTACCCACTATGAACAAGG + Intergenic
966374021 3:179277290-179277312 TTAAATACCCACTCTATGCAGGG + Intergenic
966412378 3:179656923-179656945 TTTTATCCTCACCATGTGCAGGG - Intronic
966471614 3:180295782-180295804 TTGAGTTCCTACTATGTGCTAGG + Intergenic
966619139 3:181945295-181945317 TTGCATACCCACTATGTGCATGG + Intergenic
966676405 3:182594853-182594875 CTGAAGCCCCACAATGTGCCTGG - Intergenic
966699533 3:182831926-182831948 CTGAAGGCCCAATATGTGCATGG - Intronic
966784706 3:183612574-183612596 TTGAGCACCCACTATGTGCCAGG + Intergenic
966945409 3:184774020-184774042 TTGAAGGCCCACTGTGTGCCAGG + Intergenic
966997320 3:185295831-185295853 CTGAATCCCTACTATTTGCCAGG - Intronic
967241306 3:187442241-187442263 TTGAATGTTCACTATGTGCCAGG - Intergenic
967364990 3:188676221-188676243 GTATCTCCCCACTATGTGCAAGG - Intronic
967377600 3:188822710-188822732 CTGAATGCCCACTATGTCCCAGG - Intronic
967713212 3:192733352-192733374 TTGATTGCTTACTATGTGCAAGG + Intronic
967800831 3:193657643-193657665 TTGAATGCTTACTATGTGCCAGG + Intronic
968793505 4:2686352-2686374 TTGAACACCCAATATGTGCCAGG + Intronic
969148216 4:5142859-5142881 TTGATTCTCCACAATGTGGATGG + Intronic
969331011 4:6473353-6473375 TTGAGGGCCCACTATGTGCCAGG - Intronic
970173252 4:13309992-13310014 GGGAATCGCCACTATGTGCTGGG - Intergenic
970178145 4:13359833-13359855 TGGAATCCTCACTGGGTGCAGGG - Intergenic
970185564 4:13447677-13447699 TTGAATTCTCACTATTTGCCAGG - Intronic
970279408 4:14437479-14437501 TTGAGTCCCAACTCTGTGCTGGG - Intergenic
970331931 4:14995479-14995501 TTGAAAGCCTACTATGTGCAAGG + Intergenic
970500937 4:16676487-16676509 TTGAGTTCCCACTCTGTGCAAGG + Intronic
970542319 4:17092546-17092568 TTCAATCAGCACTATGTGCTGGG + Intergenic
970792676 4:19877196-19877218 TTGAAAACCTACTCTGTGCAAGG - Intergenic
970877588 4:20890137-20890159 TTGAATGCTAACTATGTGCTAGG + Intronic
970968129 4:21950349-21950371 GTGAAGACCAACTATGTGCAAGG - Intergenic
971284682 4:25276573-25276595 TTGTATGCCTACTATGTGCGAGG - Intronic
971477757 4:27088338-27088360 TTGAGAACCCACTATGTGCCAGG - Intergenic
972071780 4:35029399-35029421 TTGAATCCTTACTGTATGCACGG + Intergenic
972171355 4:36349476-36349498 TTGAGTGCCTACTATGTGCTGGG - Intergenic
972283164 4:37622770-37622792 TTGAGACCCTACTATGTGCCAGG - Intronic
972327829 4:38034541-38034563 TTGAATGCTTATTATGTGCAGGG + Intronic
972502635 4:39692770-39692792 TTGAATGCCTACTATGGGCTAGG - Intergenic
972669092 4:41196355-41196377 TTGAGTACCCACTAGGTGCTAGG - Intronic
972748259 4:41962688-41962710 TTGAATCTGGACTTTGTGCATGG + Intergenic
973340393 4:48997473-48997495 TTGAGTGCCCACTATGTGCCAGG - Intronic
973569909 4:52227611-52227633 TTGAATACCTACTATGTACCTGG - Intergenic
973627985 4:52791659-52791681 TTGAAGCCCTACTGTGTGCCAGG - Intergenic
973737322 4:53885401-53885423 TTGAATGCCTACTATATGCCAGG - Intronic
973737333 4:53885522-53885544 TTGAACCATTACTATGTGCAGGG - Intronic
973740463 4:53914924-53914946 TTGAACACCCACTATGTGGCAGG - Intronic
974477331 4:62400208-62400230 TTGAATGCCTACTATATGCCAGG - Intergenic
974853636 4:67433513-67433535 TTGAATGCCCACCCTGTGCTGGG + Intergenic
975229141 4:71910315-71910337 TTGAACACCTACTATGTGCTAGG + Intergenic
975371316 4:73591814-73591836 TTGAATCTCCTCTTTGTGCCAGG + Intronic
975406262 4:73994183-73994205 TTGAATACCTAGTATGTGCTAGG + Intergenic
975641671 4:76506543-76506565 TTGAGAGCCCACTATGTGCCAGG - Intronic
975760677 4:77616642-77616664 TTGAACTCCCACCATGTGCCAGG - Intergenic
976054618 4:81049126-81049148 TTGATAACCTACTATGTGCAAGG - Intronic
976097541 4:81525645-81525667 CTGAATGCCCACTATGTGCCAGG + Intronic
976759088 4:88529011-88529033 TTGAATGTCCACTATGTGGCAGG + Intronic
976778600 4:88733928-88733950 TTGAGTGCTCACTATGTGCAAGG - Intronic
977717506 4:100198136-100198158 TTGAGTACCTACTATGTGCAAGG + Intergenic
977914696 4:102578422-102578444 TTGAGTACCTACTATGTGCCAGG + Intronic
978085255 4:104644259-104644281 CTAAGTGCCCACTATGTGCAAGG - Intergenic
978623351 4:110656504-110656526 TTGAGTTCTCACTATGTGCCAGG - Intergenic
978636430 4:110813084-110813106 TTGAATTCCCTCTATGCACAAGG + Intergenic
978644272 4:110910601-110910623 TTGAATGCTTACTATGTGCCAGG + Intergenic
978721814 4:111918729-111918751 TTGAAGGCCTACTATGTGCCAGG + Intergenic
978758164 4:112326473-112326495 TTGAATGCCTACTATGTGTCAGG - Intronic
979267783 4:118723750-118723772 TTGAATGCCCATTATGTGTGAGG + Intronic
979306501 4:119150610-119150632 TTTAATTCACACTATGTGCCAGG + Intronic
979392526 4:120143453-120143475 TTGAATGTCTACTATGTGCTAGG + Intergenic
979405420 4:120304847-120304869 TTGAATAACCACTCTGTGCTAGG + Intergenic
979465621 4:121034685-121034707 TTGAATGCCCACCATATGAAAGG + Intergenic
979601806 4:122593641-122593663 CTGAATCCTTACTATGTGCCAGG - Intergenic
980183141 4:129426875-129426897 ATGAGTGCCAACTATGTGCAAGG + Intergenic
980913366 4:139013088-139013110 TTGAATACACATTATGTGCCAGG - Intergenic
981057231 4:140375295-140375317 TTGAATACCTACTATGTACTAGG + Intronic
981110907 4:140932336-140932358 TTGTATCCCTACTATGTACCAGG + Intronic
981434908 4:144709138-144709160 TTGAGTGTTCACTATGTGCAAGG + Intronic
981968200 4:150632429-150632451 TTGAATACCTACTCTGAGCAAGG - Intronic
982465991 4:155733125-155733147 TTGAATGCCTACTATGTGCCAGG + Intergenic
982643175 4:157988108-157988130 TTGAATACCTACTATGTGCCAGG - Intergenic
983090145 4:163493691-163493713 TTGAATGCCTACTGTGTGCCTGG - Intergenic
983257512 4:165416864-165416886 CTGAGTCCCCACTGTGTGCCAGG - Intronic
983333220 4:166358519-166358541 TTGAAGGCCTACTATGTGCCAGG - Intergenic
983501245 4:168502107-168502129 TTGAGTGCCTACTATGTGCTAGG - Intronic
983568755 4:169182033-169182055 TTGAGTGCCTACTATGTGCTGGG - Intronic
983823611 4:172229196-172229218 TTGAATGCTCACTATGTGCCAGG - Intronic
984653408 4:182292666-182292688 TTGAACCCTCACTCTGTGCTGGG + Intronic
987151542 5:15045785-15045807 TTGAACACCTACTATGTGCTAGG + Intergenic
987314792 5:16714018-16714040 CTGAACACCTACTATGTGCAAGG + Intronic
987778387 5:22398902-22398924 TAGAGACCCCTCTATGTGCAGGG + Intronic
988217250 5:28290926-28290948 TTGAATGCCTACTATGTGCCAGG - Intergenic
988245685 5:28677517-28677539 TTGAATACCTACTATATGCCTGG - Intergenic
989061310 5:37414651-37414673 TTGAGTACCTACTATGTGCTAGG - Intronic
989117595 5:37970519-37970541 TTGAGTACCTATTATGTGCAAGG + Intergenic
989770150 5:45135253-45135275 TTAAATACCTCCTATGTGCAAGG + Intergenic
989786851 5:45342858-45342880 TTGAAAGTCCCCTATGTGCAAGG - Intronic
990161796 5:52949197-52949219 TCGAATGCTTACTATGTGCAGGG + Intronic
990167109 5:53006606-53006628 TTGAACCACGACCATGTGCAAGG + Intronic
990299142 5:54433303-54433325 TTGAATACCTACTATGTGTCAGG - Intergenic
990320685 5:54627479-54627501 TTGAATACTCACTATGAGCTAGG - Intergenic
990427144 5:55697544-55697566 TTGATTACCCACTTTGCGCAAGG - Intronic
990504641 5:56432324-56432346 TTGAGTTCCTACTATGTGCCAGG + Intergenic
990795548 5:59535896-59535918 TTGAATGTCAAGTATGTGCAAGG - Intronic
991089805 5:62683331-62683353 TTGAATACCTACTATGTGCCAGG + Intergenic
991276346 5:64851808-64851830 TTGAATACTTACTAAGTGCAAGG + Intronic
991641057 5:68752956-68752978 TTAAATACCTACTATGTGCAAGG + Intergenic
992304893 5:75426666-75426688 TTGAATACCTACTATGTGCTGGG + Intronic
992460974 5:76959985-76960007 TTGAATGCTTACCATGTGCAAGG + Intronic
992763329 5:79971167-79971189 TCAAATGCCCACTATGTGCCTGG - Intergenic
993324946 5:86522744-86522766 TTTAATACCAACTATATGCAAGG + Intergenic
993958979 5:94273240-94273262 TTGAGTTCTTACTATGTGCAAGG - Intronic
994023553 5:95055432-95055454 TTGAATACTTACTATGTGCCAGG + Intronic
994052483 5:95378634-95378656 CTGAATGCCTACTATGTGCAAGG - Intergenic
994125402 5:96164578-96164600 TTGAATACCCACTCTGTGCCAGG + Intergenic
994127704 5:96187706-96187728 CTGAGTGCCCACTTTGTGCAAGG - Intergenic
994181138 5:96767568-96767590 TTGAATGCCTACTCTGTGCCTGG + Intronic
994604547 5:101951358-101951380 TTAAATGCCAACTATGTGCCAGG + Intergenic
994986011 5:106934389-106934411 ATGAATTCCTACTATGTGCTAGG - Intergenic
995061195 5:107813462-107813484 TTGAGTGCCCACTATGTGCTAGG + Intergenic
995068564 5:107890899-107890921 TTGAGTACCCACTATGTGTCAGG + Intronic
995165724 5:109039329-109039351 TTGAATGCCTACTATGTGCAAGG + Intronic
995755250 5:115496488-115496510 CTGAATCCCTATTATGTGCCAGG - Intergenic
996044945 5:118861644-118861666 TTGAGTACCAACTATGTGCCTGG + Intronic
996294615 5:121896839-121896861 TTGAATACCTACTATGTGCTAGG - Intergenic
996347981 5:122508201-122508223 TTGAATGCTCACTCTGTGCCAGG + Intergenic
996805480 5:127449413-127449435 TTGAGTTCCTACTATGTGCCAGG + Intronic
996823022 5:127651646-127651668 TCAAATCCCCACTATGTGCCAGG + Intronic
997018725 5:129970296-129970318 TTGAGTACCTACTATGTGCCAGG - Intronic
997091844 5:130867338-130867360 CTGTATCCCCACTATTTGAAGGG + Intergenic
997201994 5:132016096-132016118 CTGAGTCCCCACTATGTGCAAGG + Intergenic
997387021 5:133481654-133481676 TTGAGTGCTCACTATGTGCCAGG + Intronic
997452771 5:133996680-133996702 TTGAATGCCTATTATGTGCCAGG - Intronic
997650083 5:135510545-135510567 TTGAATGCCAACTATGTGCCTGG - Intergenic
998073112 5:139214235-139214257 TTGAATGCTCACTATGAGCCCGG + Intronic
998096408 5:139397997-139398019 TTGTATACCTACTATGTGCCAGG - Intronic
998542304 5:142994048-142994070 TTAAATGCCTGCTATGTGCAAGG + Intronic
998595020 5:143520461-143520483 TTGATTACCTGCTATGTGCAAGG + Intergenic
998637833 5:143976062-143976084 TTGGGTTCCCACTATCTGCAAGG - Intergenic
998778667 5:145631659-145631681 TTGAATGCCCATTATGTGCCAGG - Intronic
998839811 5:146241325-146241347 TTGAATGCCTACTATGTGCCAGG + Intronic
999075833 5:148794453-148794475 TTGAATTCCTACCATGTGCCAGG + Intergenic
999076506 5:148800906-148800928 TTGAGTGCCCATTATGTGCCAGG + Intergenic
999145008 5:149386678-149386700 TTGAACACCTACTATGTGCCAGG + Intronic
999192645 5:149759965-149759987 TGGAACACCCATTATGTGCAAGG + Intronic
999201932 5:149822771-149822793 TTGAGTCCTTACAATGTGCAAGG - Intronic
999215969 5:149935459-149935481 TAGAAACCCCACTATGTGTCAGG + Intronic
999726309 5:154441095-154441117 TTGAGTACCTAATATGTGCAAGG + Intergenic
999802058 5:155047457-155047479 TTGAACACCTACTATGTGCCAGG - Intergenic
999876641 5:155813957-155813979 TTGAATGCCCTCTATGTGTCAGG + Intergenic
1000186160 5:158860165-158860187 TTGAGTGCTTACTATGTGCAAGG + Intronic
1000228818 5:159295975-159295997 TTGAATGCTCACTATGTGCCAGG - Intergenic
1000369699 5:160522954-160522976 TTGAGTACCCCCTATGTGCCAGG + Intergenic
1000790146 5:165596165-165596187 TTGAGTGCCTACTATATGCAAGG + Intergenic
1000919788 5:167124457-167124479 TTGAATGCCTACAATGGGCAAGG - Intergenic
1001131127 5:169064380-169064402 GTGAATGCCCACTATGTGTGAGG + Intronic
1001213212 5:169830437-169830459 TTGAATTCTTACTATGTGCTGGG - Intronic
1001293413 5:170482392-170482414 TTGAATCCCTAATGTGTGCCAGG + Intronic
1001306481 5:170578084-170578106 TTGAGTGCCCACTATGTGGTAGG + Intronic
1001455409 5:171856356-171856378 TTGAAGGCCTACTATGTGCTGGG - Intergenic
1001572736 5:172741177-172741199 TTGAACACCTACTATGTGCCGGG + Intergenic
1001585527 5:172831602-172831624 GTGCATCCCCAGCATGTGCAGGG + Intergenic
1002125673 5:177042117-177042139 CTGAGTCCCTACTATGTGCCAGG - Intronic
1002531426 5:179848522-179848544 TTGAATACCAACTGTGTGCCAGG + Intronic
1002878161 6:1229357-1229379 TGGACTGCCCACTATGTGCCAGG + Intergenic
1003364067 6:5456251-5456273 TTGTATGCCTACTATGTGCCAGG + Intronic
1003517752 6:6831964-6831986 TTGAATGCTTACTATGTGCCAGG + Intergenic
1003831831 6:10020485-10020507 TTGAACACCTACTATGTGCAGGG - Intronic
1004128068 6:12893105-12893127 TTGAACCCCTACTATGTGCTGGG + Intronic
1004158482 6:13192071-13192093 TTCAATGCCTGCTATGTGCAAGG + Intronic
1004185922 6:13421047-13421069 TTGAATACTCACTGTGTGCCAGG - Intronic
1004287802 6:14338913-14338935 TTAAGTCCTGACTATGTGCAAGG + Intergenic
1004368489 6:15032017-15032039 TGGGATCCCCAGAATGTGCAGGG - Intergenic
1004627685 6:17392489-17392511 TTGAATGCCCGCCATATGCAAGG + Intergenic
1004705545 6:18121231-18121253 TTGAATGCATACTCTGTGCAAGG - Intergenic
1004946986 6:20626354-20626376 TTGAGTACCTACTATGTGCTGGG - Intronic
1005707854 6:28473856-28473878 TTGACTGCCTTCTATGTGCAAGG - Intergenic
1005726026 6:28649713-28649735 TTGAATACCTACTATGTGTCAGG + Intergenic
1006662052 6:35655251-35655273 CTGAATACCTACTATGTGCCAGG + Intronic
1006704451 6:36006450-36006472 TTGAGTACCTACTATGTGCTAGG + Intronic
1007175164 6:39891454-39891476 TTGAATCCCCACCATGCCCATGG - Intronic
1007465359 6:42047949-42047971 TTGAACACCTACTATGTGCCTGG - Intronic
1008667466 6:53730253-53730275 TTGAGTCCCAACAATGTGCATGG + Intergenic
1008763292 6:54880103-54880125 TTGAGTCCCAGCTATGTGCAAGG + Intronic
1008842802 6:55924509-55924531 TTGAATGTCTACTATGTGCCAGG - Intergenic
1008952553 6:57176455-57176477 TTGAACACCCACTATGTGTTAGG + Intronic
1009163117 6:60307241-60307263 CTGAGTACCCACTATGTGCCAGG + Intergenic
1009450485 6:63794199-63794221 TTGAGTACCTACTATGTGCTAGG - Intronic
1009641780 6:66346931-66346953 TTGAATGGCCACAATGTGCCAGG + Intergenic
1009687314 6:66979208-66979230 TTGAATACCTAATATGTGCCAGG - Intergenic
1009953221 6:70420378-70420400 ATGAATTCTGACTATGTGCAAGG + Intronic
1010161183 6:72857893-72857915 TTGAATGCCTACTATGTGCTGGG + Intronic
1010260984 6:73816598-73816620 TTGAGTCTCTACTATGTGCCAGG + Intronic
1010433019 6:75800082-75800104 TTGAATTCCCAATATGTGTCAGG - Intronic
1010461954 6:76123805-76123827 TTTAATCCCAACTATATACATGG + Intergenic
1010578215 6:77560560-77560582 TTGAATCCCTACTGTGTTCTAGG - Intergenic
1010895423 6:81357145-81357167 TTGAATGCCTACTCTGTGCCAGG - Intergenic
1010940234 6:81908126-81908148 CTGAATGCTTACTATGTGCAAGG - Intergenic
1011111914 6:83847881-83847903 TTGAATACCTACTATGTGCCAGG - Intergenic
1011367058 6:86594657-86594679 TTGAGTACCTACTATGTGCTAGG + Intergenic
1011494704 6:87926562-87926584 CTGAATACCTACTTTGTGCAAGG - Intergenic
1011516229 6:88156716-88156738 TTGAATACCTACTCTGTGCCAGG - Intronic
1011752976 6:90472006-90472028 TTGAATGCTTACTATGTGCTAGG - Intergenic
1011781507 6:90794929-90794951 TTGAATGCCTACTATGTGCTTGG + Intergenic
1011961803 6:93100435-93100457 TTGAATACCCACTATGTGACAGG + Intergenic
1012378544 6:98591474-98591496 TTAAATACCTACTATGTGCCAGG + Intergenic
1012412504 6:98975129-98975151 CTGAAATCACACTATGTGCATGG - Intergenic
1012865614 6:104614774-104614796 TTGACTCTCCACTATGGGCTTGG + Intergenic
1013166731 6:107600827-107600849 TTGGGTGCCTACTATGTGCAGGG + Intronic
1013219345 6:108063535-108063557 TTGAATACCAACTATGTGCTAGG - Intronic
1013582453 6:111549850-111549872 TTAAATGCCTACTGTGTGCAAGG - Intergenic
1013745259 6:113337841-113337863 TTGAATGCCTACTATGTGCCAGG - Intergenic
1014013956 6:116508221-116508243 TTGAACTCCCACTGTGTGCCAGG - Intronic
1014916074 6:127150006-127150028 TTGATTGCCTACTATGTGCCAGG - Intronic
1015107201 6:129550914-129550936 CTGAGTCCCCACTATGTGGAAGG - Intergenic
1015134686 6:129854193-129854215 TTGAATACCTACTGTGTGCCAGG - Intronic
1015256887 6:131187662-131187684 TTGAATCTCTACTATGTGGCAGG - Intronic
1015570452 6:134616045-134616067 TAGAGTGCCCACTATGTGCCAGG + Intergenic
1015573412 6:134645575-134645597 TTGAATACCGACTGTGTGCCAGG - Intergenic
1015707344 6:136102350-136102372 TTGAATACCAACTATGTGCCAGG + Intronic
1015735762 6:136398365-136398387 TTGAATCCCTGCAATGTACATGG - Intronic
1015750496 6:136553658-136553680 TTGAATGCCCACTGTGTGTGAGG - Intergenic
1015825020 6:137302133-137302155 TTGAATGTTCACTATGTGCCAGG + Intergenic
1016526553 6:145007765-145007787 ATGAATGCCCAGTTTGTGCAAGG - Intergenic
1016828627 6:148411429-148411451 TTGAATCCTCAGCATGTACAAGG + Intronic
1016883078 6:148930310-148930332 TTGAGTGCCTACTATGTGCCAGG + Intronic
1016901745 6:149109593-149109615 AGGGATCCCCACTATGTGCAAGG - Intergenic
1017170648 6:151451595-151451617 TCGAATGCCTACTATGTGCTGGG - Intronic
1017236082 6:152118863-152118885 CTGAATGCCCACTATGTGGCAGG - Intronic
1017323843 6:153124299-153124321 TTGAGCACCCACTATGTGCTAGG - Intronic
1017529087 6:155269894-155269916 TTGTATCCCTACTATGTGCCAGG + Intronic
1017600525 6:156075818-156075840 TCGAGTGCCCACTATGTGCCAGG - Intergenic
1017941202 6:159054872-159054894 TTGAGTCCCCACAAGGTGCATGG + Intergenic
1018052832 6:160026425-160026447 TTGAATCCCTTCTGTGTGCTAGG + Intronic
1018366013 6:163120594-163120616 TTAAGTGCCTACTATGTGCAAGG + Intronic
1018604478 6:165583077-165583099 TTGAATGCCTACTATGTGCGGGG + Intronic
1020252384 7:6479831-6479853 TTGACCACCCACTATGTGCAAGG - Intronic
1021210890 7:17851029-17851051 TTGAGTGCCTACTATGTGCTAGG + Intronic
1021252598 7:18349523-18349545 TTGCATCCCTGCTATGTGCTAGG - Intronic
1021441551 7:20682685-20682707 TTGAGTGCCCACTGTGTGCCAGG - Intronic
1022186108 7:27971025-27971047 TTGAATGCCTACTATGTGTGGGG - Intronic
1022193423 7:28040274-28040296 TTGAGTGCCAACTATGTGCCAGG + Intronic
1022320381 7:29282305-29282327 CTGAGTGCCCACTATGTGCAGGG + Intronic
1022594447 7:31698963-31698985 TTGAGTGCCTACTATGTGCCAGG + Intronic
1022640125 7:32174270-32174292 TTGAATTCCCTCAATGTGCCAGG + Intronic
1022834306 7:34099099-34099121 TTGAGTGCTCACTATGTGCCTGG + Intronic
1022972839 7:35532988-35533010 TTGATTACCTACTATGTGCCAGG + Intergenic
1022999356 7:35791586-35791608 TTGAGTGCCTACTATGTGCAAGG + Intergenic
1023516061 7:41002951-41002973 TTGAATGCCTCCTATGGGCAGGG - Intergenic
1024459412 7:49644698-49644720 TTGAATTCCTTCTATGTGCTTGG + Intergenic
1024565113 7:50674191-50674213 TTGAGTGCCTGCTATGTGCAAGG - Intronic
1024849887 7:53699920-53699942 TTGAATGCCCATTCTGTGCCGGG - Intergenic
1024903582 7:54350757-54350779 TTGAGTGCCCACAAAGTGCAAGG - Intergenic
1024978439 7:55134534-55134556 TTGAGTCCCTACTGTGTGCCGGG - Intronic
1026304393 7:69127713-69127735 TTGAATACCCACTATGAGTCAGG + Intergenic
1027290338 7:76702404-76702426 TTGAGTACCTACTATGTGCAAGG + Intergenic
1027443424 7:78245373-78245395 TTGAATGCCCACAATGTGCTAGG - Intronic
1027762430 7:82296796-82296818 TTGAATGCCAACTATTTGCTAGG - Intronic
1028547863 7:92024608-92024630 TTGAGTACCTATTATGTGCAGGG - Intronic
1028616327 7:92771703-92771725 TTGAATATTCACTCTGTGCAGGG - Intronic
1028830851 7:95325071-95325093 TTGAGTACCTACTATGTGCCAGG + Intergenic
1028890879 7:95987329-95987351 TTGAGTACCTACTATGTGCTAGG + Intronic
1028936224 7:96466750-96466772 TTGAACATCCACTGTGTGCAAGG - Intergenic
1029165885 7:98590118-98590140 TGGAACACCTACTATGTGCAAGG - Intergenic
1029670168 7:102024673-102024695 TTGAGTCCCCACTGTGTGCCAGG + Intronic
1029982116 7:104888578-104888600 TTGAAGTCCTACTATGTGCCAGG + Intronic
1029992460 7:104974672-104974694 TTGAATGCCCACTATGTGTCAGG - Intergenic
1030096314 7:105903336-105903358 TTGAGTCCCTAGTATGTGCCAGG - Intronic
1030624723 7:111831957-111831979 TTGAATGCCTGCTATGTGCTAGG + Intronic
1030631948 7:111905915-111905937 TTGAGTACCTACTATGTGCTGGG + Intronic
1030765463 7:113404013-113404035 TTGAGTGCTTACTATGTGCAAGG + Intergenic
1031056654 7:116998977-116998999 TTGTGTCCCTACTATGTGCTAGG + Intronic
1031077150 7:117223863-117223885 TTGAAAACCTACTATGAGCAAGG - Exonic
1031085365 7:117297141-117297163 TTGAAACCCCACAATGTCCAGGG - Intronic
1032064700 7:128758372-128758394 TTGAAAGCCAACTATGTGCCAGG + Intronic
1032102206 7:128990474-128990496 TTGAGTGCCCACTATGTGCCAGG - Intronic
1032636625 7:133716200-133716222 TTGAATACTTACAATGTGCAGGG + Intronic
1032647128 7:133837161-133837183 TTGAATGCCTACTATGTGCCAGG + Intronic
1032750942 7:134840859-134840881 TTGAATACCTACTATTTGCGAGG - Intronic
1033243589 7:139700858-139700880 TTGAATACCTACTATGTGCATGG - Intronic
1033457997 7:141519568-141519590 TTGAACCCCTACTATGTACCAGG - Intergenic
1033822523 7:145151302-145151324 TTGAGTGTCCACTATGTGCCAGG - Intergenic
1033924038 7:146434872-146434894 TTGAATCCCCTATGTGTGCCAGG + Intronic
1033964529 7:146958787-146958809 TTGGATGCCTACTATGTGCCAGG - Intronic
1034072789 7:148203277-148203299 TTGCATACCTACTATGTGCTAGG + Intronic
1034747154 7:153532936-153532958 TTGCATTCCTACTATGTGCTAGG - Intergenic
1035936008 8:3840456-3840478 TTGAATGCCTATTATGTTCAGGG - Intronic
1036581947 8:10082854-10082876 TTGAATTCCTACTCTGTTCACGG - Intronic
1037794551 8:21981069-21981091 TTGAATACCTACTCTGTGCCAGG + Intronic
1037807183 8:22065028-22065050 TTGAATGCTCATTATGTGCTAGG - Intronic
1038217237 8:25573500-25573522 CCCAATCCCCAATATGTGCAAGG - Intergenic
1038465684 8:27760571-27760593 CTGAATACCTACTATGTGCCAGG + Intronic
1038757331 8:30353482-30353504 TTGAGTGCCTACTATGTGCCAGG - Intergenic
1038763923 8:30410018-30410040 TTGAATACCTACTATGTGCCTGG + Intronic
1038896427 8:31787897-31787919 TTGAATCCTGACTATGTGTCAGG + Intronic
1038905575 8:31898315-31898337 TTTAATAACCACTATGTGCCAGG + Intronic
1038967054 8:32586093-32586115 TTGAGTACCTACTATGTGCCAGG - Intronic
1039139872 8:34374794-34374816 TTGAGTACTCACTATGTGCCAGG + Intergenic
1039165365 8:34673455-34673477 TTGAGTGCCCACTATGTGCTAGG + Intergenic
1039229032 8:35422719-35422741 TTGAATACCTACTATGTGCCAGG + Intronic
1039483521 8:37893454-37893476 TTTAATGCCTACTATGTGCCAGG - Intronic
1040046888 8:42973900-42973922 CTGAATATCTACTATGTGCAGGG - Intronic
1040382726 8:46888409-46888431 TTAAATCCCCTCTGTGGGCAAGG + Intergenic
1040874900 8:52141255-52141277 CTGAACACCTACTATGTGCAAGG + Intronic
1041543699 8:59016149-59016171 TTAAATGCCTACTGTGTGCAAGG + Intronic
1042382024 8:68127813-68127835 TTGAGCTCCCACTAAGTGCATGG - Intronic
1042427662 8:68667523-68667545 TTGAATTCCTACCCTGTGCAAGG + Intronic
1042476074 8:69249066-69249088 TTGAGTGCCTACTATGTGCCAGG - Intergenic
1042572669 8:70183864-70183886 TTGAGCGCCCACTATGTGCCAGG - Intronic
1043007951 8:74844202-74844224 TTGAATGCTCACTATGTGTCAGG + Intronic
1043017058 8:74952221-74952243 TTGAATCCCTACTATATGCTAGG - Intergenic
1043232806 8:77823817-77823839 TTTATTCCCCACTTTGTCCAGGG + Intergenic
1043379186 8:79684512-79684534 TTGAGTACCTACTATGTGCCAGG - Intergenic
1043392214 8:79802905-79802927 TAGAATGCCTACTATGTGCCAGG + Intergenic
1043667399 8:82833426-82833448 CTGAATACCTACTATGTGCCAGG - Intergenic
1043919382 8:85963617-85963639 TTGAACACCCACTCTGTGCCAGG - Intergenic
1044480358 8:92680289-92680311 TTGAATAACTACTATGTGCCTGG + Intergenic
1044493426 8:92847558-92847580 TGGAATGCCTACTATGTGTATGG - Intergenic
1044561251 8:93614314-93614336 TTGAATACCTACTATGTGACAGG - Intergenic
1044908038 8:97026227-97026249 TTGAAAACCTACTATGTGCCAGG + Intronic
1045496305 8:102712325-102712347 TTGAATACCTACTATGTGCCAGG - Intergenic
1045764702 8:105653337-105653359 TTGAATTGCCACTATATGCCAGG + Intronic
1045809422 8:106203856-106203878 TTGAGTGCCTACTATGTGAAAGG + Intergenic
1045836349 8:106525954-106525976 TTGAATGCCTACTATGTTCCAGG + Intronic
1045906858 8:107355952-107355974 TTGAGACCCCACTATGTGCCAGG - Intronic
1046094568 8:109541576-109541598 TTGAGTACCTACTATGTGCCCGG + Intronic
1046096880 8:109573098-109573120 TAGACTTCCCACTATGTGCCAGG + Intergenic
1046104842 8:109652993-109653015 TTAAATCCCCAGTTTGTACAAGG - Intronic
1046760228 8:118012738-118012760 TTGAATGTCCATTATGTGCCAGG - Intronic
1046785207 8:118258465-118258487 TTGAGTGCCTACTATGTGCCTGG + Intronic
1046819249 8:118618542-118618564 TTTAATCCTCACAATGAGCAGGG + Intronic
1046871788 8:119211949-119211971 CTGAATACCTACTATGTGCAAGG + Intronic
1047056874 8:121174695-121174717 TTGAATGCCTACTGTGTGCCAGG + Intergenic
1047140417 8:122132726-122132748 TTGAATACCTGCTATGTGCTAGG - Intergenic
1047354004 8:124103001-124103023 TTGGATCACAACTATGTGCTAGG - Intronic
1047469491 8:125155512-125155534 TTGAGTGCCTACTATGTGCCAGG + Intronic
1047502879 8:125455582-125455604 ATGAGACCCCACTATGTGCCAGG + Intergenic
1047527281 8:125644332-125644354 TTGAATACCTACTAGGTGCCAGG + Intergenic
1047548507 8:125843571-125843593 AGGCATCCTCACTATGTGCATGG - Intergenic
1047754122 8:127905581-127905603 TTGAGCACCTACTATGTGCAGGG + Intergenic
1047754278 8:127906788-127906810 TTGAGTGCCTACTATGTGCCAGG + Intergenic
1047818754 8:128494954-128494976 TTGAATACCCTCTATGTGCAAGG - Intergenic
1047985554 8:130229612-130229634 TTGAATACCTACTCTGTGCCAGG - Intronic
1048142746 8:131810601-131810623 TTGAATCTCCACTATGTTCCAGG - Intergenic
1048228368 8:132612695-132612717 TAGAATACCTACTATGTGCCAGG - Intronic
1048261596 8:132949895-132949917 GTGAATGCCCACTCTGTGCTGGG + Intronic
1048377720 8:133837184-133837206 TTGAATCCATACTATGTGTTAGG - Intergenic
1048381663 8:133870724-133870746 TTGAAGCCCTGCTATGTGCTGGG + Intergenic
1048412787 8:134192938-134192960 TTGAGTGCCAACTATGTGCCAGG - Intergenic
1048513494 8:135082929-135082951 TTGAGTTCCTACTATGTGCCAGG - Intergenic
1048708453 8:137181484-137181506 TTGAGTACCTACTATGTGCTGGG - Intergenic
1049095542 8:140546071-140546093 TTGAGTACCTACTGTGTGCAGGG - Intronic
1049353576 8:142177031-142177053 CTGAATGCCTACTGTGTGCAAGG - Intergenic
1050170608 9:2811991-2812013 TTGAATGCCTACTATGTGCCAGG + Intronic
1050298920 9:4236698-4236720 TTGAGCCCCCACTATGTGTAAGG + Intronic
1050466407 9:5928904-5928926 TTGACTGCCCACTGTGTGCAAGG - Intronic
1050524991 9:6538560-6538582 TTGAGTGCCTACTATGTGCCAGG + Intronic
1050704692 9:8383820-8383842 TTGAGTCTCTACTATGGGCAAGG + Intronic
1050890033 9:10812989-10813011 TTGAAAACCCATTATGTGCCAGG - Intergenic
1051114098 9:13674364-13674386 TTGAATATCCACTATGTTCCAGG - Intergenic
1051265969 9:15308378-15308400 TTGAGTCCTTACTATGTGCCAGG + Intergenic
1051856112 9:21567220-21567242 TTGAATCCCTCCCATGTGCCTGG + Intergenic
1051873485 9:21766426-21766448 TTGAGTTTCCACTATGTGCTAGG + Intergenic
1052383798 9:27801554-27801576 TTGAATGCCTACTATGTGCCAGG - Intergenic
1052430294 9:28357850-28357872 TTGATTCCCTACTAGGTGCTAGG - Intronic
1053089174 9:35258061-35258083 TTGAGTATCCACTACGTGCAAGG - Intronic
1054838809 9:69712596-69712618 TTGAATTCCTACAATGTGCAAGG + Intronic
1054839015 9:69715392-69715414 ATGAGTCCTCACAATGTGCAGGG + Intronic
1054944275 9:70778427-70778449 TTGAGTGCCTACTATATGCATGG - Intronic
1055016783 9:71626970-71626992 TTGAGTGCCTACTATGTGCCAGG - Intergenic
1055095565 9:72410156-72410178 TTGAGTGCCCACTATGTCCGAGG - Intergenic
1055267769 9:74517846-74517868 TTGAACACTCACTATGTGAAAGG + Intronic
1055287533 9:74745318-74745340 TTGAGTACCTACTATGTGCCAGG + Intronic
1055354295 9:75421515-75421537 TTGAGTGCCTACTATGTGCTAGG - Intergenic
1055650880 9:78405727-78405749 TTGTATATCCACTCTGTGCATGG + Intergenic
1055666431 9:78557548-78557570 TTGAGGCCCCACCATGTACAGGG + Intergenic
1055768602 9:79692000-79692022 TTGAGTCCCCACTATTTGCCAGG - Intronic
1056253415 9:84773821-84773843 TTGAGTCCCTACTCTGTGCTTGG + Intronic
1056724855 9:89105999-89106021 TTGAACATCCACTATGTGCCAGG + Intronic
1057268915 9:93636232-93636254 TTGACTCCTCCCTATGTGCATGG + Intronic
1057521367 9:95763124-95763146 TTGAACACCTACTATGTGCCAGG + Intergenic
1057867634 9:98693772-98693794 TTGAATCCCTACTATGTGCTGGG - Intronic
1058075030 9:100642339-100642361 TTGACTACCTACTATGTGCCAGG + Intergenic
1058103692 9:100946029-100946051 TTAAATGCCCACTCTGTGCCAGG + Intergenic
1058172898 9:101704405-101704427 TTGAATCCCCACAATGTGCTAGG + Intronic
1058573702 9:106377055-106377077 TTGAACACCAACTATGTGCCAGG - Intergenic
1058684525 9:107468493-107468515 TTGAACACCTACTATGTGCCAGG + Intergenic
1058703748 9:107621993-107622015 TTGAACACCTACTATGTGCCAGG - Intergenic
1059021453 9:110580473-110580495 TTGAATACCCATTGTGTGCCAGG + Intergenic
1059369048 9:113810339-113810361 TTGAACACCTACTATGTGCCAGG - Intergenic
1059685943 9:116636210-116636232 TTGAATACCTACTATGTATATGG + Intronic
1059926998 9:119219554-119219576 CTGAAGCCCTACTATGTGCCAGG + Intronic
1060115516 9:120937080-120937102 TTGAATGGCTGCTATGTGCAAGG + Intergenic
1060139706 9:121199935-121199957 TTAAACACCCACTATGTGCCTGG + Intronic
1060162300 9:121375465-121375487 TTGCATACCAACTATGTGCCAGG + Intergenic
1060278672 9:122201144-122201166 TTGAATACCTACTATGCGCCAGG - Intergenic
1060299605 9:122367544-122367566 TTGAATATCTACTATGTGCAGGG - Intergenic
1060459754 9:123839416-123839438 TTGAATCCCTTCTGTGTGCCAGG - Intronic
1060693402 9:125685097-125685119 CTGAATGCCTACTATGTGCCAGG + Intronic
1061350705 9:130062510-130062532 TTAAATACCTACTATGTGCTAGG + Intronic
1061613940 9:131766881-131766903 TTGAGTGCCTACTATGTGCCAGG + Intergenic
1061651662 9:132055128-132055150 TTGAGGGCCCACTATGTGCAGGG - Intronic
1061701502 9:132419748-132419770 TTGAACACCTACAATGTGCAAGG + Intronic
1062147170 9:134996171-134996193 CTGAATCCCTACTATGAGCCAGG + Intergenic
1203454470 Un_GL000219v1:152225-152247 TTGAATCCTTACTAAGAGCAAGG - Intergenic
1186228936 X:7431770-7431792 TTGAATGTCTACTATGTGCTAGG - Intergenic
1186366336 X:8898105-8898127 TTGCATGCCTACTATGTGCTGGG + Intergenic
1186825688 X:13337806-13337828 TTGAGTACCTACTATGTGGATGG - Intergenic
1187235240 X:17461036-17461058 TTGAATACCTACTTTGTGCGTGG + Intronic
1187247182 X:17563291-17563313 CTGAATGCCCCCTATGTGCCAGG - Intronic
1187305955 X:18095444-18095466 TTGAAGCCCCACTATAAACAAGG + Intergenic
1187420896 X:19132762-19132784 TTGAATATCAACTATGTGCTAGG - Intergenic
1188264847 X:28060318-28060340 TTGAATGCCAAATATGTGCCAGG + Intergenic
1188729197 X:33625574-33625596 TTGAGTCCTCAGTATGTGCCAGG + Intergenic
1189172332 X:38921525-38921547 TTGAGTGCCTGCTATGTGCAAGG + Intergenic
1189192148 X:39119522-39119544 TTGAATACCTGCTATGTGCCAGG - Intergenic
1189211182 X:39284905-39284927 TTGAATACCCATTATCTGCCAGG - Intergenic
1189222107 X:39381396-39381418 TTGAGTACCCACTGTGTGCCAGG + Intergenic
1189337618 X:40179847-40179869 TTGATTGCCCACTTTGTGCCAGG + Intergenic
1189761089 X:44322326-44322348 TTGAACACCTACTATGTGCAAGG - Intronic
1189887987 X:45568776-45568798 TTGGATGCCTACTATGTGCCAGG + Intergenic
1189926040 X:45956615-45956637 TTGAGTACCCACCATGTGCCAGG + Intergenic
1190443963 X:50504466-50504488 TTGAATACTCAGTATGTGCCAGG + Intergenic
1190553454 X:51609538-51609560 TTGAATGTCCTCTATGTGCCTGG - Intergenic
1190879860 X:54484406-54484428 TTGAGTGCCTACTATGTGCTAGG - Intronic
1191841830 X:65518760-65518782 TTGCATGCCCACTATGTGCCAGG - Intronic
1192209251 X:69117170-69117192 TGGAATGCCCACCATGTGCTGGG - Intergenic
1192220002 X:69191423-69191445 TTGAATCTCTACTATGTGCCAGG - Intergenic
1192273487 X:69606740-69606762 TTGAGTACCTACTATGTGCCAGG - Intergenic
1192480423 X:71480443-71480465 TTGAATTCCCACTATGTACCCGG + Intronic
1192639115 X:72846357-72846379 TTGAAGCCCTACTATGTGGCAGG - Intronic
1192642596 X:72874448-72874470 TTGAAGCCCTACTATGTGGCAGG + Intronic
1192816947 X:74603599-74603621 TTAAATATCCACAATGTGCAAGG - Intronic
1192890273 X:75383239-75383261 TTGAATGCCAATTATGTGCCAGG - Intronic
1193137098 X:77984283-77984305 TTGAATGTCCATTATGTGCCCGG - Intronic
1193166413 X:78285777-78285799 TTGAGTGCCTACTATGTGCAAGG - Intronic
1193851914 X:86547244-86547266 TTGAATACCTCCAATGTGCATGG + Intronic
1193934351 X:87597793-87597815 TTGAAGACTCACTATGTACAAGG - Intronic
1194387234 X:93270830-93270852 TTGAGTAACTACTATGTGCAAGG + Intergenic
1194720679 X:97336691-97336713 TTAAATGCCTACTATGTGCCAGG - Intronic
1194771268 X:97908707-97908729 TTGAGTGCTCACTATGTGCAAGG + Intergenic
1194970301 X:100335750-100335772 TTGAGTGCCCACTATGTGCCTGG - Intronic
1195005110 X:100678226-100678248 TTGAGTGCCTACTATGTGCCAGG - Intronic
1195006968 X:100694723-100694745 ATGAATGCCTACTATGTGCCAGG - Intronic
1195134074 X:101886106-101886128 TTGAACTCCTACTATGTGCCAGG + Intronic
1195217779 X:102716927-102716949 GGGAATCCACACTATGTGCAAGG - Exonic
1195430792 X:104787082-104787104 TTGAGTACCCACTTTGTGCCAGG + Intronic
1195451104 X:105013988-105014010 CTGAATACGCACTATGTGCCTGG - Intronic
1195715204 X:107811851-107811873 TTGAATTCTCTCTATGTGCCAGG + Intergenic
1196236619 X:113288941-113288963 TTGAATGCCTACCATGTGCCAGG + Intergenic
1196275243 X:113759117-113759139 TTGACTTCCTACTATGTGCACGG - Intergenic
1196287996 X:113905002-113905024 TTGAGTACCTACTATGTGCCAGG + Intergenic
1196615593 X:117763638-117763660 TTGAATACTCACTTTGTGCCAGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197082828 X:122440044-122440066 GTGAATCCCCACTATGAGAGAGG - Intergenic
1197143603 X:123145051-123145073 TTGAATACCTACTATGTGTCAGG + Intergenic
1197332712 X:125173844-125173866 CTGAATCCCTGCTATGGGCAAGG + Intergenic
1197454533 X:126661911-126661933 TTGAATACAAACTATGTGCTAGG - Intergenic
1197613202 X:128661708-128661730 TTGAATGCCTACTATGTGCCAGG + Intergenic
1197622378 X:128764936-128764958 TTGAATCCCTACTCTGTGCTGGG - Intergenic
1197634902 X:128903879-128903901 TTGAATACCTACTCTGTGCTAGG - Intergenic
1197954952 X:131936369-131936391 TTGAATGCCTATTATGTGCCAGG - Intergenic
1198217369 X:134568273-134568295 TTGAATGCCTACTATGTGCACGG + Intronic
1198423870 X:136496349-136496371 TTGAGCCCCTACTAAGTGCAGGG - Intergenic
1198425495 X:136515737-136515759 TTGAGCCCCCACTATGTGCCAGG - Intergenic
1198427135 X:136531537-136531559 TTGAATGCCAACTGTGTGCCAGG - Intergenic
1198445220 X:136706717-136706739 TTGAGCACCTACTATGTGCAAGG - Intronic
1198466832 X:136910739-136910761 TTGAAAGCTTACTATGTGCAAGG - Intergenic
1198514128 X:137387328-137387350 TTGAATGCCTACTATGTGCCAGG + Intergenic
1198640882 X:138755237-138755259 TTTAATATCCACAATGTGCAAGG - Intronic
1198681249 X:139184735-139184757 TTGAATACCTACTATGTGCCAGG - Intronic
1198764214 X:140064427-140064449 TTAAATGCCTACTATGTGCCAGG - Intergenic
1198811953 X:140544849-140544871 TTGAATGCCTACTATGTACTAGG + Intergenic
1198984945 X:142440460-142440482 TTAAATCCCTACTGTGTGCCAGG + Intergenic
1199238772 X:145522147-145522169 TTGAATACCTACTTTGTGCCAGG + Intergenic
1199497601 X:148470616-148470638 TTGAGGGCCTACTATGTGCAGGG + Intergenic
1199503791 X:148538661-148538683 TTAAATCCTTACTATGTGCAAGG + Intronic
1199531200 X:148849633-148849655 TTGAGTGCCTACTATGTGCCAGG + Intronic
1199652741 X:149963245-149963267 TTGAATATCCACTCTATGCAAGG + Intergenic
1199814466 X:151385774-151385796 CTGAGTGCCTACTATGTGCAAGG - Intergenic
1200042271 X:153379178-153379200 CTGAGTCCCCACTGTGTGCCAGG - Intergenic
1200381410 X:155841327-155841349 TTGAGTGCCTACTATGTGCCAGG - Intergenic
1200619713 Y:5427445-5427467 TTGAGTCCCCACTATGTGACAGG + Intronic
1200895954 Y:8376268-8376290 CTAAATCCCCACTATGGGGAGGG + Intergenic