ID: 905785104

View in Genome Browser
Species Human (GRCh38)
Location 1:40749216-40749238
Sequence AAGGAGAAACAATATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 614}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905785104_905785112 16 Left 905785104 1:40749216-40749238 CCTTCCTCATATTGTTTCTCCTT 0: 1
1: 0
2: 3
3: 67
4: 614
Right 905785112 1:40749255-40749277 CCTGCCACTTACTGGCTCTATGG 0: 1
1: 1
2: 4
3: 58
4: 339
905785104_905785114 22 Left 905785104 1:40749216-40749238 CCTTCCTCATATTGTTTCTCCTT 0: 1
1: 0
2: 3
3: 67
4: 614
Right 905785114 1:40749261-40749283 ACTTACTGGCTCTATGGCTGTGG 0: 1
1: 0
2: 6
3: 52
4: 534
905785104_905785115 23 Left 905785104 1:40749216-40749238 CCTTCCTCATATTGTTTCTCCTT 0: 1
1: 0
2: 3
3: 67
4: 614
Right 905785115 1:40749262-40749284 CTTACTGGCTCTATGGCTGTGGG 0: 1
1: 0
2: 2
3: 48
4: 373
905785104_905785108 8 Left 905785104 1:40749216-40749238 CCTTCCTCATATTGTTTCTCCTT 0: 1
1: 0
2: 3
3: 67
4: 614
Right 905785108 1:40749247-40749269 ACCTAAACCCTGCCACTTACTGG 0: 1
1: 0
2: 1
3: 19
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905785104 Original CRISPR AAGGAGAAACAATATGAGGA AGG (reversed) Intronic
900955184 1:5882450-5882472 AAGGAGAAAGAACAAGAGGCGGG - Intronic
901475437 1:9486175-9486197 AAGGAGCAACCAGATGAGGTGGG - Intergenic
903108111 1:21102689-21102711 GAGGAGGAAAAATAGGAGGATGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
905257366 1:36693465-36693487 GAGGAGAGACAAAAGGAGGAAGG + Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905479099 1:38248967-38248989 AAACAGAAACAAAATGGGGAGGG - Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905980768 1:42224683-42224705 AAGAAAAAATAATATTAGGATGG + Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
909168880 1:72268007-72268029 AAGTAGAAACAATATGTGTGAGG + Intronic
909474641 1:76069279-76069301 AAGCAGAAACAATTTGTGAATGG - Intergenic
909802200 1:79823834-79823856 GAGGAGACAGAAGATGAGGAAGG - Intergenic
909813654 1:79962774-79962796 AAGGAGAAAGGATATGAGAGAGG + Intergenic
909876417 1:80810042-80810064 ACTGATAAACAATATGAAGAAGG - Intergenic
910375102 1:86559900-86559922 AAGGAAAAAATATGTGAGGATGG - Intronic
911242436 1:95480690-95480712 AAGGAAACACAATTTGAAGATGG - Intergenic
911529137 1:99022974-99022996 AAGGAGCAAGAATATGATGGAGG - Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912016100 1:105038465-105038487 AAGGAAGAAAAAAATGAGGAGGG - Intergenic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913662995 1:121021246-121021268 GAGGAGATACAATATGGGAATGG - Intergenic
913698215 1:121348201-121348223 AAGGATAAATGAGATGAGGATGG - Intronic
914014376 1:143804511-143804533 GAGGAGATACAATATGGGAATGG - Intergenic
914139334 1:144931851-144931873 AAGGATAAATGAGATGAGGATGG + Intronic
914653001 1:149713069-149713091 GAGGAGATACAATATGGGAATGG - Intergenic
914826206 1:151139526-151139548 AAGGAGCCATAATGTGAGGAGGG - Intronic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
916143635 1:161721682-161721704 AAGGAGACACACTATCAGGCTGG + Intronic
916189931 1:162168721-162168743 AAGGAGAAAGAAAGGGAGGAAGG - Intronic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916350549 1:163844844-163844866 ATTAAGAACCAATATGAGGAAGG - Intergenic
916607316 1:166355780-166355802 AAGGAAAAACATGATGAGAAGGG - Intergenic
916874157 1:168950936-168950958 AGGAAGAAATATTATGAGGATGG + Intergenic
916932405 1:169592318-169592340 ATGGAGAAAGAATAAGAGTAAGG + Intronic
917201161 1:172516939-172516961 AAGGAGGAAGAATATGACCAAGG - Intergenic
917628303 1:176867989-176868011 AATGAGAAAGAAAATGAAGAAGG - Intronic
917678201 1:177340229-177340251 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
918595410 1:186287208-186287230 AAGGGGAAAAAAGATGAAGATGG - Intergenic
918658814 1:187063795-187063817 TAGGAATAACAATATGAGGTAGG + Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920061379 1:203229201-203229223 CAGGACAGACAATATGAGGTTGG + Intronic
920125223 1:203689021-203689043 AAGAAGAGACAATAAAAGGAGGG - Intronic
920226640 1:204443814-204443836 AAGGAGAAACAAGATGCAGAGGG - Intronic
920485614 1:206366857-206366879 AAGGATAAATGAGATGAGGATGG - Intronic
920548508 1:206838644-206838666 GAGGAGAAAGAATCTGAAGATGG - Intronic
920565623 1:206970446-206970468 AAGGGGACACAAGAGGAGGAAGG - Exonic
921325938 1:213986339-213986361 AAGGAGAAAAAAAATTAGGTCGG - Intronic
921573615 1:216807770-216807792 AAAGAGAACCAAGATGAGGATGG + Intronic
922085688 1:222344734-222344756 ATGGAGAAATAATAAGAAGAGGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923751820 1:236753822-236753844 AAGGAGAAACGAAGGGAGGAGGG - Intronic
923806519 1:237263929-237263951 AAGGGGAAAAAATAAGAGAAGGG + Intronic
924630588 1:245736470-245736492 TGGCAGAAACAATATGGGGATGG + Intergenic
1063789028 10:9419910-9419932 AAGGAGAAATTACATGAGGCTGG + Intergenic
1063922863 10:10949221-10949243 AAGGAGAGAGAATATGGGAAGGG - Intergenic
1064523831 10:16231989-16232011 AAGGAGAAGCAAGTTGATGATGG - Intergenic
1065030302 10:21579418-21579440 AGAGAGAAAGAATATGAGGCAGG - Intronic
1065475646 10:26135450-26135472 AAGGAGAATCAACATAAGGCAGG + Intronic
1065602929 10:27388102-27388124 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068467593 10:57415089-57415111 GAAGAGAAAGAAGATGAGGAGGG + Intergenic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068532448 10:58204899-58204921 AAGGATAGACAATATGAAAATGG + Intronic
1069583332 10:69579717-69579739 AAGTAAAAACAATATGTGTATGG - Intergenic
1069692098 10:70360406-70360428 AAGGAGGAAGAAGAGGAGGAGGG - Intronic
1070506991 10:77122531-77122553 AAGCAGAGAAAATATGAGAAAGG + Intronic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071455960 10:85851881-85851903 AGGGAGAAAAAAATTGAGGATGG - Intronic
1071473576 10:86005406-86005428 AAGGAGAAAGATCATGAGCAAGG + Intronic
1071494294 10:86157126-86157148 AAGGAGGAACAAGCTTAGGATGG + Intronic
1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG + Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072271275 10:93779491-93779513 AGGGAGAAAGAAAAAGAGGAAGG + Intronic
1072326293 10:94301924-94301946 AAGGATAAACATTATGTGAATGG + Intronic
1072523987 10:96255182-96255204 AAGGATAAACAAGTTCAGGAAGG + Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1072857119 10:98959879-98959901 AAGGAGAAAGAAGAGGAGGAGGG - Intronic
1072880421 10:99221612-99221634 AAGGAGAAAAAACTTGAGCAGGG + Intronic
1073192066 10:101658568-101658590 AATGAAAAAGAAAATGAGGAAGG + Intronic
1073676538 10:105653676-105653698 AAGGAAAAACATCATGAGAATGG + Intergenic
1074013124 10:109504634-109504656 AAGAGGAAATAATATGGGGATGG + Intergenic
1074449864 10:113550312-113550334 AATAAGAGACAATATGTGGAAGG + Intergenic
1074657573 10:115611917-115611939 AAGGCCAAAAATTATGAGGAAGG + Intronic
1075212107 10:120500228-120500250 AAAGACAAACAAGACGAGGAAGG + Intronic
1078477238 11:11641412-11641434 AAGGAAAAAGAAGATGAGGAAGG - Intergenic
1078554954 11:12317039-12317061 AAAGAGAAACTCTATGAGGTTGG - Intronic
1078744071 11:14094706-14094728 AAGCAGTTACAAAATGAGGAAGG + Intronic
1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG + Intronic
1078838038 11:15050824-15050846 AAGGATAAACTATATGAAAATGG + Intronic
1079134646 11:17769503-17769525 AAGGAGAAAGGAAAGGAGGAAGG + Intronic
1079493536 11:21015672-21015694 AAGGAGAAAGAACTAGAGGAGGG - Intronic
1079569096 11:21920921-21920943 AAGGAGAAAAATTTTGAGAAGGG - Intergenic
1079684698 11:23343832-23343854 AAGAAGAAAAAATAGGAAGATGG + Intergenic
1079841414 11:25404820-25404842 TAGAAGAAAGAATATGGGGAGGG + Intergenic
1079841473 11:25406036-25406058 TAGAAGAAAGAATATGGGGAGGG - Intergenic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1080740347 11:35058051-35058073 GATGAGAAACACTATGAGGGAGG + Intergenic
1080863893 11:36176251-36176273 AAAGAGAAAGAATATCAGAATGG - Intronic
1080932736 11:36829748-36829770 AAACTGGAACAATATGAGGAGGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083311130 11:61784323-61784345 AAGGAGGAACCATGTGAGGAGGG + Exonic
1083351885 11:62035475-62035497 AAGGAGAAAGAAAGAGAGGAAGG - Intergenic
1083463877 11:62832680-62832702 AAGGAGGAAGAGTCTGAGGACGG - Intronic
1083477061 11:62921546-62921568 GAGGAGAAAGGACATGAGGAAGG + Exonic
1084848046 11:71916263-71916285 AAAGAGAAACAAAATCAGGGGGG + Intronic
1084938859 11:72601663-72601685 CAGGAGACACAAGAAGAGGAAGG + Intronic
1085079576 11:73623032-73623054 AAGGACAAAAAATATTATGATGG + Intergenic
1085235165 11:75008994-75009016 AAAGAGAAAAAACATGAGGCAGG - Exonic
1085909999 11:80812041-80812063 AAGGAGAAAAAAAAAGAGAAAGG - Intergenic
1086013036 11:82128681-82128703 AAAGAGAAAAAATTTGTGGAAGG - Intergenic
1086158685 11:83696231-83696253 AGGGAGAACTAATATTAGGAAGG + Intronic
1086475729 11:87171078-87171100 TAGGAGAAACAATATGAAAAGGG + Intronic
1086608065 11:88721062-88721084 AAGGAGAATAAATTTCAGGAAGG - Intronic
1087124719 11:94613632-94613654 AAGGAGAAAAAATAAAAGGATGG - Intronic
1087261564 11:96017998-96018020 ACGGAGAAAGAAGATGAGTAAGG + Intronic
1087526061 11:99314746-99314768 GAGGAGAAAGAAGAAGAGGATGG + Intronic
1088030274 11:105240257-105240279 AAAGAGAAACAAGATGAGAAGGG + Intergenic
1088073947 11:105823990-105824012 AAGGAGAGACCATGTGAGGATGG + Intronic
1088205004 11:107382469-107382491 AAGGTGAAACAAGATTAGTAAGG + Intronic
1088550513 11:111008400-111008422 AATGAAAAACTACATGAGGATGG - Intergenic
1088800671 11:113303980-113304002 AAGGATATGCAATTTGAGGAAGG + Intergenic
1088883703 11:113991128-113991150 AAGAAGAAACACTAGGAGGTGGG + Intergenic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089570404 11:119404269-119404291 AAAGAAAAAGAATAAGAGGAGGG - Intergenic
1089639099 11:119835384-119835406 AAGCAGAGACAACATGGGGAGGG - Intergenic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1090162708 11:124511957-124511979 AAAGAGGAACAATATGTGGGAGG + Intergenic
1090460439 11:126887035-126887057 AAGGTGAAACCATATGAGATAGG - Intronic
1090485719 11:127110349-127110371 GTGGAGAAATAATAGGAGGAGGG - Intergenic
1090598460 11:128344546-128344568 AAAGAGAAGAATTATGAGGATGG + Intergenic
1092267695 12:6995496-6995518 ACAGAGAACCAATATGAAGAAGG - Intronic
1092306300 12:7304524-7304546 AAGGAGAAGGTATATGACGATGG + Exonic
1092432123 12:8418310-8418332 TATTAGGAACAATATGAGGAAGG - Intergenic
1092621770 12:10279707-10279729 AATAAGAAATAATATAAGGATGG - Intergenic
1093359350 12:18203771-18203793 AAGAAAAAAAAATATGAGGTTGG + Intronic
1093502818 12:19831916-19831938 AAGGAGGAACAACTAGAGGATGG - Intergenic
1093508370 12:19896595-19896617 AAGAAGAAAGAAGAGGAGGAAGG - Intergenic
1094034627 12:26054695-26054717 AAGGGAAAAAAATATTAGGAAGG + Intronic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094515690 12:31123894-31123916 AATGAGAAACAATATCAGTGGGG + Intergenic
1095205007 12:39429849-39429871 GAGGAGAAAAAAGAAGAGGAGGG + Intronic
1097900624 12:64869950-64869972 AAAGAGAAACAATACTAGGTGGG - Intronic
1097975082 12:65676822-65676844 AGGGAGAAATAATAGAAGGACGG + Intergenic
1098558205 12:71842852-71842874 AAAGAAAAAGAAAATGAGGAGGG + Intronic
1099028190 12:77491987-77492009 AAGGAGAAAAAATATGAGATAGG - Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099305415 12:80948586-80948608 AAGGAGAAACAAGAGGTAGAAGG + Intronic
1100347554 12:93747443-93747465 AAGAAGAAAAATTAAGAGGAAGG - Intronic
1101234323 12:102773311-102773333 AAGAAGGAACAAGATGGGGAAGG - Intergenic
1101690812 12:107078917-107078939 AAGGGGAAAGGCTATGAGGAAGG - Intronic
1102167815 12:110820611-110820633 AAGAAGAAAGAAGAAGAGGAGGG - Intergenic
1102635958 12:114324165-114324187 AAGGAGCCACCATATGAAGACGG - Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1103202754 12:119101959-119101981 AAGGTGAAACTATTTGATGAAGG - Intronic
1104424171 12:128660880-128660902 CCAGAGAAACAAGATGAGGAGGG + Intronic
1104715352 12:131012702-131012724 AAGGAAAAACAAGTTGAGGGAGG + Intronic
1105001990 12:132696006-132696028 GAGGAAGAACAACATGAGGAAGG - Exonic
1106729198 13:32521677-32521699 AAGTCAAAACAATATGAGGCTGG + Intronic
1106948268 13:34853344-34853366 AAGAGGAAACATTACGAGGAAGG + Intergenic
1107172427 13:37358662-37358684 AAGGAGTAAGAATACGGGGATGG + Intergenic
1108006914 13:45957743-45957765 AAGGAAAAACTATGTGAGGAAGG - Intronic
1108292348 13:48974776-48974798 AAGCAGAAAGAATAAGAGGAAGG + Intergenic
1108470832 13:50765431-50765453 AAGGAGAAAGAAGAGGAGGAAGG + Intronic
1108538629 13:51413921-51413943 AAGGAGAGACTAGATGTGGACGG - Intronic
1108698944 13:52927307-52927329 AAGGAGGAAGAAAAGGAGGAAGG - Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1110026137 13:70542066-70542088 GAGGAAATACAATATGAGGTTGG - Intergenic
1110805969 13:79754771-79754793 AAGGAGATATAATAAAAGGATGG - Intergenic
1111176998 13:84607886-84607908 GAGGTGAAAGAGTATGAGGAAGG + Intergenic
1111804773 13:93026071-93026093 AAGGAGAAACAATATTCAAAAGG + Intergenic
1112078894 13:95945347-95945369 AAGGAGAAATAATTTGAACAAGG - Intronic
1112323282 13:98426527-98426549 AGGGAGAGACAAGAGGAGGATGG + Intronic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1112788991 13:102982808-102982830 AAGGAGGAGGAAGATGAGGAGGG + Intergenic
1112804317 13:103146322-103146344 AAATAGAAACCCTATGAGGAAGG + Intergenic
1113088754 13:106595531-106595553 AAACACAAAGAATATGAGGAAGG + Intergenic
1113110248 13:106814929-106814951 AAGGATAAACAATATAATCAAGG + Intergenic
1113159584 13:107364945-107364967 AGGGAGAGAGAAAATGAGGAGGG - Intronic
1115022354 14:28697863-28697885 AAGGAGAACAGATATGAGGCGGG - Intergenic
1115235517 14:31206443-31206465 AAGGAGAAACAATTTGGAGGGGG - Intronic
1115268047 14:31522025-31522047 AACGAGTAAAAATATTAGGAAGG + Intronic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1115315254 14:32018622-32018644 CTAGAGAAACAATAGGAGGAGGG - Exonic
1115758605 14:36555319-36555341 AAGGAGAAAAACTATGTGGGAGG + Intergenic
1115795809 14:36934296-36934318 AAGGTGAAAAAATCTTAGGAAGG + Intronic
1116579665 14:46623419-46623441 AAGGAGAAAGAATGTGTGGCTGG - Intergenic
1116582281 14:46657382-46657404 AAGAAGAAAGAATATAAAGATGG - Intergenic
1117257477 14:53993369-53993391 AAGGAGACAGAATTTGAAGAAGG + Intergenic
1117541104 14:56747373-56747395 AAGGAAAAAAAAAATGAGAAAGG - Intergenic
1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG + Intronic
1118140600 14:63076824-63076846 AAGCAAAAACAATATGAAGTAGG - Intronic
1118570092 14:67186225-67186247 AAGGAGAGAGATTATGAGAAAGG + Intergenic
1118979093 14:70701676-70701698 AAGGAGGAACAAGAGGAAGAGGG + Intergenic
1119123062 14:72097826-72097848 AAGGAGCTACAATCTGAGGAAGG - Intronic
1120024467 14:79567385-79567407 AATGGGAAACAAAATGGGGAAGG + Intronic
1120320593 14:82955930-82955952 AAGGATCATCAATATGAGGAAGG + Intergenic
1120997976 14:90431097-90431119 AATGTGAAACAGTGTGAGGAAGG - Intergenic
1121037161 14:90715909-90715931 AAGGAGAAAGGAGAGGAGGAAGG - Intronic
1121808272 14:96852433-96852455 AAGGAGAAACAGTCACAGGAAGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122322240 14:100862054-100862076 AAGGAGAAAGAAGAAGAGGAAGG - Intergenic
1124552118 15:30691246-30691268 AAGGAGAAAGAATAGGGAGAAGG - Intronic
1124679123 15:31714420-31714442 AAGGAGAAAGAATAGGGAGAAGG + Intronic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1124807085 15:32895338-32895360 AAAGGGAAACAAAAAGAGGAAGG + Intronic
1125301809 15:38262683-38262705 TATGAGACACAATATGAGCATGG + Intronic
1125516830 15:40325289-40325311 AAGTAGAAACAATTTAGGGAGGG + Intergenic
1125543024 15:40482569-40482591 AAGAAGAAAACATAGGAGGAAGG - Intergenic
1125877109 15:43158933-43158955 AAGGTGGAACAATTTGAGCATGG - Intronic
1125989132 15:44088566-44088588 AAGAAGAGAAAACATGAGGAGGG - Intronic
1126063943 15:44810839-44810861 TAGGAGATAAAATATGAGGCCGG + Intergenic
1126123286 15:45272441-45272463 TTGGAGGAATAATATGAGGAAGG + Intronic
1126325851 15:47476577-47476599 AAGGAGATAGAGCATGAGGAAGG - Intronic
1126857023 15:52848469-52848491 CAGGAAAACCACTATGAGGAAGG - Intergenic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127675800 15:61237587-61237609 AATGAGTAACCATGTGAGGATGG - Intergenic
1127765731 15:62184203-62184225 AAAGAGAAAGAAAATAAGGAAGG + Intergenic
1127953145 15:63829752-63829774 AAGGAAAAATAAGATGAGCATGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128940925 15:71787032-71787054 AAGAAGACACAATATTAGAATGG + Intergenic
1129880974 15:79005813-79005835 AAAGAGAAAGGAAATGAGGAGGG - Intronic
1130032084 15:80325075-80325097 AAGGAGAAACAAGACCAAGATGG + Intergenic
1130160377 15:81393049-81393071 AAGGAGACAAAACATGTGGATGG - Intergenic
1130301847 15:82686094-82686116 AAGAAGACACAAAATCAGGAGGG + Intronic
1130735031 15:86538915-86538937 AAGGAGGAAGGAGATGAGGAAGG + Intronic
1131825220 15:96316026-96316048 AAGGAGAGACAATTAGAAGAGGG + Intergenic
1132534152 16:468813-468835 AAGGAAAACTAATATGAGAATGG + Intronic
1133690981 16:8214798-8214820 AAGGAGAGACAAAAGGAGTAAGG + Intergenic
1134015668 16:10886435-10886457 CAGGAGAACCCATCTGAGGATGG - Intronic
1134423328 16:14114797-14114819 AAGGTGTAACAATATTATGATGG - Intronic
1134610268 16:15602637-15602659 GAGGAGAAAGAAAAGGAGGAGGG + Intronic
1135892631 16:26371420-26371442 AAGGAAAGATAAAATGAGGAGGG + Intergenic
1137805654 16:51302960-51302982 AAGGAGAAACAATTTGCTGATGG + Intergenic
1137972638 16:53001084-53001106 AAGGAGGAAAAATATGTGGTAGG + Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1141337992 16:83175490-83175512 CAGGAGAAACTGTATGGGGATGG + Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1203142019 16_KI270728v1_random:1772884-1772906 TAGGATAAGAAATATGAGGACGG - Intergenic
1142923093 17:3208223-3208245 AAGGAGAAACATTATCAGAAGGG - Intergenic
1143647316 17:8239109-8239131 AAGGAAAAAGAAAATAAGGATGG + Intronic
1143811104 17:9472501-9472523 GAGGAGAAACAGTATGACTAGGG + Intronic
1144172583 17:12672939-12672961 AAGGAGATACAAGTTGAGAAGGG - Intronic
1144225547 17:13141538-13141560 AAGGAGAAAAATTAGGAGGAAGG - Intergenic
1144664475 17:17092548-17092570 AAGGAGAAAGAAAAGGATGAGGG - Intronic
1145940702 17:28742010-28742032 GAGGAGAAGCAATATCAGGGTGG - Exonic
1146110003 17:30080728-30080750 GAGGAAAAAGAGTATGAGGATGG - Intronic
1146644198 17:34565907-34565929 GAGGAGAAACAAGATAAGGAAGG + Intergenic
1146753222 17:35401119-35401141 AAAGAGAAAATATATAAGGATGG - Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148756993 17:49978433-49978455 AAAGAGAAACACTATGGGGTCGG - Intergenic
1148807081 17:50269357-50269379 AAGCAGAAAGAGTAAGAGGAGGG + Intergenic
1149296847 17:55268554-55268576 AAGGAAAAAAAATGTGAGTAGGG + Intronic
1149304315 17:55333696-55333718 AAGTACAAACAATATTAAGATGG - Intergenic
1149403105 17:56319085-56319107 AAGGAGGAAGAAGAGGAGGAGGG + Intronic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150547956 17:66181672-66181694 AAGAAGATAAAATATGGGGATGG + Intronic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1152552546 17:81036889-81036911 AAGGAGAAAAAATAGGAAAAAGG - Intronic
1153106704 18:1536423-1536445 TAGGAGAAAGAAAGTGAGGAAGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157124470 18:44942935-44942957 AGGGTGACAGAATATGAGGATGG + Intronic
1157150417 18:45211616-45211638 AAGGAGAAAAAAGCAGAGGAGGG - Intergenic
1157866776 18:51194873-51194895 GTGGAGGAACAATGTGAGGAGGG - Intronic
1158305787 18:56103814-56103836 AAGGAAGGAAAATATGAGGAAGG + Intergenic
1158375604 18:56859801-56859823 AAGTAGAAGCCATATGAAGAAGG - Intronic
1158580170 18:58673841-58673863 AAGGAGTAATGATGTGAGGAGGG + Intronic
1159117964 18:64136709-64136731 CAGAAGAGACAATATGAAGAAGG + Intergenic
1159122747 18:64189945-64189967 AAGGAGAAAAATTATGAGGGGGG - Intergenic
1159710947 18:71758834-71758856 ATAGGGAAACAATATAAGGAGGG - Intronic
1160025685 18:75213572-75213594 AAGGACAAACAAAATGCTGAGGG + Intronic
1160147158 18:76375235-76375257 AAGGAGAAAGGAAATGCGGAAGG + Intronic
1160389018 18:78516300-78516322 AAGGGAAAACAATATCTGGAAGG - Intergenic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1163240897 19:16063001-16063023 AAGGAGATACAAGTAGAGGATGG - Intergenic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163591807 19:18198053-18198075 AACGAGACACAATTTTAGGAAGG - Intronic
1163953653 19:20613959-20613981 AAGGAGAAAGAGTGTGAGAAGGG + Intronic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166145127 19:40828949-40828971 AGAGAGAGACAATGTGAGGATGG - Intronic
1166692761 19:44833578-44833600 AAGGAGGAAGAAAAGGAGGAAGG + Intergenic
1167686403 19:50959600-50959622 AAAGAGAAACAATTTAAGAATGG + Intronic
1168205441 19:54847241-54847263 AAGGAGAAAGAAGAGGAGGATGG - Intronic
925446248 2:3929395-3929417 AAGGAGAAAGAATAACGGGAAGG - Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925799404 2:7583262-7583284 CAGGAGAAAGAATGGGAGGAAGG + Intergenic
926361610 2:12093171-12093193 AAGGAGAAACAATTCCAGGGGGG - Intergenic
926402425 2:12511689-12511711 AAGGACAAACATTAGGGGGAAGG - Intergenic
926412434 2:12618115-12618137 CAGGAGAAACCACATGGGGAGGG + Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
926881080 2:17543819-17543841 AAGGAGAAAAAACAGGAGGAAGG - Intronic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
928226531 2:29453718-29453740 AAAGAGAAAGAAAAAGAGGAAGG + Intronic
928333109 2:30372823-30372845 AAGGAGAAAATATCTAAGGATGG - Intergenic
928572759 2:32625557-32625579 AAGGAGAAAAAATAGGAAGGAGG - Intergenic
928855408 2:35797027-35797049 AAGGGGAAACTAAAAGAGGAGGG + Intergenic
929651520 2:43684394-43684416 AAAGAGAAAAAAATTGAGGATGG + Intronic
929702529 2:44176227-44176249 AAGGTGGAACAATAGGAGAAGGG + Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
931426108 2:62173101-62173123 AAGAAGAAAAAATATTAGAAAGG - Intergenic
932099416 2:68883907-68883929 AAGGAGAAAGAAAAGGAGAAAGG - Intergenic
932744460 2:74321322-74321344 CAGGAGAAAGAACCTGAGGAAGG + Intronic
932989946 2:76774608-76774630 AAGGAGGAGGAACATGAGGAAGG + Intronic
934064220 2:88325052-88325074 AAGCAGAATCAACATGAGAAAGG + Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
934903250 2:98177559-98177581 AAGGAGAAAAAAAAAAAGGAGGG - Intronic
936769995 2:115900746-115900768 AAAGAGAAAAAATAAGAGAAGGG - Intergenic
938971255 2:136435029-136435051 AAGGAGAGACAAATTAAGGATGG - Intergenic
939111027 2:138007700-138007722 AATGTGAAACAAGATGAGAAAGG - Intronic
939619443 2:144400136-144400158 AATGAGAAACAATATCAAGACGG - Exonic
941405500 2:165082855-165082877 AAGGAAAAGCAATCTGAGCAGGG - Intergenic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
943155688 2:184172257-184172279 AAGGAGAATCAATCTAAGCATGG + Intergenic
943366209 2:186969859-186969881 AAGGAGAAACAAGCTGAAGAAGG + Intergenic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
944019315 2:195082411-195082433 AAGAAGAAAAAAGAGGAGGAAGG - Intergenic
944248395 2:197556684-197556706 AAGGAAAAGCAATGTGATGATGG - Intergenic
944322598 2:198365474-198365496 AAGGAGAAAAATTATGAAGTAGG + Intronic
944390697 2:199216324-199216346 AAGGAGAACCCATGTGAAGACGG + Intergenic
944912824 2:204327072-204327094 AAGGAGGGACAAAATGAGGGAGG + Intergenic
945631876 2:212288323-212288345 AAGGAGAGAAAATATTACGAGGG + Intronic
945686686 2:212979592-212979614 AATGAGAAAAAATAAAAGGAGGG + Intergenic
945890531 2:215426014-215426036 GAGGAGAAATAAAATGTGGAAGG - Intronic
946346677 2:219116727-219116749 AAGCAGAAAGAAAATGGGGATGG + Intronic
946641622 2:221789829-221789851 AAGGAGAAATAGTTTTAGGATGG - Intergenic
946996459 2:225397887-225397909 AAGAAGAAACAAAACAAGGAAGG + Intergenic
947701185 2:232235548-232235570 CAGGAGATAAAATATGAAGAAGG - Intronic
948161958 2:235832290-235832312 AAGGAGAACAATTATTAGGAGGG - Intronic
948488305 2:238295278-238295300 AAGGAGAAAGAAGAAGAAGAAGG - Intergenic
948939212 2:241187789-241187811 GGGGAGAAACGATAGGAGGAGGG + Intergenic
1169461196 20:5797160-5797182 AAGGAAAAACAAAAGGGGGAAGG + Intronic
1169484020 20:6011535-6011557 AAGGAGAAAGATTGTGAGAATGG - Intronic
1169603989 20:7294596-7294618 AAGGAGATACAAACTGAGCAGGG - Intergenic
1169902201 20:10565034-10565056 AAGGAAAAAAAAAATTAGGAGGG - Intronic
1170016398 20:11786860-11786882 AGGGAGAAACAATCCTAGGATGG - Intergenic
1171007215 20:21478333-21478355 AAACAATAACAATATGAGGAAGG + Intergenic
1172038498 20:32027295-32027317 AAGGGCATACAGTATGAGGAAGG - Intronic
1172677863 20:36687341-36687363 AAGGAGAGAAAATATGAGGATGG + Intronic
1172953021 20:38734137-38734159 AAGGAGGAAGAAGAGGAGGAGGG - Intergenic
1172957649 20:38772526-38772548 AAGGGGAAAAAATAGGAGGAGGG - Intergenic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1175494904 20:59407180-59407202 AAGGAAAAACAATAAAAGAAGGG + Intergenic
1175620123 20:60436746-60436768 AAGGAGAAACAAAATCTGAATGG - Intergenic
1176065875 20:63194458-63194480 AAGGAAACACAAAATGAGAACGG - Intergenic
1177144897 21:17396944-17396966 AAGGAGATTCAACATGAGAAAGG + Intergenic
1178100824 21:29266779-29266801 AAGGAGATAGCATCTGAGGAAGG - Intronic
1178637722 21:34319578-34319600 AAGGAGAATGGATATGGGGAAGG + Intergenic
1178742895 21:35219666-35219688 AAGAGGAAACAATAAAAGGAAGG + Intronic
1179186194 21:39086945-39086967 AAGGAGAAATGAAATGAGAAGGG + Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179671821 21:42954679-42954701 TATGAGGAACAATATCAGGAAGG - Intergenic
1183129425 22:35819801-35819823 ACAGAGAAAAAATAAGAGGAGGG + Intronic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1184339173 22:43876521-43876543 AAGGAGAAATGATTTCAGGACGG - Intergenic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184670986 22:46012278-46012300 AAGGAGAAAGGAGATAAGGATGG + Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949233950 3:1786186-1786208 TAGGAGAAAAAGTAAGAGGATGG + Intergenic
949268149 3:2184599-2184621 CAGGTGAAACAATATTATGAGGG + Intronic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949710246 3:6862885-6862907 ACGGAGAAAAAATGGGAGGAAGG + Intronic
950323683 3:12083519-12083541 AAGGAGAAACTTTGGGAGGAAGG - Intronic
951055036 3:18137662-18137684 ATGCAGAAAAAATATGGGGAGGG - Intronic
952504120 3:33992175-33992197 AAAGAGGAACAACATCAGGAGGG - Intergenic
952593294 3:34983973-34983995 TAGAAGAAACAATCTGTGGAAGG + Intergenic
952720515 3:36527585-36527607 AAAGACAAAAAATGTGAGGATGG + Intronic
953215701 3:40915764-40915786 AAGGCTAAACAATGTGAGTAAGG - Intergenic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
954112937 3:48445900-48445922 AAGGAGCAGCAATTTGAGGTGGG - Intergenic
955532742 3:59891236-59891258 AAGGACACAAAATATGAGGAAGG + Intronic
955897742 3:63718500-63718522 AAGGATAAAGAATATTAGCAAGG - Intergenic
956319333 3:67978940-67978962 ATGGAGAAACAAGAAGAGAATGG - Intergenic
957127206 3:76177219-76177241 AAGGAGAAACATTTTTTGGAAGG + Intronic
957156751 3:76553237-76553259 AAGGAGCAACATTTTAAGGATGG + Intronic
957162900 3:76633509-76633531 AAGGAGAAAGAAGATGAGAAAGG + Intronic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957864778 3:86007367-86007389 AAGAAGAAACAATATGACACTGG + Intronic
958470841 3:94516809-94516831 AAGGAGAAAAAATTTTGGGAAGG + Intergenic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960537482 3:118829157-118829179 AAGAAGAAACAAAAAGAGGGAGG + Intergenic
960767502 3:121151709-121151731 AGGGAAAAAAAATAAGAGGAAGG - Intronic
960858847 3:122131031-122131053 AAGGAGGAAGAAGAGGAGGAAGG - Intergenic
961130581 3:124463040-124463062 AATGTGAAATAAAATGAGGATGG - Intronic
961221922 3:125207930-125207952 AAGGAGATGCCATATGTGGAAGG - Intronic
961272502 3:125699635-125699657 TATGAGGAACAATATCAGGAAGG + Intergenic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961515681 3:127433004-127433026 AAGCAGTAACAAGAGGAGGATGG + Intergenic
961777898 3:129302946-129302968 ACGGAGAAACAATATGGTCAAGG - Intronic
961917093 3:130387710-130387732 AGGGAGAAACTGTAAGAGGATGG + Intronic
962081892 3:132148806-132148828 AAGAAGAAACCATCTGAAGAGGG + Intronic
962188244 3:133282665-133282687 AAGGAGAAATAAAATTATGATGG - Intronic
962280666 3:134049425-134049447 AAGTAGAGACAATTTTAGGAAGG - Intronic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
963517752 3:146329640-146329662 AAGGAGAAGCAATAGTATGAAGG + Intergenic
963545328 3:146650399-146650421 GAAGAGAAACAATTTAAGGATGG - Intergenic
964037877 3:152220716-152220738 AAGGAGGAACAATAAAAAGAAGG + Intergenic
964117161 3:153148347-153148369 AAGGAGAAATAAAAGGAGAATGG - Intergenic
964646692 3:158966038-158966060 GAGGAGAAACCACATGAAGACGG - Intronic
964858129 3:161169861-161169883 AAGGAAGAAGAATATGAAGATGG + Intronic
964951605 3:162302055-162302077 AAGGAGCTACAATAAGACGAAGG + Intergenic
964982742 3:162706172-162706194 AAGGAGAAATAAAATAATGAAGG - Intergenic
966053125 3:175646795-175646817 AAGGGGAAACTATATAAGAAAGG - Intronic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966266225 3:178047721-178047743 AAGGAGAAAGGAAAGGAGGAAGG + Intergenic
966406518 3:179604322-179604344 AGGCAGCAACAAAATGAGGAAGG + Intronic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
967605547 3:191441107-191441129 AAAAAGAAACAATATGTAGAGGG - Intergenic
968138311 3:196235388-196235410 GAAGAGAAAAAATATGAGGGAGG - Exonic
968625190 4:1623840-1623862 GAGGAGAAAAAAGTTGAGGAGGG + Intronic
969246618 4:5938526-5938548 AATAAGAAACAATATTAGGGTGG + Intronic
970360139 4:15301034-15301056 TAGGACACACAGTATGAGGAAGG + Intergenic
970385512 4:15552498-15552520 AAGGAGAAACAAATTAGGGAAGG - Intronic
970478163 4:16445729-16445751 AAGGATAGGCCATATGAGGATGG - Intergenic
971394809 4:26218087-26218109 AATGAGAAACAATGTGAAGTGGG - Intronic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971497899 4:27287420-27287442 ATGGAGAAACACTCTGTGGATGG + Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971686428 4:29775279-29775301 AAGTAGAAACAATAAGTGGTGGG - Intergenic
971810790 4:31424097-31424119 AAGAAGAAACAAGGTGTGGAAGG - Intergenic
971918574 4:32908192-32908214 AAGGAGAAACAACATGGCCAGGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
973720721 4:53720882-53720904 TAGGAGAAACCAGATAAGGATGG + Intronic
973738705 4:53898839-53898861 AAGTAGACATAGTATGAGGAGGG + Intronic
973858658 4:55039034-55039056 AAAGAGAGGCTATATGAGGAAGG - Intergenic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974692764 4:65320458-65320480 TAGGAAAAACAAAATGAGAAAGG + Exonic
974811784 4:66955308-66955330 AACGAGGAACAAGAAGAGGAAGG + Intergenic
974885680 4:67814191-67814213 CCTGAGAATCAATATGAGGATGG - Intergenic
975100673 4:70509397-70509419 AAGGAGAAGAGATCTGAGGAGGG + Intergenic
975258279 4:72265828-72265850 AAGGAGAAACCATGACAGGAAGG - Intergenic
975440409 4:74404016-74404038 AAAGAGTAACAATATAAGTAGGG + Intergenic
975543702 4:75539810-75539832 AAAGAAAAACAGTATGTGGATGG - Intronic
975560738 4:75706055-75706077 AAGGAGTGACACTATGAGGTTGG + Intronic
975921965 4:79401915-79401937 AAAGAGAAACAAGGTGAGGAAGG - Intergenic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
976662249 4:87551768-87551790 AAGGAGAAAAAATTTGGGCAGGG - Intergenic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979063751 4:116100279-116100301 AAGGAGAATCAATTAGAGAAAGG + Intergenic
980710341 4:136557996-136558018 AAGAAAAAACATTGTGAGGAAGG + Intergenic
981585955 4:146302601-146302623 AATGAGAAACAAGTTGAGGTGGG + Intronic
981617968 4:146662660-146662682 AAGGAGAAAGAAGAGAAGGAAGG - Intergenic
981876694 4:149555104-149555126 AAGGAGAAAGGAGAAGAGGAGGG - Intergenic
982072531 4:151707938-151707960 AGAGAGAAACAATAGGAAGAAGG + Intronic
982192610 4:152873648-152873670 AAGGTGAAAGAATATTAAGAAGG - Intronic
983203160 4:164884205-164884227 AAGAAGAAAGAAAAAGAGGAAGG + Intronic
983307935 4:166017678-166017700 AAAGAGAAAGAACAAGAGGAAGG - Intronic
984094027 4:175411846-175411868 AAAAAAAAACAATATGAGGAGGG - Intergenic
985236861 4:187884635-187884657 AAGGAAAAAAAGTATGTGGATGG - Intergenic
986095582 5:4550561-4550583 ACAGAGAAACAGTATTAGGAGGG + Intergenic
986492142 5:8304215-8304237 AAGGAGAAACAAGGTTAGCAAGG - Intergenic
987135344 5:14894727-14894749 AAAGAGAGACAATAAAAGGATGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988166216 5:27593016-27593038 TAGGGGCAAAAATATGAGGAAGG - Intergenic
988424850 5:31052018-31052040 AAGGAGAAAAAGTGTGAGGTGGG - Intergenic
988432306 5:31133550-31133572 AAGGAGAAAGTGTATGAGAAAGG - Intergenic
988836072 5:35033559-35033581 GAGAAGAAACAACAGGAGGATGG + Intronic
988839179 5:35066562-35066584 AAGGGGAAATAAGAAGAGGAAGG - Intronic
989202971 5:38784057-38784079 AAGAGAAAACAATTTGAGGAAGG + Intergenic
989677829 5:43992959-43992981 AGGGAGAAACACTATGAGTTGGG + Intergenic
989756209 5:44958726-44958748 GAGGAGGAACAAGAAGAGGAAGG - Intergenic
990218350 5:53559765-53559787 AAATAGGAACAATAGGAGGATGG - Intergenic
991513071 5:67401547-67401569 AAGGAAAAAAAATATGAAGATGG - Intergenic
991995988 5:72387240-72387262 AATGAGAAACAAAATGAACATGG + Intergenic
992007375 5:72491096-72491118 AAGGAGAAACTATATGGGGTAGG + Intronic
992144163 5:73828623-73828645 AAGGAGAAACAAAAGGAAAAAGG - Intronic
992270846 5:75061485-75061507 AAGCAGAAACAAAATGGGGGAGG - Intergenic
992507375 5:77400511-77400533 AAAGAAAAACAAGATGGGGAGGG - Intronic
992829406 5:80579832-80579854 AAGGAGAAAGCATATGCAGAAGG - Intergenic
993061202 5:83041217-83041239 AATGAGAAACAACATGTGGATGG - Intergenic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993560092 5:89396030-89396052 AAGGAGAAAGAATATGTTTAGGG - Intergenic
993594684 5:89838574-89838596 CAGGAGAAACAAAGTTAGGATGG + Intergenic
993596914 5:89868897-89868919 AAGGAGAGAGATTATGGGGAGGG + Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
994073142 5:95622991-95623013 AAGGAGGAACAAAGAGAGGAAGG - Intergenic
995545640 5:113227657-113227679 TAGAACAAACAATATGGGGATGG + Intronic
996119909 5:119659761-119659783 AATAAGAAACAATATGAAGAAGG + Intergenic
996397512 5:123027915-123027937 AATGAGAAACAATAAGCTGAAGG + Intronic
996425388 5:123308097-123308119 GAGGAGAGGTAATATGAGGAAGG - Intergenic
996771063 5:127086225-127086247 AAGATGAAACAATATTAGGGTGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997251720 5:132393733-132393755 TGGGAGAAACAAGGTGAGGATGG - Exonic
997318992 5:132962999-132963021 AAGGAGAAACACTAAACGGATGG + Intronic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
998157455 5:139795125-139795147 AAGGAGAAAGAACCTGAGGGAGG - Intergenic
998186559 5:139984422-139984444 AAGGAGAAAAAATATATGCATGG + Intronic
998191849 5:140031964-140031986 AAGGAGAAACATTAGGAGAAAGG + Intronic
998619993 5:143783110-143783132 AAGGTGATGCAATTTGAGGAGGG + Intergenic
999137293 5:149330632-149330654 AACCAGAATCAATAGGAGGAAGG + Intronic
999643412 5:153694907-153694929 AAGGAGGAAGAATAGGAGGAAGG + Intronic
999652214 5:153778584-153778606 AAGGAGGGAAATTATGAGGAAGG + Intronic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000651624 5:163825226-163825248 AAGGAAAAACAATAGGGGTAAGG - Intergenic
1001144880 5:169175141-169175163 AAGAAGGAACAAAATGAAGAAGG + Intronic
1002831722 6:827785-827807 AAGGAGAAATAAAATGAAGAAGG - Intergenic
1003881945 6:10487184-10487206 AAGCAGAAACAAAACGAGGGAGG + Intergenic
1003989279 6:11469859-11469881 AAGGAGCAAAAACATGAGCATGG + Intergenic
1004109926 6:12707730-12707752 AATGAGACACAATGTGAAGATGG + Intergenic
1004526014 6:16408492-16408514 AATGAGGAACATGATGAGGATGG + Intronic
1004813125 6:19281692-19281714 AAGGAGAAAAAAAATGGGGTGGG + Intergenic
1005141701 6:22639306-22639328 AAGCAGAAGCAATGTGATGAGGG - Intergenic
1006119261 6:31794412-31794434 AAAGAGAAATGAAATGAGGAAGG - Intronic
1006227510 6:32552678-32552700 AAGGACAAAAAATAAGAGAAAGG - Intergenic
1006560421 6:34906706-34906728 AAGGAGAAACAATATTTATATGG + Intronic
1007581969 6:42965205-42965227 AAGGAGGCACAAAATGAGGGTGG + Intronic
1007919070 6:45589720-45589742 AAGGAGTATCATTATAAGGAGGG - Intronic
1008256034 6:49301168-49301190 AAAGATAAACAACATGAGGAAGG - Intergenic
1008270688 6:49485818-49485840 AAGAAGATACCATATGAGTATGG + Intronic
1008953867 6:57192527-57192549 AAGGAAAAACTACATGAAGAAGG + Intronic
1009745975 6:67816391-67816413 GTGGAGAAAGAATATGATGAGGG - Intergenic
1009827668 6:68887966-68887988 AAGGAGCACCAATATGAGAAGGG - Intronic
1009860066 6:69317312-69317334 AAGGAGAAAGGAGAGGAGGAGGG + Intronic
1009885832 6:69622851-69622873 AAGGAAAAACAATGTGAAGGAGG - Intergenic
1010191941 6:73204646-73204668 AATGAGAAACAATAGGAGCTTGG - Intergenic
1010388929 6:75313990-75314012 AAAGAGAAATAACAAGAGGAAGG - Exonic
1010698697 6:79012726-79012748 AAAGAGAAACAATTCGAGGGAGG - Intronic
1011360337 6:86517356-86517378 AAGGGGATGCATTATGAGGAGGG - Intergenic
1012111312 6:95238484-95238506 AAGTAGAGACAATAGGAGGTTGG + Intergenic
1012291619 6:97462704-97462726 AAGGAGCAAAAATATGCTGATGG + Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1014075264 6:117228183-117228205 ACAGAGAAACAAAGTGAGGAGGG - Intergenic
1014150148 6:118044914-118044936 AATTAGAAACAATAGGAGAAAGG + Intronic
1014271073 6:119336602-119336624 CAGGAGAAACAATATGAAATTGG + Intronic
1014758805 6:125331841-125331863 AAGAAGAAAGAAAAGGAGGAGGG - Intergenic
1014894787 6:126888703-126888725 TAGAAGATACAACATGAGGAAGG - Intergenic
1015503434 6:133956562-133956584 AGGGACATACAATATGATGATGG - Intronic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1016722438 6:147317467-147317489 TAGTAGACACAACATGAGGAAGG + Intronic
1017297216 6:152811983-152812005 AAAGAGAAAGAAGAGGAGGAAGG - Intergenic
1017507899 6:155085262-155085284 AAGAAGATACAATTTGAAGAAGG + Intronic
1017604789 6:156122439-156122461 AAGGATAAACTATAGGATGATGG - Intergenic
1018655902 6:166035541-166035563 AAGGAGAAACAATGTTATGGGGG - Intergenic
1018844739 6:167547618-167547640 AAGGAGTGACAAGGTGAGGAGGG - Intergenic
1019060874 6:169256558-169256580 AAGAATAAAGAATATGAAGACGG + Intergenic
1020915081 7:14183506-14183528 AAGGAGAAACTGTATGGGGAAGG + Intronic
1021868878 7:24983866-24983888 AAGGAGGAAGAAGATGAGTAGGG - Intergenic
1022203527 7:28140434-28140456 AAGGTGTCAAAATATGAGGAAGG + Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023502462 7:40865149-40865171 AAGGAGAAAAGAGAGGAGGAGGG - Intergenic
1023795178 7:43786475-43786497 AAGGAGACAGAAAATCAGGAAGG + Intronic
1024820238 7:53320223-53320245 GAGGAGAAACAAAGTGAAGAAGG - Intergenic
1024823333 7:53360118-53360140 AAAGAGAAATAATCTGAGGAGGG - Intergenic
1026210467 7:68299489-68299511 AAAGAGAAAGAATAAGAGCAAGG - Intergenic
1027671564 7:81105719-81105741 AAGAGGAAACATTATGAGTAAGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1027959230 7:84922101-84922123 AAGGATAAACAATAATAGAAAGG + Intergenic
1027960256 7:84937223-84937245 AAGAAGAAGCAATAGGAAGAAGG + Intergenic
1028085379 7:86630160-86630182 AAGGCGGAACAAAATGAGGCAGG - Intergenic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028696374 7:93717712-93717734 AAAGAGAAAGAAAAGGAGGAAGG + Intronic
1028727812 7:94109221-94109243 AAGGAGGAAGAAGAGGAGGAGGG + Intergenic
1028925772 7:96355598-96355620 AAGAAGCAACATTATAAGGAAGG - Intergenic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030177110 7:106665948-106665970 GAGGAGAAAAAATATGAGGCTGG + Intergenic
1030556713 7:111034155-111034177 AAGTAGTTACAAAATGAGGAGGG + Intronic
1030607812 7:111656896-111656918 AAGGAGAATGAAAATGAGCAGGG + Intergenic
1030897696 7:115082250-115082272 TAGGAGAAACAAAAAGAGAATGG + Intergenic
1031023674 7:116656277-116656299 TAGGAAAAACAACCTGAGGATGG - Intergenic
1031334020 7:120503537-120503559 AATGAAAAATAATATGAGGGAGG - Intronic
1031366385 7:120905239-120905261 AGGGAGAATCAATATGAAAATGG + Intergenic
1031666929 7:124496103-124496125 AGGGAGAATCAATATGAAAATGG - Intergenic
1031995269 7:128226491-128226513 AAGGATGGACAATAGGAGGATGG - Intergenic
1031995274 7:128226514-128226536 AAGGATGGACAATAGGAGGATGG - Intergenic
1032325846 7:130927478-130927500 AATTAGAAACAACGTGAGGATGG - Intergenic
1032378839 7:131454222-131454244 AAGGAGAAAAAATCTGAAGACGG + Intronic
1033537933 7:142329026-142329048 AGGGAGAGACAACATGAGGGTGG - Intergenic
1033537951 7:142329091-142329113 CAGGAGAGACAACATGAGGGTGG - Intergenic
1034152150 7:148925475-148925497 GAGGAGAGGCAACATGAGGACGG + Intergenic
1034215621 7:149403530-149403552 AAGGAGAAACAAAAAAAAGAAGG - Intergenic
1034393345 7:150802033-150802055 AAGGAGAAAGAAGAAGAGGCAGG - Intronic
1037645669 8:20790623-20790645 AGGGAGAAATAATATGAAGGAGG - Intergenic
1037703362 8:21295417-21295439 AAGGAGAAAAATGATGAGTAGGG - Intergenic
1038205559 8:25461376-25461398 AAGGAAATACTATATGAGAATGG + Intronic
1038318035 8:26503924-26503946 AAGGAGAAGCAATTTCAAGAAGG + Intronic
1039184660 8:34903734-34903756 ACAGAGAAACAATGTGAGGGTGG - Intergenic
1039194824 8:35019384-35019406 AAGGAGTGACAATATCAGGCAGG + Intergenic
1039320151 8:36420725-36420747 AAGGAGAAAGAACATGGGCAGGG - Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039942797 8:42105592-42105614 AGGGAGATACAAAATGAGAAGGG + Intergenic
1040663973 8:49608943-49608965 AAGGAGGAACAAAATAAGAAAGG - Intergenic
1041870942 8:62633808-62633830 AGGGGGAAAGAATATGAAGAAGG + Intronic
1042999940 8:74745689-74745711 AAGGAAAAGCACTATGTGGATGG + Intronic
1043196963 8:77307336-77307358 AAGGAGAATCAAAAAGAGAATGG + Intergenic
1043432478 8:80208321-80208343 AGGGAGAAACAATGTGCTGAAGG - Intronic
1044152432 8:88798034-88798056 AAGAAGAAAGAAAAAGAGGAAGG - Intergenic
1044313392 8:90722192-90722214 AAGGAGAATCAATGTGAAAAGGG + Intronic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1045803265 8:106126573-106126595 AAGTAGAAACAAAATTTGGAGGG + Intergenic
1046332272 8:112734225-112734247 AAAGAGAAAGAAGAGGAGGAAGG + Intronic
1046476362 8:114749868-114749890 AAGAAAAAAAAATAGGAGGAGGG - Intergenic
1046512610 8:115218450-115218472 AAACAGGAACCATATGAGGAAGG + Intergenic
1047360186 8:124162065-124162087 ACGGAGAGACTATATGGGGAAGG + Intergenic
1047553764 8:125906759-125906781 AAGAAGAAAAAATATTATGAAGG - Intergenic
1047599855 8:126415042-126415064 AAGGGGAAACATTCTCAGGAAGG + Intergenic
1047791842 8:128211235-128211257 AGGGAGAAACTATATGAAGCTGG + Intergenic
1047919786 8:129622982-129623004 AAGGAGAAAGAACATGAGACTGG + Intergenic
1048079187 8:131106447-131106469 ATGGAGAAGCAATAAGAGAAGGG - Intergenic
1048596101 8:135868050-135868072 AGGAAGAAACAATATGATGTTGG - Intergenic
1049730820 8:144177430-144177452 GAGGAGAAACAATAGTAGGAAGG - Intronic
1049913842 9:297114-297136 AAGGAGAAAGAAGATGTGAAAGG + Intronic
1050350152 9:4733723-4733745 GAGGAGAAATAAGATGAGGCTGG - Intronic
1050705575 9:8392870-8392892 AAGGAGAAAAAATTTTAGAAAGG + Intronic
1050775692 9:9257356-9257378 TATGAGACACAATTTGAGGATGG + Intronic
1050899178 9:10923566-10923588 AAGCAGAAGAAATATGAGAAAGG - Intergenic
1051102098 9:13533427-13533449 AAAGAGAAAAAATATGTGTATGG - Intergenic
1051375163 9:16394982-16395004 AAAGAGAGACAATATAAAGAGGG - Intergenic
1051527232 9:18059185-18059207 GAGGAGAGACAATGTGATGAGGG - Intergenic
1052169010 9:25370893-25370915 AAAGAGAAACAATAAGCAGAGGG + Intergenic
1052334580 9:27306602-27306624 AGGGAGATAGAATATGAGGCTGG - Intergenic
1052950287 9:34203787-34203809 AAGGAAAAACAATATAAGGATGG - Intronic
1053421116 9:37979258-37979280 AAGCAGAAACATTAACAGGATGG + Intronic
1055100901 9:72464388-72464410 AAGGATAAACAATATGAATGTGG - Intergenic
1056600396 9:88042545-88042567 GAGGAGAAATAATGTGAGCAGGG + Intergenic
1056918183 9:90762715-90762737 AATTAGAAACAATATCAGTAGGG - Intergenic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1057799037 9:98178596-98178618 AAGGGGAAACACTCTGAGAAAGG - Intronic
1057962219 9:99467775-99467797 AAACAGAAACAAGAAGAGGAGGG + Intergenic
1058437684 9:104978149-104978171 AAGGAGAATCAATAACAGAAGGG - Intergenic
1058593967 9:106595025-106595047 AAGTAAAAACAAAATGAAGAAGG - Intergenic
1058921374 9:109618581-109618603 AAGAAGAAATACCATGAGGATGG - Intergenic
1059571372 9:115440045-115440067 AGTGAGAAACAATATGTAGAAGG - Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1060718653 9:125958492-125958514 AAGTAGGACCAATATGTGGAAGG + Intronic
1061040980 9:128140243-128140265 AATTAGAAACAATATGAGTGGGG - Intergenic
1061689645 9:132315814-132315836 AAGGAGAAATCAAATGATGAGGG - Intronic
1186039915 X:5464380-5464402 ACAGAGAAAAAATATGAGAAAGG + Intergenic
1187167543 X:16818537-16818559 AAGGAGAAAAAAGATGGAGAAGG - Intronic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187693367 X:21894179-21894201 AAGGAGAAATAAGATTTGGATGG + Intergenic
1188412635 X:29892716-29892738 AATGGGAAACAATGTGAGGATGG + Intronic
1188539688 X:31235925-31235947 AAGGAGAAAGAATTTGGGAAGGG - Intronic
1188591002 X:31834858-31834880 AAGGAGAAAAAAAAAAAGGAAGG + Intronic
1189356917 X:40316892-40316914 CAGGAGAAAAAATCTGAGTAAGG + Intergenic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1190108148 X:47573552-47573574 GAGGAGGAAAAGTATGAGGATGG + Intronic
1190213763 X:48467191-48467213 AAGGAGAGACCATCGGAGGAGGG + Intronic
1190586110 X:51944348-51944370 AAATAAAAACAATATGAGGTCGG - Intergenic
1190746390 X:53325221-53325243 TAGAAGAAACAAGATAAGGACGG - Intergenic
1190887548 X:54542929-54542951 AAGGAGAAAAAAAAAGAGAATGG - Intronic
1193024365 X:76829287-76829309 AAGAAGAAACATTATGGGTAAGG - Intergenic
1193221403 X:78930611-78930633 GAGGAGAGAGAAAATGAGGAGGG - Intergenic
1193725954 X:85039727-85039749 AAGGAAACACAATATGAAAAAGG - Intronic
1194426677 X:93747449-93747471 AGGGAGAAAAAAGATGATGAAGG + Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1195619656 X:106940152-106940174 GAGGAGAAACAATCAAAGGAAGG - Intronic
1195758168 X:108219855-108219877 AAGGGAATACAATATGGGGAGGG - Intronic
1195811571 X:108838254-108838276 AAGAAGAAATAATAAGATGATGG - Intergenic
1195897327 X:109759845-109759867 AAGAAGAAACAATATGAGCAAGG + Intergenic
1195901234 X:109799862-109799884 AGGGAGAAACAATACCCGGATGG + Intergenic
1196028345 X:111067223-111067245 AATGAGAAACAAGATAAAGATGG - Intronic
1196370574 X:114975128-114975150 AAGGAGGAAGAAGAGGAGGAAGG + Intergenic
1196906659 X:120443733-120443755 AAAGAGAAACATTGTGAGGCAGG + Intronic
1196943269 X:120798637-120798659 AGGGAGAAGCAATGTCAGGATGG + Intergenic
1197789044 X:130232432-130232454 TAGGAGAAACTATCTGAGAAAGG + Intronic
1198179722 X:134194566-134194588 AAGGAGAAAGAAAAAGAAGAAGG - Intergenic
1198301579 X:135338926-135338948 AAGGAGGAAGAATAGCAGGAGGG - Intronic
1198460861 X:136861758-136861780 AAGTAAAAACAAAATGAGGAGGG + Intronic
1198778553 X:140208253-140208275 AAGGAGAAACCAGATCAGGTAGG + Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199059713 X:143340553-143340575 AAAGAGAAAGAAGAGGAGGAGGG + Intergenic
1199186422 X:144920822-144920844 AAGGTGAAACAATGTGAAGCAGG + Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1201461518 Y:14230648-14230670 AAGGAGAAAGAAAAGAAGGAAGG + Intergenic