ID: 905786381

View in Genome Browser
Species Human (GRCh38)
Location 1:40760991-40761013
Sequence TGCCAAGGGCAGGCTCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905786374_905786381 6 Left 905786374 1:40760962-40760984 CCCTTTACAGAATGAACTTAGAG 0: 1
1: 0
2: 0
3: 23
4: 250
Right 905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG 0: 1
1: 0
2: 2
3: 20
4: 235
905786375_905786381 5 Left 905786375 1:40760963-40760985 CCTTTACAGAATGAACTTAGAGG 0: 1
1: 0
2: 1
3: 11
4: 163
Right 905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG 0: 1
1: 0
2: 2
3: 20
4: 235
905786372_905786381 23 Left 905786372 1:40760945-40760967 CCTGCCAAAGGCTTTATCCCTTT 0: 1
1: 0
2: 1
3: 14
4: 197
Right 905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG 0: 1
1: 0
2: 2
3: 20
4: 235
905786373_905786381 19 Left 905786373 1:40760949-40760971 CCAAAGGCTTTATCCCTTTACAG 0: 1
1: 0
2: 1
3: 17
4: 141
Right 905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG 0: 1
1: 0
2: 2
3: 20
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905786381 Original CRISPR TGCCAAGGGCAGGCTCTGAT TGG Intronic
900152652 1:1185425-1185447 TGCCAAGTGGAGGATCTGAAAGG - Intronic
900267180 1:1763746-1763768 TCCCAAGGACAGGCTATGCTTGG + Intronic
900738039 1:4311622-4311644 TGCCAAGGGCAGGGTCTTTCTGG - Intergenic
903741946 1:25563525-25563547 TGCCAGGGCCGGGCTCTGCTGGG + Intronic
904382025 1:30117940-30117962 GTCCAAGGGCAAACTCTGATTGG - Intergenic
904489934 1:30852330-30852352 TGCCCAGGGCTGGCTCTGGATGG - Intergenic
904689061 1:32280216-32280238 AGCCAAGGGCAGGAACTGAAAGG + Intronic
905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906678349 1:47709018-47709040 TGGCAGGGCCAGGCTCTGAAAGG - Intergenic
906838155 1:49106541-49106563 TGCCTAGGGCAGGATCATATTGG - Intronic
907807926 1:57840113-57840135 TGCCATGGGCTTTCTCTGATAGG + Intronic
908475444 1:64483546-64483568 TACCAAGGGCAGGCTGGGCTGGG + Intronic
909081402 1:71116886-71116908 TGCCAATGGGAGGCACTGTTGGG - Intergenic
915592659 1:156879428-156879450 TAGCAAGGGCAGGCTCTCAGTGG - Intronic
916747230 1:167693929-167693951 TTCCAAGAGCAGGCCATGATGGG + Intronic
920851489 1:209631026-209631048 TGCCAAGCGCTGCCTCTGACTGG - Intronic
920875761 1:209833875-209833897 TGCCTATGGCGGGCTTTGATGGG + Intronic
921096914 1:211894737-211894759 AGCCCAAGGAAGGCTCTGATTGG + Intergenic
921497411 1:215858351-215858373 TGTCAAGGGCAGGACCTGGTGGG + Intronic
1063171399 10:3513102-3513124 TGGCTGAGGCAGGCTCTGATGGG + Intergenic
1063923188 10:10951663-10951685 ACTCAAGGGCTGGCTCTGATGGG - Intergenic
1067439848 10:46302424-46302446 TGCACAGGGCAGGCTCAGAGTGG - Intronic
1068463759 10:57360196-57360218 TGTCAAGGGCAGGTCCTGGTGGG + Intergenic
1068948470 10:62753922-62753944 TATCAAGGGCAGGATCTGGTGGG + Intergenic
1069635441 10:69922095-69922117 TGCCATAGGCAGGCCCTGATTGG + Intronic
1069726066 10:70579766-70579788 TGCCAGGGATAAGCTCTGATTGG - Intergenic
1070505903 10:77112476-77112498 TACCAAGGGAAGGCCCTGCTGGG + Intronic
1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG + Intronic
1073666093 10:105535378-105535400 AAACAAGGGCAGGCTCTGAGGGG + Intergenic
1073798902 10:107019698-107019720 TGCCAAAGGCATGCTCAGATGGG + Intronic
1073833234 10:107411013-107411035 TGTCAAGGGAAGGGTCTGGTGGG + Intergenic
1074869608 10:117566431-117566453 TGCCCTGGGGATGCTCTGATTGG + Intergenic
1076109886 10:127852132-127852154 TGCCAAGGGAATGCTGTGACGGG + Intergenic
1077044940 11:540558-540580 TGCCAAGGGCTTGCTGTGACGGG + Intronic
1077515807 11:3001499-3001521 AGCCATGGGTAGGCTCTGAGGGG - Intronic
1077917623 11:6621700-6621722 TGCCCAGGGCAGGCTCAGAGTGG + Exonic
1080877882 11:36293062-36293084 TGCCTAGGGCTGGGTGTGATGGG - Intergenic
1083482469 11:62958444-62958466 TTCCTAGAACAGGCTCTGATTGG - Intronic
1083791788 11:64990375-64990397 TGCCACGGGAAGGCCCTGTTGGG - Intronic
1084557152 11:69881987-69882009 TGGCCAGGGGCGGCTCTGATGGG - Intergenic
1084894410 11:72254981-72255003 TGCCAAGAGCAAGCTCTGTAGGG - Intergenic
1089640753 11:119845691-119845713 TGCCAAGGGCAGGCTTTGGTGGG + Intergenic
1089697755 11:120226389-120226411 CCCCCAGGGCAGGCTCTGCTGGG - Intronic
1089750545 11:120648318-120648340 TGCCCAGGGCAGCCTCTGGATGG + Intronic
1089771241 11:120804760-120804782 CCCCAAGGTCTGGCTCTGATTGG + Intronic
1090684089 11:129096441-129096463 TTCCAAGGGAAGGCTTGGATGGG + Intronic
1091214245 11:133890789-133890811 TGCCAAAGTCAGGGTCTAATAGG - Intergenic
1091222128 11:133935889-133935911 TGCCAAGGCCAGGGTCTGCATGG - Intronic
1095358218 12:41303236-41303258 TGCCGAGGGCATGGTCTGACTGG - Intronic
1097984858 12:65772250-65772272 TGCCAAATGCAGCCTCTGACTGG - Intergenic
1100611155 12:96193391-96193413 GGCTCAGGCCAGGCTCTGATGGG - Intergenic
1100633165 12:96408309-96408331 TTCCAAGGAAAGACTCTGATTGG + Intergenic
1102800396 12:115727730-115727752 TGCTAATGGAATGCTCTGATTGG - Intergenic
1104799799 12:131546877-131546899 TCCCAGGGAAAGGCTCTGATTGG - Intergenic
1106061422 13:26296508-26296530 TTCCAAGAGCAGGAACTGATGGG + Intronic
1107451835 13:40516785-40516807 TTCCAAAGGCAGGTTCTGCTTGG - Intergenic
1111607908 13:90564257-90564279 TGGCAAGAGCAGGCTCTGGCGGG - Intergenic
1113747249 13:112754001-112754023 GGTCAAGGTCAGGCTGTGATCGG - Intronic
1113891106 13:113736015-113736037 TGCCAGGCGCAGGCTCTGTTGGG + Exonic
1114406666 14:22463339-22463361 TGCCAATGGCAGGCTATAGTTGG - Intergenic
1115702524 14:35968667-35968689 TTCCAGGGGCATGCTCTAATTGG - Intergenic
1116866000 14:50032133-50032155 TTCCCAGGAGAGGCTCTGATTGG - Intergenic
1118174261 14:63422364-63422386 AACCAAGAGCAGGCTTTGATGGG - Intronic
1119936147 14:78594028-78594050 TGCCGAGGGCATGCTCTGGGTGG - Intronic
1122007946 14:98721183-98721205 GGCCAAGGTCAGACTATGATTGG + Intergenic
1122900246 14:104779448-104779470 TCCCAAGGAGAGGCCCTGATGGG + Intronic
1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG + Intergenic
1123637769 15:22375979-22376001 TGGCAAGTGCAGGAACTGATGGG - Intergenic
1124291314 15:28455964-28455986 TCCCAAGGGAAGGCGCTGGTGGG - Intergenic
1127784014 15:62340276-62340298 TGCCAAGGGCTGGCTATGGATGG - Intergenic
1128666497 15:69542081-69542103 GGCCAAGGAAATGCTCTGATGGG - Intergenic
1129360086 15:75019160-75019182 TGCCAAGAGCAGAATCTGAAAGG - Exonic
1130389715 15:83445079-83445101 TAGCAAGGGCAGCATCTGATTGG - Intergenic
1130483911 15:84387095-84387117 TGGCAAGGGCAGGGACTGAGCGG - Intergenic
1130546059 15:84858165-84858187 TTCCCAGGGGAGGCTCTGACAGG + Exonic
1130627271 15:85528358-85528380 TGCCAATGGCAAGCTTTGTTGGG + Intronic
1130869811 15:87961701-87961723 TGCCCAGGGCATGCCCAGATGGG + Intronic
1132476753 16:143131-143153 TGCCAAGGGCAGGCCCAGGCTGG - Intergenic
1132891197 16:2205657-2205679 GGCCAGCGGCAGGCCCTGATGGG - Intronic
1132929977 16:2454129-2454151 TCCCAAGGGCAGGCACTGGGTGG + Intronic
1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG + Intronic
1136013620 16:27381253-27381275 AGACAAGGACAGTCTCTGATGGG + Intergenic
1136625920 16:31462227-31462249 TGCCAAGGCCAGGCGGTGCTGGG - Exonic
1136707463 16:32201707-32201729 TCCCAAGGGAAGGCACTGGTGGG + Intergenic
1136760448 16:32727710-32727732 TCCCAAGGGAAGGCACTGGTGGG - Intergenic
1136807655 16:33142676-33142698 TCCCAAGGGAAGGCACTGGTGGG + Intergenic
1137798663 16:51242759-51242781 TGCCAAGAGCAGGCTGTGCCAGG - Intergenic
1139223889 16:65215190-65215212 ATCCCAGGGAAGGCTCTGATTGG - Intergenic
1141266876 16:82505767-82505789 AGGCAAAGGCAGGCTCTGAGCGG + Intergenic
1142312330 16:89321278-89321300 TGACAAGAGCAGGCACTGGTGGG + Intronic
1203062601 16_KI270728v1_random:988025-988047 TCCCAAGGGAAGGCACTGGTGGG - Intergenic
1143304016 17:5931928-5931950 TGCCAAGAGCAGGCTCACACAGG - Intronic
1143621699 17:8084591-8084613 TGCCAAGGGGAGGGTCTCACTGG - Intronic
1144671710 17:17136498-17136520 TCCCCAGGGCCAGCTCTGATGGG - Intronic
1146405268 17:32531164-32531186 TCCCAACGGAAGTCTCTGATTGG - Intronic
1147569172 17:41557109-41557131 TGGCAGGAGCAGGCTCTGTTCGG - Intergenic
1148161337 17:45451843-45451865 TGTGAAGGCCAGGCTCTGAGGGG - Intronic
1150138259 17:62707529-62707551 TGCAAAGGGCACAATCTGATTGG + Intronic
1151378533 17:73708569-73708591 AGCAGAGGGCAGGCTCAGATAGG - Intergenic
1151471591 17:74321747-74321769 TTCCAGGGAAAGGCTCTGATTGG + Intergenic
1151579115 17:74968267-74968289 TGGCAAGGTCAGGGACTGATGGG - Intronic
1152797539 17:82315577-82315599 TGCCTGGGGAAGGCTCTGCTGGG - Intronic
1156333144 18:36144477-36144499 TGTCAAGGGAAGGATCTGGTGGG - Intronic
1160891160 19:1379476-1379498 TGCCAGGGACAGGCTCAGGTGGG - Intergenic
1160920345 19:1516613-1516635 GTCCCAGGGCAGGCTCTCATTGG - Intergenic
1161809478 19:6463943-6463965 TGCCTAGGGCAGACTTGGATGGG - Intronic
1163457128 19:17413851-17413873 TGACAAGGGCAAACTATGATGGG - Intronic
1163675003 19:18651300-18651322 ATCCCAGGGAAGGCTCTGATTGG + Intronic
1165899565 19:39162776-39162798 TACCAAGGGCTGACTCTGCTGGG - Intronic
1166532248 19:43550053-43550075 GGGCAGGGGCAGGCTCTGTTGGG - Intronic
1166665458 19:44677236-44677258 TGGCCAGGGAAAGCTCTGATTGG + Intronic
1167416349 19:49375061-49375083 TGCTTGGGGCAGGGTCTGATGGG - Exonic
1168371057 19:55835001-55835023 TGCAACGGGCATGCTCTTATGGG + Intronic
1202648130 1_KI270706v1_random:159195-159217 GGCCTAGCGCAGGCGCTGATGGG - Intergenic
925011501 2:488885-488907 TGCCGAGGGCAGGCTAGGAACGG + Intergenic
925481801 2:4283779-4283801 TGCCAGGGGCAGGAACTGATGGG - Intergenic
927651476 2:24916094-24916116 TGCCAAGGTCAGGCTCCCCTGGG + Intronic
929086855 2:38176527-38176549 TGGCCAGAGCAGGCTCTGAGAGG + Intergenic
930673614 2:54177225-54177247 TGCCAGTGGAAGGCACTGATAGG + Intronic
930927646 2:56838659-56838681 TGCCAAGGGCGGGACCTGGTGGG - Intergenic
931652881 2:64484287-64484309 TCCCAGGGAAAGGCTCTGATTGG - Intergenic
934103306 2:88673623-88673645 TGTCAAGGGAAGGACCTGATGGG + Intergenic
934541204 2:95176509-95176531 AGCCAATGGTAGGGTCTGATTGG + Intronic
934910044 2:98243879-98243901 GGCCAAGGAGAGGTTCTGATTGG - Intronic
935807148 2:106760382-106760404 TGTCAAGGGCAGGACCTGGTAGG + Intergenic
936831171 2:116649450-116649472 TGCCAATAGAAGGCACTGATAGG + Intergenic
938489394 2:131753995-131754017 GGCCAAGCGCAGGGCCTGATGGG - Intronic
938494666 2:131787969-131787991 TGTCAAGGGCAGTCTCAGACTGG - Intergenic
942044296 2:172090489-172090511 TCCCAAGGCCAGGCCCTTATGGG + Intergenic
942084228 2:172428728-172428750 TGCAAAGTCCAGGCTCAGATCGG - Intronic
946863562 2:224022814-224022836 TGCCAAGGGCAGGACCAGGTGGG + Intronic
947587587 2:231366102-231366124 TGGCAAGCGCAGAATCTGATGGG + Intronic
947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG + Intronic
1169306271 20:4493175-4493197 AGCCAAGGGCAGGAGCTCATTGG + Intergenic
1169683804 20:8247906-8247928 TGCCTAGGGCAGGGTCTGGAAGG + Intronic
1170567486 20:17615310-17615332 TGCCAAGGGCAGGTCCCGGTGGG + Intronic
1172078059 20:32314903-32314925 AGGCAAGAGCAGGCTCTGAGTGG - Intronic
1172327649 20:34049131-34049153 TGCCAAAGCCAGGCTCTGAAGGG - Intronic
1172449205 20:35009959-35009981 TGTCAAGTGCAGGTACTGATGGG + Intronic
1173392791 20:42649846-42649868 AGCTAAGGCAAGGCTCTGATTGG - Intronic
1173952454 20:47004285-47004307 TTCCCAGGGCAGAGTCTGATTGG + Intronic
1174322317 20:49751564-49751586 TGCCAAGGTGAAGCTCTGAAGGG + Intergenic
1174375217 20:50122057-50122079 GTCCCAGGGCAGGCTCTCATTGG - Intronic
1175155165 20:56966200-56966222 ATCCCAGGGAAGGCTCTGATTGG - Intergenic
1175281136 20:57804848-57804870 TTCCAAGGGCAGAGTCTGACAGG + Intergenic
1175482017 20:59318515-59318537 TGTCAGCGGCAGGCTCTGCTGGG + Intronic
1176227342 20:64008534-64008556 TGCCAAAGGCAGGAGCTGAAAGG - Intronic
1176309906 21:5144008-5144030 TGCTAAGGGCAGGCTTGGCTGGG + Intronic
1176603720 21:8813499-8813521 GGCCTAGCGCAGGCGCTGATGGG + Intergenic
1176706579 21:10123042-10123064 GGCCCAGGGCAGGGGCTGATGGG - Intergenic
1177275671 21:18910120-18910142 TGTCAAGGGAAGGATCTGGTGGG + Intergenic
1178013835 21:28318705-28318727 TGTCAAGGGCAGGACCTGGTAGG + Intergenic
1179558015 21:42193097-42193119 TGCCAAGAGCAGGTTCTGAAAGG + Intergenic
1179847150 21:44118024-44118046 TGCTAAGGGCAGGCTTGGCTGGG - Intronic
1180346003 22:11705050-11705072 GGCCTAGCGCAGGCGCTGATGGG + Intergenic
1181581254 22:23829303-23829325 TGGCCAGGGCAGGTGCTGATGGG + Intronic
1181643084 22:24215034-24215056 TGCCACTGGGAGGCACTGATGGG + Intergenic
1183694722 22:39415281-39415303 TGCCAAGGGCCTGCTCTGATGGG + Intronic
1183736391 22:39647059-39647081 GGCCCAGCGCAGGCTCTGACAGG - Intronic
1184022458 22:41830133-41830155 GGACAAGGGCTGGCTCTGAGAGG - Intergenic
1185122805 22:48982631-48982653 TCCCATGGGCAGGCTCTGCCAGG + Intergenic
950413564 3:12855086-12855108 TGCCACTGGCAGCCTCTGCTTGG - Intronic
950897954 3:16470396-16470418 GCCCAAGGGCAGGCCCTGGTTGG + Intronic
951980716 3:28563658-28563680 TGCCAGGGGCAGGGTTTGAGGGG + Intergenic
956215083 3:66840399-66840421 TACTAAGGGCAGGCTGTGATGGG - Intergenic
956921036 3:73929746-73929768 TGCCCAGAACAGCCTCTGATTGG - Intergenic
957330546 3:78757908-78757930 AGCCAAAGACAGGCTCTGATAGG - Intronic
961042039 3:123684372-123684394 TATCAAGGGGAGGCTCTGCTAGG - Intronic
961555025 3:127691491-127691513 TGCCAGGGGGAGGCTCAGGTTGG - Exonic
964376012 3:156049867-156049889 TGCCAAAGGGAGGCACTAATAGG + Intronic
965081975 3:164045370-164045392 AGCCAAGGGCAGACTGTGGTAGG - Intergenic
965123583 3:164595344-164595366 TGGCAAGAGCAGGCTCTGTGCGG + Intergenic
967330891 3:188288218-188288240 TGCCGAAAGCAGGCTGTGATGGG + Intronic
969329937 4:6468680-6468702 TGCCCAGGGCAGGATGTGCTTGG + Intronic
969478193 4:7432999-7433021 GCCCATGGGCAGGCTCTCATGGG + Exonic
971204535 4:24551276-24551298 TGACAAGGGTAGCTTCTGATTGG - Intronic
972320027 4:37964880-37964902 TGCCAATAGCAGGCTCTGTCAGG - Intronic
973767842 4:54180171-54180193 TGACAGGGGTGGGCTCTGATTGG + Intronic
975779081 4:77820007-77820029 GGCCAAGGCCAGGCTCTGCGTGG - Intergenic
976359993 4:84166533-84166555 TCCCAAGGCCTGGTTCTGATAGG + Intergenic
979477251 4:121172472-121172494 TGCCAATGGCAGTGTCAGATGGG + Intronic
980197518 4:129609787-129609809 TGTCAATGTCAGGCTCTGTTTGG + Intergenic
987986023 5:25146927-25146949 TGCTTAGGGAAGGGTCTGATGGG + Intergenic
988083793 5:26446826-26446848 TGTCAGGGGCAGGACCTGATGGG - Intergenic
989139831 5:38191379-38191401 TGCCTAGGGAAGGCTCTTACTGG - Intergenic
997648642 5:135498592-135498614 TGCCAAGGCCTGGCTCTGCATGG - Intergenic
1000325562 5:160169433-160169455 TTCCCAAGGCAGGCTCTGGTTGG - Intergenic
1001546479 5:172573688-172573710 GTCCCAGGGAAGGCTCTGATTGG + Intergenic
1003053210 6:2797960-2797982 TGCCCTGGGCAGGCTGTGAGAGG + Intergenic
1005107071 6:22235166-22235188 TGGAAAGGGCAAACTCTGATTGG + Intergenic
1005335661 6:24793611-24793633 AGCTAAGGGCAGGCCCAGATTGG + Intergenic
1005498820 6:26412404-26412426 GGCCAATGGGAGGCCCTGATAGG - Intronic
1005885461 6:30094158-30094180 TGCCTAGGGCTGGCACTGAGAGG + Intergenic
1006306958 6:33228544-33228566 TGCCAAGGGAAGGCTATAACAGG + Intergenic
1010688112 6:78876094-78876116 TGTCAAGGGGGGGATCTGATGGG + Intronic
1010693027 6:78933114-78933136 TTCAAAGGACAGGCTCTCATTGG - Intronic
1010840276 6:80641691-80641713 TGGCACAGGCAGGCTCTGAATGG + Intergenic
1010905885 6:81487688-81487710 TGCCCAGTGCAGCCTCTGATTGG + Intergenic
1012748249 6:103122648-103122670 TGCAAAGGGAAGGCTTTTATAGG - Intergenic
1012943935 6:105446558-105446580 GGGGAAGGGCGGGCTCTGATGGG - Intergenic
1013665953 6:112348630-112348652 TGCTCAGTGCAGGCTCTTATTGG + Intronic
1014019082 6:116567156-116567178 TGCCAGGGGAAGGGTCTGGTGGG - Intergenic
1015079041 6:129201237-129201259 TGGCAAGGCCAGGCTGTGTTTGG - Intronic
1015226210 6:130860176-130860198 AGACAAGGACAAGCTCTGATGGG + Intronic
1017431431 6:154374900-154374922 TGCCAGGGGCAGGATATGCTGGG - Intronic
1019068373 6:169321717-169321739 TGCCAAGGGCAGCTTCTGGGCGG - Intergenic
1019935914 7:4257845-4257867 TCCCAAGGCAAGACTCTGATTGG + Intronic
1020007801 7:4791615-4791637 TGCCATGGAGCGGCTCTGATTGG + Exonic
1022124937 7:27347224-27347246 GGTCAAGGGCAGTCTCTGATTGG - Intergenic
1022639227 7:32165676-32165698 TGTCAAGGGAAGAATCTGATGGG - Intronic
1024219137 7:47274036-47274058 TCCCCAGGGCTGGCTCTGGTCGG + Intergenic
1024646604 7:51376172-51376194 TCCCCAGGGCAGTCTCTGAATGG - Intergenic
1024701821 7:51911897-51911919 AGCCAATGGCAGCCTCTGGTAGG - Intergenic
1025170757 7:56754437-56754459 TGCCAGGGTCAGGCTCTGCTTGG + Intergenic
1025701127 7:63821262-63821284 TGCCAGGGTCAGGCTCTGCTTGG - Intergenic
1026326652 7:69316248-69316270 TGTCAAGGGCAGGACCTGGTGGG + Intergenic
1026736702 7:72953610-72953632 GGCCAATGGAAGGCTCTGTTGGG - Intergenic
1027107032 7:75411453-75411475 GGCCAATGGAAGGCTCTGTTGGG + Intergenic
1029493849 7:100886787-100886809 TTGCGAGGGCAGGCTCTGATGGG - Exonic
1029666268 7:101997064-101997086 CCCCATGGGCAGGCCCTGATGGG - Intronic
1029706559 7:102279612-102279634 GGCCAAGGAGCGGCTCTGATGGG - Intronic
1030538839 7:110803684-110803706 AGCCAAGGGCAAGTCCTGATGGG + Intronic
1031482377 7:122294218-122294240 TTCCCAGGGCAGGTTCTAATAGG - Intergenic
1033579355 7:142717660-142717682 TGGCAAGGGCAGGCTCAGGAAGG - Intergenic
1034518739 7:151602738-151602760 TGCCAAGGGCAGGACCTGCTGGG + Intronic
1036661891 8:10714345-10714367 TGCCAAGGCCAGGGTCAGAGAGG + Intergenic
1038643720 8:29347523-29347545 TTCCAAGGGCAGGCTCCCTTTGG + Intronic
1039462710 8:37759473-37759495 TGCCAAGGGCTTGCTGTCATGGG + Intergenic
1043973529 8:86559979-86560001 TGCCAAGGCCAGGCTGAGAGGGG + Exonic
1045416314 8:101971383-101971405 TGTCAAGGGCAGGACCTGGTGGG + Intronic
1045562384 8:103277574-103277596 TGCCAATGGAAAGCACTGATGGG - Intergenic
1047954039 8:129959757-129959779 TTCCAAGGGCAGGTCCTGAATGG + Intronic
1048017728 8:130512499-130512521 TGTCAAGGGCAGGACCTGGTGGG + Intergenic
1048199217 8:132357830-132357852 TGCAAGGGGAAGGTTCTGATTGG - Intronic
1049796105 8:144497929-144497951 AGCCTAGGGCAGGCACTGAGAGG - Intronic
1053066482 9:35072674-35072696 TCCGCAGGGCAGGCGCTGATTGG - Exonic
1053270707 9:36747564-36747586 TCCCAAGGACAGACTCTGATCGG - Intergenic
1053643872 9:40110161-40110183 GGCCCAGGGCAGGGGCTGATGGG - Intergenic
1053762280 9:41355328-41355350 GGCCCAGGGCAGGGGCTGATGGG + Intergenic
1054324727 9:63707389-63707411 GGCCCAGGGCAGGGGCTGATGGG - Intergenic
1054350676 9:64015367-64015389 GGCCCAGCGCAGGGTCTGATGGG + Intergenic
1054540874 9:66266447-66266469 AGCCCAGGGCAGGGGCTGATGGG + Intergenic
1056871718 9:90288023-90288045 TGGCTGGGGCAGGCTCTGATGGG - Intergenic
1057745000 9:97744149-97744171 TGTCAAAGGCGGGATCTGATGGG + Intergenic
1058163762 9:101597199-101597221 TCCCATGAACAGGCTCTGATTGG + Intronic
1059771805 9:117433825-117433847 TTCAAAGGGCAAGCTGTGATGGG - Intergenic
1060410707 9:123398344-123398366 AGCCAATGGCAGGCTCTGAAAGG - Intronic
1060585334 9:124782081-124782103 TGCCAAGGGCAGGGTGGGCTGGG + Intronic
1061649350 9:132034431-132034453 AGCGAAGGGCAGGCTTTGTTAGG - Intronic
1061865270 9:133488892-133488914 TGCCTCGGGCAGCCTCTGACGGG - Intergenic
1061872864 9:133529973-133529995 TCCTCAGGGCAGGCTCTGATCGG + Intergenic
1188921660 X:35985474-35985496 TGGCAGGGGAAGGCTGTGATGGG + Intronic
1190426926 X:50342218-50342240 TGCCAAGTACAGGGTCTCATGGG - Exonic
1190464094 X:50708517-50708539 TGCTAAGGGGAGGCCCTGTTGGG + Intronic
1192554437 X:72078643-72078665 TGCCAAGGTCACCCTCTGAGTGG + Intergenic
1195986431 X:110635712-110635734 TGTCAAGGGCAGGACCTGGTGGG - Intergenic
1201152609 Y:11102193-11102215 TGCCCAGCGCAGGGGCTGATGGG + Intergenic