ID: 905789664

View in Genome Browser
Species Human (GRCh38)
Location 1:40783528-40783550
Sequence CCCCGAAGGCCAGCCCGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905789664_905789676 22 Left 905789664 1:40783528-40783550 CCACCCCGGGCTGGCCTTCGGGG 0: 1
1: 0
2: 0
3: 22
4: 191
Right 905789676 1:40783573-40783595 GGACACCACTTGCACGCGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 26
905789664_905789678 30 Left 905789664 1:40783528-40783550 CCACCCCGGGCTGGCCTTCGGGG 0: 1
1: 0
2: 0
3: 22
4: 191
Right 905789678 1:40783581-40783603 CTTGCACGCGTCCGGCTTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 34
905789664_905789670 -2 Left 905789664 1:40783528-40783550 CCACCCCGGGCTGGCCTTCGGGG 0: 1
1: 0
2: 0
3: 22
4: 191
Right 905789670 1:40783549-40783571 GGCCACACTGCCCCACGCAGCGG 0: 1
1: 0
2: 1
3: 22
4: 193
905789664_905789672 1 Left 905789664 1:40783528-40783550 CCACCCCGGGCTGGCCTTCGGGG 0: 1
1: 0
2: 0
3: 22
4: 191
Right 905789672 1:40783552-40783574 CACACTGCCCCACGCAGCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905789664 Original CRISPR CCCCGAAGGCCAGCCCGGGG TGG (reversed) Intergenic
900117339 1:1034239-1034261 CGCTGGCGGCCAGCCCGGGGAGG + Intronic
900360082 1:2284163-2284185 CCCCAGAGGCCGGCCCTGGGGGG + Intronic
901642931 1:10702189-10702211 CCCCGCAGGCCAGCCCTGGCGGG + Intronic
902098274 1:13964602-13964624 CCACGAAAGCAAGCCTGGGGTGG - Intergenic
902916682 1:19644095-19644117 CGCCGAAGCTCAGCCCGGGGCGG + Intronic
903678941 1:25084121-25084143 GCCCGCAGGCCAGGCGGGGGTGG + Intergenic
903740495 1:25555956-25555978 CCCGGAAGGCCTCCCAGGGGAGG + Intronic
905028252 1:34865697-34865719 CCACGAAGCCCAGCCCCGCGGGG + Exonic
905789664 1:40783528-40783550 CCCCGAAGGCCAGCCCGGGGTGG - Intergenic
906284091 1:44574745-44574767 CCCTGACCTCCAGCCCGGGGTGG + Intronic
908951689 1:69568723-69568745 CCCCAGAGGCCGGCCGGGGGCGG + Intronic
912561630 1:110555534-110555556 CCCAGAAGCCCAGCCCTCGGAGG - Intergenic
912576383 1:110675365-110675387 CCCCTAGGTACAGCCCGGGGAGG + Intergenic
922729323 1:227941731-227941753 CCCAGAAGGCCAGCCACGAGTGG - Intronic
922857465 1:228787309-228787331 CCCCGAAGGCCAGGGGGGAGAGG + Intergenic
1066591343 10:36998048-36998070 CAGCTAAGGCCAGCCAGGGGTGG + Intergenic
1072578526 10:96720751-96720773 CACCAAAGGGCAGCCCGAGGTGG + Intergenic
1072618314 10:97064028-97064050 CCCCAGAGGCCAGCCCAGGCTGG - Intronic
1075616175 10:123891993-123892015 CCCCGCAGGCCAGCCAGCGTGGG + Intronic
1075727646 10:124618720-124618742 GCACGAAGCCCAGCCCGGCGTGG - Exonic
1076217963 10:128711030-128711052 CCCCTACGTCCTGCCCGGGGTGG + Intergenic
1076290220 10:129340290-129340312 CCCCCAAGGCCAGCACAGCGTGG + Intergenic
1076749998 10:132537758-132537780 CCGCGGAGCCGAGCCCGGGGCGG - Intergenic
1076806402 10:132861363-132861385 CCCCGAAGACCAGCCAGAGTGGG - Intronic
1076838402 10:133032672-133032694 CGCTGAAGGCCAGCCCAGGAGGG + Intergenic
1077370909 11:2181196-2181218 CCCCCAAGGCCATGCTGGGGTGG - Intergenic
1078421537 11:11216694-11216716 CCACTAAGGCCAGCCCTGGGAGG + Intergenic
1079076630 11:17388835-17388857 GCCCGAAGGCCAGACAGGTGAGG - Intronic
1081909536 11:46692108-46692130 TCCCGGAGGCCAGCTGGGGGTGG + Intronic
1083893949 11:65611093-65611115 CCACAGAGGCCAGCCCAGGGAGG - Intronic
1084191260 11:67500039-67500061 CCCAGGAGCCCAGCCTGGGGAGG + Intronic
1084567488 11:69939725-69939747 TCCCAAAGTCCAGCCTGGGGCGG - Intergenic
1089456282 11:118627787-118627809 CCCCGGAGGCCAGGGCTGGGAGG - Exonic
1091295620 11:134472152-134472174 TCCCACTGGCCAGCCCGGGGAGG + Intergenic
1091583883 12:1805181-1805203 ACTCGAAGGCCAGGCAGGGGGGG - Intronic
1091923062 12:4321116-4321138 CCCCGAAGGCCACTCAGGGCCGG - Intergenic
1092939166 12:13391303-13391325 CCTCGAGGGCCAGCCATGGGAGG + Intergenic
1094844852 12:34356966-34356988 CCCGCGAGGCCAGCCCGTGGCGG - Intergenic
1094845108 12:34358093-34358115 CCACGAGGGCCAGCCCAAGGCGG - Intergenic
1094856949 12:34407097-34407119 CCACGGAGGCCAGCCCAAGGTGG + Intergenic
1102506411 12:113387191-113387213 CCCAGAGGGCCAGCAGGGGGTGG + Intronic
1102509014 12:113401915-113401937 CCCAGAAGGCCAGGCAAGGGTGG + Intronic
1102626651 12:114240445-114240467 CCCAGAAGGCGAGCCGTGGGAGG + Intergenic
1103343611 12:120234868-120234890 CCCTTAAGGCCAGCAGGGGGAGG + Intronic
1103722239 12:122981074-122981096 CCCCCAAGGCCGGCCGCGGGCGG - Exonic
1104987707 12:132606234-132606256 ACCCGATGGCCGGCCCGGGGTGG - Exonic
1105349463 13:19602311-19602333 CCCGGCGGGCCACCCCGGGGCGG - Intergenic
1112504851 13:99969587-99969609 CCCGGAAGGCCTGCCTCGGGCGG + Intronic
1113529009 13:111006259-111006281 CCCCGGAAGCCAGCTCCGGGTGG - Intergenic
1121622725 14:95361469-95361491 CCAGGTAGGCCAGCCTGGGGTGG + Intergenic
1122123262 14:99565821-99565843 TCCAGAAGGCCAGGCCAGGGAGG + Intronic
1122325181 14:100877522-100877544 TCCTGAAGGCCACCCCTGGGGGG - Intergenic
1122716583 14:103700019-103700041 CCACCAAAGCCAGCCCGTGGTGG + Intronic
1122806898 14:104264416-104264438 GCCCGAAGGCAAGCCCCAGGGGG - Intergenic
1122948351 14:105025075-105025097 TCCGGAAGGCCAGCCCAGGCAGG + Intergenic
1129233229 15:74208375-74208397 CCACGGTGGCCAGCCCAGGGAGG - Intronic
1130975451 15:88769915-88769937 CCTCCCAGGCCTGCCCGGGGAGG + Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132618354 16:853118-853140 CCCCCTCGGCCTGCCCGGGGGGG - Intergenic
1132628085 16:901901-901923 CCACGAAGCCCAGCCAGGGCCGG + Intronic
1132657025 16:1045710-1045732 CACCGAAGCCCAGGCCGGGTGGG + Intergenic
1132669073 16:1095338-1095360 CCCCCAAGGCTGGCCTGGGGTGG + Intronic
1132785731 16:1656227-1656249 CCCCGAAAGCGCCCCCGGGGAGG + Exonic
1132887707 16:2189805-2189827 CCCCCAAGGCCAACCCTGGGAGG + Intronic
1133140637 16:3741165-3741187 CACCCAGGGCCAGCCCCGGGAGG + Intronic
1134441561 16:14302187-14302209 GCCCTATGGCCGGCCCGGGGCGG - Intergenic
1136544652 16:30948497-30948519 CCCCGGAGGCCTGCGCGGAGGGG - Exonic
1136547968 16:30965996-30966018 CCCCAAAGGCCCCACCGGGGGGG - Exonic
1137915412 16:52424624-52424646 CCCCAAAAGCCAGCCAGGAGTGG - Intergenic
1141431386 16:83971987-83972009 CCCTGGATCCCAGCCCGGGGAGG + Intronic
1141852836 16:86659062-86659084 CCCAGAAGGATAGCCCAGGGTGG - Intergenic
1142000532 16:87661730-87661752 CCCCGCAGGCCGCCACGGGGCGG + Intronic
1142306540 16:89289135-89289157 CGACGAAGGCCACCCCGGGCAGG + Intronic
1143341380 17:6213997-6214019 CCCAGGAGGCCAGCATGGGGAGG + Intergenic
1144784388 17:17823712-17823734 CCCCGAAGGGCGGGGCGGGGCGG - Intronic
1146976085 17:37113160-37113182 CCCCGCAGCTCAGCCTGGGGAGG + Exonic
1147142412 17:38466890-38466912 CCCTGCAGGCCAGACGGGGGTGG - Exonic
1149430816 17:56594472-56594494 CCCCGAGGACCGGCCCGGCGGGG + Exonic
1149997403 17:61412236-61412258 CCCCGAAGGCGCTCCCGGGAGGG - Exonic
1150376296 17:64684446-64684468 TCTCAAAGGCCAGCCTGGGGAGG - Intergenic
1151712189 17:75813224-75813246 CCCAGGAGGCCAGCCACGGGAGG + Intronic
1151976944 17:77488531-77488553 CACCTGAGGCCAGCCCGGGGAGG + Intronic
1151988243 17:77557727-77557749 CCTGGAAGGCCAGCCCTTGGCGG - Intergenic
1152105805 17:78328156-78328178 CCTCTAGGGCCAGCCCTGGGAGG - Intergenic
1152797700 17:82316221-82316243 CCCCCAGGCCCAGCCCGAGGAGG + Exonic
1152887156 17:82859202-82859224 CCCTGAAAGCCAGTGCGGGGAGG - Intronic
1152887195 17:82859410-82859432 CCCTGAAAGCCAGTGCGGGGAGG - Intronic
1153688244 18:7567377-7567399 GCCCCAAGCCCAGCCCCGGGCGG - Exonic
1156362845 18:36399588-36399610 GCCCCAAGGGCAGCCTGGGGTGG - Intronic
1159019686 18:63133101-63133123 CCCCTTGGGCCAGCCCTGGGTGG - Intronic
1160134750 18:76262662-76262684 CCTCGCAGGGCAGCCCTGGGAGG + Intergenic
1160853635 19:1206284-1206306 CCCCGAACGCTCGCCCGGGCCGG + Intronic
1160864532 19:1250998-1251020 CCCCGGAGGCCCGCGGGGGGAGG - Intronic
1160897126 19:1408104-1408126 CCCCGAACGGCAACCTGGGGGGG + Intronic
1161487471 19:4543775-4543797 CCCCGACGGGCAGCCTGAGGAGG - Exonic
1161550699 19:4910460-4910482 CCCAGAAGTCCAGCGCGGGCCGG - Intronic
1162398746 19:10432285-10432307 CCCCCAGGGACAGCCCCGGGCGG - Intronic
1163457977 19:17420020-17420042 CCCAGAAGGCCATGCGGGGGGGG - Exonic
1163860073 19:19738171-19738193 GCCCGCAGGCCAGCCCCTGGGGG - Intergenic
1164594550 19:29525100-29525122 CCCCGAAGGCAAATGCGGGGTGG - Intergenic
1166388084 19:42393131-42393153 CCTTGAAGGCCAGCCCAGCGGGG + Intergenic
1168683792 19:58335806-58335828 TCCTGGAGGCCAGCCCAGGGTGG - Intronic
925293869 2:2765423-2765445 CCCTGATGGCCAGCTAGGGGTGG + Intergenic
928158130 2:28894955-28894977 GCCCGAAGCCGAGCCCGGGAAGG - Intronic
929888702 2:45901857-45901879 CCCTGAAGTCCAGCCAGGTGCGG + Intronic
931375973 2:61708680-61708702 CCTCGAAAGCCAGCCTGCGGAGG + Intergenic
933858500 2:86441632-86441654 CCCCGTGGGGCCGCCCGGGGCGG + Intronic
935713504 2:105919485-105919507 CCCTGAAGGCCAGACCAGGCAGG - Intergenic
940640843 2:156342695-156342717 CCCCGCAGGGCGGGCCGGGGCGG - Intergenic
945080776 2:206085260-206085282 TCCGGACGGCCAGGCCGGGGCGG - Intronic
945225931 2:207530611-207530633 CCCCGGAGGCCCGGCCGGGTCGG - Intronic
946375777 2:219308355-219308377 CCTCCAAGGCCAGCCCTTGGCGG - Intronic
946422524 2:219572549-219572571 CCCCGAAGACATGCCCTGGGGGG + Exonic
947493313 2:230614623-230614645 CTCAGAAAGCCAGCCCGGGTCGG + Intergenic
948903706 2:240968121-240968143 CCCCACAGGCCAGCGCCGGGTGG + Intronic
1170969858 20:21105914-21105936 CCCCGCAGGCCGGGCCGAGGTGG - Intergenic
1174054082 20:47785904-47785926 CCCCGAAGTCCAGCTCCGGACGG + Exonic
1175501646 20:59455146-59455168 CCTCGAAGCCCAGCCCGGAGAGG + Intergenic
1175877103 20:62235556-62235578 CCCCGCATGCCAGCCCTGGGAGG + Intronic
1175890081 20:62312123-62312145 CTCCGACGGCCACCGCGGGGTGG + Intronic
1176122032 20:63458319-63458341 CCTCGAGGGCCAGGCCAGGGTGG - Intronic
1176141955 20:63548711-63548733 CCCTGAAGGCCACCCAGGTGCGG - Intronic
1176218388 20:63958769-63958791 AACTGAAGGCCAGCCAGGGGAGG - Exonic
1176551405 21:8224040-8224062 CGGCAAAGGCCAGCCGGGGGAGG - Intergenic
1176570314 21:8407039-8407061 CGGCAAAGGCCAGCCGGGGGAGG - Intergenic
1176578223 21:8451226-8451248 CGGCAAAGGCCAGCCGGGGGAGG - Intergenic
1178673849 21:34614730-34614752 CCCCGACGGCCCGCCCGGCGCGG + Intronic
1180077263 21:45469082-45469104 CCCCGAGGCCCAGCCCAGGAGGG + Intronic
1180733707 22:18000870-18000892 CCCCGAGGGCCAGGCCGCGGAGG + Intronic
1181081774 22:20420348-20420370 CCCTGATGGCCAGTCAGGGGCGG + Intergenic
1183076548 22:35431035-35431057 CCCTGCAGGCCAGGCCGGGTGGG - Intergenic
1183601665 22:38843757-38843779 CCCTGGCGGCCAGCCCGGCGCGG - Exonic
1183951912 22:41357111-41357133 CCCAGATGGACAGCCTGGGGTGG + Intronic
1184843343 22:47065534-47065556 CCCCCAAGGGCAGGCAGGGGAGG - Intronic
1184968035 22:47995817-47995839 CCCCGAGGACCAGCCCAGGGTGG + Intergenic
1185273114 22:49937654-49937676 CACCCAAAGCCAGCCTGGGGCGG + Intergenic
950021770 3:9792617-9792639 CCCCGGGGCACAGCCCGGGGCGG + Exonic
951908813 3:27728984-27729006 CCCCGAAGGCCAAGCCGGCCTGG + Intergenic
953420129 3:42747838-42747860 CCCCGAAGGCAAGCCCAGCGTGG + Intronic
954379685 3:50212977-50212999 CCCTGAAGGCCAGCCTGGCCAGG - Intronic
954539493 3:51384450-51384472 CCCCGAGGGCCTAGCCGGGGAGG + Intergenic
960972355 3:123148977-123148999 GCCAGCAGGCCAGCCTGGGGAGG + Intronic
961551452 3:127672583-127672605 CGCCGAGGGCCAGGCCGCGGGGG - Exonic
961646326 3:128394703-128394725 CCCCAATGGCCAGCCTTGGGGGG + Intronic
968065651 3:195757590-195757612 CCCCAAAGGGCAGCCCTGGCTGG + Intronic
968230797 3:197003477-197003499 CCCCGAAGCCCGGGCCGCGGTGG + Intronic
968934848 4:3604653-3604675 CCACAAAGGCCAGCCCGGTGTGG - Intergenic
969239195 4:5888185-5888207 CCACAAAGGCCAGCGCGGGGCGG + Intronic
969867868 4:10087096-10087118 CCCCAAATGCCAACCTGGGGAGG - Intronic
985537447 5:473167-473189 GCCCGAGGGCGAGCCGGGGGCGG - Intergenic
991371730 5:65926130-65926152 GCCCGACGGACGGCCCGGGGAGG + Intergenic
992962784 5:81972263-81972285 CCCCGCAGCCCAGCCCGGCGAGG - Exonic
993901717 5:93588502-93588524 CTCCGAAGGCCAGGCCCGGGCGG - Intronic
994648549 5:102498912-102498934 ACCCAAAGGCCAGCCTGGCGAGG + Exonic
999148745 5:149412916-149412938 CCCAGTAGCCCAGCCAGGGGTGG - Intergenic
1001651302 5:173318068-173318090 CCCCGAGCGCCAGCCCCAGGTGG - Exonic
1003307940 6:4946146-4946168 CCCCTCTGGCCAGCCCTGGGTGG + Intronic
1006377496 6:33679735-33679757 CCCCAAATCCCAGCCAGGGGAGG + Intronic
1007292313 6:40797069-40797091 CCCAGGAGGCCAGCCGGGGACGG - Intergenic
1011610518 6:89146285-89146307 CCTCGTAGGCCAGCTCGGGCTGG - Exonic
1017891572 6:158644180-158644202 GCCGGGACGCCAGCCCGGGGCGG + Intronic
1018384590 6:163291180-163291202 ACCCGCAGGCCAGCTCGGGCAGG - Intronic
1018384648 6:163291408-163291430 ACCCGCAGGCCAGCTCGGGCAGG - Intronic
1018384660 6:163291454-163291476 CCCCGCAGGCCAGCTCGGGCGGG - Intronic
1018910676 6:168099585-168099607 CCCCGAAAGCCAGGCCAGGCGGG - Intergenic
1019309866 7:354765-354787 CCCACGGGGCCAGCCCGGGGTGG + Intergenic
1019358706 7:594179-594201 CCTGGAAGGCCAGCCTGGGTGGG - Intronic
1019430509 7:996882-996904 CCCCCAATGCCATCCTGGGGTGG + Intergenic
1019618533 7:1978219-1978241 CCCAGAAGGGCAGCCCAGGCAGG - Intronic
1019663873 7:2241859-2241881 CGCCGGGGGCGAGCCCGGGGCGG - Intronic
1019701335 7:2476204-2476226 CCCAGCAGGCCAGCTCTGGGGGG + Intronic
1020785824 7:12571106-12571128 CCCCAAAGGGCAGCCCCGTGGGG - Intronic
1024578329 7:50782475-50782497 CCCCGAAGCCCTACCCGGGCCGG - Intronic
1024623951 7:51188359-51188381 CCCAGCAGGCCTGCCCAGGGCGG + Intronic
1024898730 7:54292838-54292860 ACCCCAAGCCCAGCCCTGGGAGG - Intergenic
1029444657 7:100605227-100605249 TCCCCTAGGGCAGCCCGGGGAGG - Intronic
1032076300 7:128837734-128837756 CCCTGAAGGCCACACCGAGGAGG + Exonic
1034274060 7:149816400-149816422 CCGTGAATGCCAGCCCGGCGAGG + Intergenic
1034338311 7:150337440-150337462 CACCGAGGCCCAGCCCTGGGTGG + Exonic
1034419051 7:150979418-150979440 CCGGGAAGGCCAGGGCGGGGAGG + Intergenic
1036789466 8:11708557-11708579 CCCAGCAGGGCAGCCCGGGATGG + Exonic
1039792790 8:40888762-40888784 CCCAGAGGGCCACCTCGGGGGGG + Intronic
1039885871 8:41653742-41653764 CCCTGGAGGCCGGGCCGGGGTGG + Intronic
1040417029 8:47204690-47204712 CCCCACAGGCCAGCCAGGTGCGG + Intergenic
1041051565 8:53939644-53939666 CGCCCCAGGCCAGCCCGGAGCGG + Exonic
1041107073 8:54454239-54454261 TCCCGGAGGCCAGCACGAGGTGG - Intergenic
1048377453 8:133835024-133835046 CCCACAAAGCCAGCCCTGGGTGG + Intergenic
1049205146 8:141360169-141360191 CCCCAGAGGCCAGACCGGAGAGG + Intronic
1049212256 8:141392172-141392194 CCCCGAAGCCGTGCCCGGAGCGG - Intronic
1049243072 8:141548570-141548592 CCACGAAGGGCAGACCTGGGTGG - Intergenic
1049707211 8:144048497-144048519 CCCAAAAGGCCAGCCCGCAGTGG - Intergenic
1053430285 9:38037758-38037780 GCCCCAAGGTCAGCCCAGGGAGG - Intronic
1054455325 9:65427325-65427347 CCACAAAGGCCAGCCCGGTGTGG + Intergenic
1056787968 9:89606070-89606092 CCCCGAGTGACAGCCCGGCGGGG + Exonic
1057490444 9:95516206-95516228 CCCCCGAGGCCAGCCCCGCGTGG - Intronic
1060663040 9:125415628-125415650 CCCCGGAGGCCAGCCTGGGAGGG - Intergenic
1060748280 9:126151981-126152003 CCCCGGAGGGCAGCCCAGTGTGG - Intergenic
1060796400 9:126515214-126515236 CCCTGAAGGGCAGCCAGGGGAGG - Intergenic
1060917154 9:127398069-127398091 CACCGCAGGCCAGGCCGGTGAGG - Exonic
1060947542 9:127579053-127579075 CCTCTAAGGCCAGCCAGGCGGGG + Intergenic
1061227926 9:129291431-129291453 CACCGAAGTCCTGCCCCGGGAGG + Intergenic
1061945364 9:133905678-133905700 GCCTGAAGACCAGCCCTGGGGGG + Intronic
1062025718 9:134339256-134339278 CCCTGAAGGCCAGGCAGGGAGGG - Intronic
1062362223 9:136193474-136193496 CCCCCCAGGCCCGCGCGGGGCGG + Intergenic
1203472584 Un_GL000220v1:122684-122706 CGGCAAAGGCCAGCCGGGGGAGG - Intergenic
1185449655 X:275571-275593 TCCTGGAGTCCAGCCCGGGGTGG + Intergenic
1188004438 X:25007355-25007377 CCGGGAAGGGCAGCCCAGGGGGG + Exonic
1189251773 X:39605955-39605977 CCCCAAAGGCCAGCCCTCTGTGG - Intergenic
1190554241 X:51618008-51618030 CCCCGCAGGGCCGCCCGGGCCGG + Intergenic
1190560536 X:51681966-51681988 CCCCGCAGGGCCGCCCGGGCCGG + Intergenic
1190563755 X:51711355-51711377 CCCCGCAGGGCCGCCCGGGCCGG - Intergenic
1200036452 X:153334566-153334588 GCCCGAAGGCCTTCCCGAGGCGG + Intronic
1200053689 X:153447442-153447464 ACCCTAAGGCCAGCCGGGGGAGG + Intronic
1200310379 X:155071409-155071431 CGCCGAAGGCCAGGCCTGGGCGG + Intronic