ID: 905791324

View in Genome Browser
Species Human (GRCh38)
Location 1:40791303-40791325
Sequence CTTGAAATGCATAGGGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905791319_905791324 27 Left 905791319 1:40791253-40791275 CCTGGCACACAGTCGTGGTGGGC 0: 1
1: 0
2: 0
3: 10
4: 113
Right 905791324 1:40791303-40791325 CTTGAAATGCATAGGGTACCAGG 0: 1
1: 0
2: 0
3: 1
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905791324 Original CRISPR CTTGAAATGCATAGGGTACC AGG Intronic
905641076 1:39590394-39590416 CCTGAAATGCAAAGGGTTCAAGG - Intergenic
905791324 1:40791303-40791325 CTTGAAATGCATAGGGTACCAGG + Intronic
906228131 1:44138825-44138847 CTTGAAAAGCATAGGAATCCTGG + Intergenic
906775956 1:48529816-48529838 CTTGACATGCAGAGGGCCCCTGG - Intergenic
916517443 1:165532788-165532810 CTTGAAAAGCTTAGGGACCCTGG - Intergenic
916602084 1:166303074-166303096 CTTGAAGTTCTTAGGTTACCAGG + Intergenic
917539056 1:175895933-175895955 CTTGAATTGCATATGGTAGGGGG + Intergenic
921631995 1:217445113-217445135 CTTGATATGCATATTGTTCCAGG - Intronic
1062890652 10:1057103-1057125 CTTGGAATGCAGAGGGTCCGTGG + Intronic
1063233925 10:4092862-4092884 CTAGAAGAGCATAGGCTACCAGG + Intergenic
1064189494 10:13193322-13193344 GTGGAAATGCATAGGGTAGGTGG + Intronic
1066086370 10:31975547-31975569 CTTGTAATTCACAGGGTATCAGG + Intergenic
1070440995 10:76443134-76443156 CATGAAAGCCATAAGGTACCTGG + Intronic
1070713664 10:78701933-78701955 CTTGAAAAGCAGTGGGTGCCCGG - Intergenic
1071170126 10:82854511-82854533 CTTCAAATGCAGAAGGTATCTGG - Intronic
1073097387 10:100988162-100988184 CTTGAAATGCCTTAGGTGCCTGG - Exonic
1080886479 11:36372753-36372775 CTTGAAAAACCTAGGGGACCTGG - Intronic
1085596715 11:77818315-77818337 GTTGAAATGCATAGGTTTTCTGG - Intronic
1089391666 11:118106429-118106451 CTTGAAATGCCTATGGTTCTAGG - Intronic
1100767313 12:97881550-97881572 GCTGAAATGCATATGGTAACTGG - Intergenic
1104221226 12:126786753-126786775 CCTGGAATGCACAGGGCACCTGG + Intergenic
1104381835 12:128314044-128314066 CTAGAAATGGTTAGGGTCCCTGG + Intronic
1119437422 14:74606415-74606437 AGTGAAATCCATAGGGTAACTGG - Intronic
1123995581 15:25715900-25715922 CGTGATATGCATATGGAACCAGG - Intronic
1128198466 15:65782247-65782269 CTTGCAATGCAAAGGGTCCTGGG - Intronic
1130862707 15:87905214-87905236 CTTGACATGCATAGAGACCCTGG + Intronic
1131117284 15:89803175-89803197 CTTGAGATGCTGAAGGTACCTGG - Intronic
1134547817 16:15124077-15124099 CTTGAAATGCATAGATTCCTTGG - Intronic
1143567622 17:7734073-7734095 CCTGAAATGCATATGCTTCCTGG + Intronic
1148966828 17:51442793-51442815 CTAGAAATGCAGAGGGAAACGGG - Intergenic
1149358194 17:55866075-55866097 CTTCAAATGCAGATGGCACCAGG + Intergenic
1149642262 17:58210830-58210852 CTGGAAACGCAGAGGGTTCCTGG - Intronic
1150071104 17:62150827-62150849 CTTGAAATCTATATGGTACTGGG + Intergenic
1153154560 18:2133845-2133867 CTTGAAATGGAAAGGGATCCAGG - Intergenic
1155660025 18:28238285-28238307 CTGGAAATGGATAGGTTATCAGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1162654233 19:12116738-12116760 TCTGACATGCATAGGGTCCCTGG + Intronic
1162657367 19:12141032-12141054 TTTGACATGCATAGAGTCCCTGG - Intronic
1163129996 19:15266378-15266400 CTTGAGATGCACAGGGAACATGG - Intronic
932616781 2:73236844-73236866 CCTGCAAAGCATAGGGAACCTGG + Intronic
939279650 2:140045866-140045888 CTTGAAAAGCATAAGGTATATGG - Intergenic
941085899 2:161117884-161117906 CTGGAAATCCATGGGTTACCTGG + Intergenic
941576993 2:167245346-167245368 CTTGAATTGCATAGAGTGGCTGG - Exonic
945590253 2:211720138-211720160 CTAAAAATGCATCGGTTACCGGG - Intronic
1169119383 20:3085805-3085827 CTTGAGAGGCAGGGGGTACCGGG - Intergenic
1170648101 20:18214475-18214497 CTTGAGATGCAGAGGTTAGCTGG + Intergenic
1175318825 20:58071241-58071263 CAGGAAATGCACAGGGCACCAGG - Intergenic
950990976 3:17437364-17437386 CTTTATATCCATAGAGTACCTGG - Intronic
955898513 3:63726560-63726582 CTTGAAAAGCAAAGTCTACCTGG - Intergenic
956180239 3:66510725-66510747 CTTGGAAAGCATAGGTAACCTGG + Intergenic
960165896 3:114400852-114400874 ATTGAAAGGCAGAGGGTATCAGG + Intronic
961555577 3:127694794-127694816 CTTGAAATTCATAGGCTCCTGGG + Intronic
964789092 3:160434510-160434532 GTTGAAATGCATTTAGTACCCGG - Exonic
967038993 3:185672184-185672206 ATTAAAATATATAGGGTACCTGG - Intronic
985379102 4:189373509-189373531 CAGGAAATGCAAAGGCTACCTGG + Intergenic
985717813 5:1472408-1472430 CTTGCAAGGCATGGGGTACTGGG + Intronic
986426854 5:7641055-7641077 CTTGAAAGGCATAGAGTGGCAGG - Intronic
986631755 5:9780959-9780981 TTTGAAATGCATAGGCAAGCTGG - Intergenic
988373126 5:30398432-30398454 CTCAAAATGCATAAGGTACAAGG + Intergenic
989082642 5:37640991-37641013 CTTGTAATGAATAGAGTACTGGG - Intronic
992729173 5:79641132-79641154 CTTTAAATGGATTTGGTACCCGG + Exonic
995201564 5:109430427-109430449 CTAGAAATGCAGAAGGTGCCCGG + Intergenic
996201218 5:120676785-120676807 CTAGAACTGCATTGGGTTCCTGG - Intronic
999840288 5:155417549-155417571 CATCAAATGAATAGGGTACTGGG + Intergenic
1001929023 5:175659480-175659502 CTTGTAATGCACCGAGTACCAGG - Intronic
1003506269 6:6742881-6742903 CCTGACATACATAAGGTACCAGG + Intergenic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1014173241 6:118302784-118302806 CTTGAAATCCATGGGGTAGTAGG - Intronic
1015897603 6:138032539-138032561 CTAGAAATGCATAGTGAACTAGG + Intergenic
1016869882 6:148806632-148806654 TTTGAAAGGCATAGGGGGCCGGG - Intronic
1017488037 6:154920965-154920987 CATGAAATTCACAGGGTCCCTGG + Intronic
1020520746 7:9183895-9183917 CTTGAAATGGTTTGGGTAACAGG - Intergenic
1024747318 7:52423341-52423363 CTTGGAATGCAAAGGGTAAATGG - Intergenic
1026600779 7:71775539-71775561 CTTTACATGTATAAGGTACCTGG + Intergenic
1027925749 7:84461069-84461091 CTTAAAATTCATAGGGTATAAGG + Intronic
1029862908 7:103593968-103593990 CTAGAAATGCAAATGGTACATGG - Intronic
1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG + Intergenic
1034145524 7:148867858-148867880 CTTGAGATGTTTAGGGTATCTGG - Intronic
1042799444 8:72702858-72702880 CTGGAAATCCATAGGACACCTGG - Intronic
1043118404 8:76289484-76289506 ATTGATATGCATAGAGTACAAGG + Intergenic
1043218934 8:77633899-77633921 CTTGAAATACCTGGGGTACTGGG - Intergenic
1043773754 8:84238585-84238607 CTTGAAATTCATGGTGAACCTGG + Intronic
1044997850 8:97854287-97854309 CTAGAAATGGAGAGGGCACCAGG + Intergenic
1050826954 9:9958721-9958743 TTTAAAATGCATAAGGTATCTGG + Intronic
1194279840 X:91936190-91936212 CTTGAAGATCATAAGGTACCTGG - Intronic
1200597317 Y:5159670-5159692 CTTGAAGATCATAAGGTACCTGG - Intronic