ID: 905804157

View in Genome Browser
Species Human (GRCh38)
Location 1:40863811-40863833
Sequence TGTCAAATGCGTGGAGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905804157_905804163 14 Left 905804157 1:40863811-40863833 CCTTACCCTCCACGCATTTGACA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 905804163 1:40863848-40863870 TCTGACCTTCCCCCGACCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 126
905804157_905804168 24 Left 905804157 1:40863811-40863833 CCTTACCCTCCACGCATTTGACA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 86
905804157_905804166 23 Left 905804157 1:40863811-40863833 CCTTACCCTCCACGCATTTGACA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905804157 Original CRISPR TGTCAAATGCGTGGAGGGTA AGG (reversed) Intergenic
903207786 1:21795812-21795834 TGTGAAATAGGTGAAGGGTACGG + Intergenic
903317351 1:22518726-22518748 TGTAAACTGCTTGGAGGGAAAGG - Intronic
904651304 1:32007942-32007964 TGCCAAATATGTGGAGGGAAGGG - Intergenic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
908132776 1:61091761-61091783 GGTCAAATGCCTGGTGGCTAAGG - Intronic
910036053 1:82790591-82790613 TGTAAAATAGGTGAAGGGTAGGG - Intergenic
915072860 1:153286786-153286808 TGTCAGCTCTGTGGAGGGTAGGG - Intergenic
916464776 1:165062882-165062904 TGAGATATGCGTTGAGGGTAGGG - Intergenic
918163730 1:181924857-181924879 TGGCAAAAGTGTGGAGGGCATGG - Intergenic
921914550 1:220592752-220592774 TCTCAACTGCTTGGAGTGTAAGG + Intronic
924706048 1:246503078-246503100 TGTTAAATGGGTTGAGGGGACGG - Intronic
924832299 1:247609896-247609918 TGTCGGAGGCATGGAGGGTAAGG + Intergenic
1068540796 10:58293064-58293086 TCTCTAATGCTTGAAGGGTAAGG - Intergenic
1069720959 10:70549073-70549095 TGTTAAATGTGGGGAGGGGAAGG + Intronic
1071406549 10:85339792-85339814 TGCCAAATGCTTTGAGGATATGG + Intergenic
1071426163 10:85555250-85555272 TGTTAACTGTGTGCAGGGTATGG + Intergenic
1072716183 10:97754077-97754099 TGTCAGATGGGAGCAGGGTAAGG + Intronic
1073424477 10:103447967-103447989 TCTGAAATGCTTGGAGGGCAAGG + Intronic
1074865762 10:117543560-117543582 TGGCGAGTGCGAGGAGGGTAGGG - Exonic
1075709466 10:124522830-124522852 TGACAAATGAGTAGAGGGAAGGG + Intronic
1079646168 11:22866107-22866129 TGTAAAATAGGTGAAGGGTAGGG - Intergenic
1082090079 11:48081755-48081777 TGTAAAATGGGTGGGGGGAAGGG + Intronic
1084313067 11:68327707-68327729 TGTGACAGGCGTGGAGGGTAGGG + Intronic
1086469026 11:87086718-87086740 TGTAAAATAGGTGGAGGGTGGGG + Intronic
1087228682 11:95632569-95632591 TGTGAACTGAGGGGAGGGTATGG - Intergenic
1090471386 11:126984362-126984384 TGTCACATGCTTGGAGGATGAGG + Intronic
1093459585 12:19396112-19396134 GGTCAAATGAGAGGAGGGAAAGG - Intergenic
1098389871 12:69958203-69958225 TGTCAAATGCGTGTACGAAATGG + Intronic
1098488682 12:71050299-71050321 TGTAAAATAAGTGAAGGGTAGGG - Intronic
1100072551 12:90737844-90737866 TGTCAAATCTGTCAAGGGTAGGG - Intergenic
1106799100 13:33237672-33237694 AGTCAAATGGGTGTAGGGGATGG - Intronic
1106933943 13:34697302-34697324 TGTAAAATAGGTGAAGGGTAGGG + Intergenic
1109821916 13:67668288-67668310 TGTCAAATAGGTGAAGGATAAGG - Intergenic
1111872892 13:93856300-93856322 TGTCAAGTGGGTTGAGGATAAGG + Intronic
1119619043 14:76118027-76118049 CGGCAGATGCGGGGAGGGTAGGG + Intergenic
1122132194 14:99610967-99610989 CGTCAAATGGGTGGAGGCCAGGG - Intergenic
1128466762 15:67919012-67919034 TGTAAAATAGGTGAAGGGTAGGG + Intergenic
1130334716 15:82949091-82949113 TGGCAAATGAGTGCATGGTAGGG + Intronic
1133065206 16:3201506-3201528 TGCCAAATACGTGGAGGAAAAGG + Intergenic
1134123451 16:11600580-11600602 TGTCAAATAGGTGAAGGGTGGGG - Intronic
1137884129 16:52084298-52084320 TGTCAGATGCGTTGAGAGAATGG + Intergenic
1138975081 16:62196235-62196257 TGTATAATGCGGGGAGGCTAGGG + Intergenic
1145801519 17:27689036-27689058 GGTCAAATGAGTGGAGGAAAAGG + Intergenic
1149289547 17:55203450-55203472 TGTAGAATGGGTGGATGGTAGGG + Intergenic
1156062088 18:33091181-33091203 TGTCAAATGCGTGAAGTGATTGG + Intronic
1156477248 18:37413521-37413543 TGTCACAGGAGTGGAGGGCATGG - Intronic
1157720797 18:49922639-49922661 TGGCAAATGCCAGGAGGATAAGG + Intronic
1160230589 18:77045822-77045844 TGTCAGTTGCGTGGAGGTTTTGG - Intronic
1164254883 19:23518950-23518972 TGTAAGAGGAGTGGAGGGTAAGG - Intergenic
1167533938 19:50037098-50037120 AGTCAGATGCCTGGAGGGTTGGG + Intronic
1168332295 19:55577833-55577855 TGTCAAGGGCGTGAAGGGGACGG + Exonic
925085815 2:1106600-1106622 TGTCACTTGGGTGCAGGGTATGG + Intronic
925182791 2:1827765-1827787 TGCCAATTGTGTGGAGGGGAGGG - Intronic
935921474 2:108020394-108020416 TATTTAATACGTGGAGGGTAAGG + Intergenic
936992640 2:118382605-118382627 TTTCAACTGCATGGAAGGTAAGG + Intergenic
939596882 2:144136320-144136342 TGTCAAAAGAGGGGAGGGGAGGG + Intronic
939928421 2:148201916-148201938 TGTAAAATAAGTGAAGGGTAGGG + Intronic
945668988 2:212779339-212779361 TGTCAAATGAATGGTGGGAAAGG + Intergenic
946708723 2:222485360-222485382 TGTCAAATGCGGGGGTGGGAAGG - Intronic
1169857110 20:10115043-10115065 TGTCAGAGGGGTGTAGGGTATGG - Intergenic
1174048945 20:47754076-47754098 AGTCAAATGCGTGCAGGGAAAGG + Intronic
1175309071 20:57998936-57998958 AGTCAGATGGGTAGAGGGTAGGG - Intergenic
1177228758 21:18291787-18291809 AGTAAAATGCGTGGTTGGTAAGG + Intronic
1181665982 22:24397492-24397514 TGTCAGGTGCTTGGAGGGTGAGG + Intronic
1182692987 22:32176486-32176508 GGTCAAATGCCTGGAGGGGGCGG - Intergenic
1183039353 22:35164950-35164972 TGTCAGAGACGTGGAGGGAAAGG - Intergenic
1184578717 22:45397613-45397635 TGTAAAATAGGTGAAGGGTAGGG - Intronic
954452587 3:50579777-50579799 TCTGAAATGCATGGAGGGCATGG - Intronic
956743190 3:72290936-72290958 TGTCAAATGCGTGGTGGAGAGGG + Intergenic
956895891 3:73659432-73659454 TGGCAAATGCTAGGAGGGTATGG - Intergenic
960721385 3:120627643-120627665 TGATAAATGAGTGAAGGGTAGGG + Intergenic
962234301 3:133694281-133694303 TGTCAACTGTGTGCAGGGAAAGG + Intergenic
962307878 3:134304646-134304668 TGTCAAATAGGTGAAGGGAAGGG + Intergenic
963853277 3:150228288-150228310 TGTGCAATGGGTGGAGGGTCTGG - Intergenic
964987865 3:162766522-162766544 TGTAAAATAGGTGAAGGGTAGGG + Intergenic
967764934 3:193268919-193268941 TGTCAAATGGTAGCAGGGTACGG - Intronic
973639155 4:52886128-52886150 TGTAAAATAGGTGAAGGGTAGGG - Intronic
977629594 4:99227290-99227312 TGTCATGTGCGGGGAGGCTAGGG - Intergenic
978247729 4:106595224-106595246 TGTCAAGTGATTGGAGGGTTTGG - Intergenic
981777125 4:148382004-148382026 TGTCTATTGGGTGGAGGGAATGG - Intronic
985131362 4:186741543-186741565 TGTCAAATGTGGGGAGGGTATGG - Intergenic
988361285 5:30239655-30239677 TGTAAAATAGGTGAAGGGTAGGG - Intergenic
991205973 5:64050880-64050902 TGTAAAATAGGTGAAGGGTAGGG - Intergenic
1003197506 6:3928225-3928247 TGTCTAGTGGGTGGAGGCTAGGG - Intergenic
1010867344 6:80995380-80995402 TGATAAATGCTTGAAGGGTATGG - Intergenic
1013546318 6:111161262-111161284 TGTAAAATAGGTGGAGGGTGGGG + Intronic
1013853454 6:114542671-114542693 TCTCAAATGCGAGGAAGATATGG + Intergenic
1015571969 6:134631060-134631082 AGCCAAATACGTGGAGGCTAGGG + Intergenic
1017810318 6:157979668-157979690 TGTATAATGCCTGGAGGGTAGGG - Intergenic
1021054514 7:16030482-16030504 TGTCAAATAGGTGAAGGGTGGGG + Intergenic
1021773871 7:24032407-24032429 TGTCAAATGAGGGGATTGTAAGG + Intergenic
1024095642 7:45980367-45980389 TGTCAATTGAGTGGTGGGCAAGG + Intergenic
1029954316 7:104621577-104621599 TGTCAACTCCCTGGAGGGAAAGG - Intronic
1030067923 7:105674632-105674654 TTTCTAAAGCGTGGAGGGAAAGG - Intronic
1031816516 7:126444773-126444795 TGTCAAAAGTATGGAGAGTAGGG + Intronic
1035326092 7:158067135-158067157 TGTTAGATGGGTGGAGGGCAAGG + Intronic
1036590969 8:10167733-10167755 TGTCAAAAGCCTGGAGAGTTGGG + Intronic
1037018619 8:13940452-13940474 TGTTAAAGGCATGGAGGGAAGGG + Intergenic
1037301952 8:17461142-17461164 TGTAAAATAGGTGAAGGGTAGGG + Intergenic
1037424996 8:18746117-18746139 TGTAAAATACGTGAAGGGTGGGG - Intronic
1040959063 8:53011592-53011614 TATCAAATGCTGGGAGGGTATGG + Intergenic
1048410683 8:134169094-134169116 TGTAAAATAGGTGAAGGGTAGGG + Intergenic
1055673934 9:78635695-78635717 TGTCAGATGGGTTGAGTGTAGGG + Intergenic
1057870006 9:98709764-98709786 GGTCAAATGCCTGGAGGGGGCGG - Intergenic
1059806668 9:117808501-117808523 TGTCATATCGGTGGAGAGTAGGG - Intergenic
1062518659 9:136948239-136948261 AGTCAGAGGCGTGGAGGGTCAGG - Intronic
1189396537 X:40628292-40628314 TGTAGAATGGGTGGAGGGCAGGG - Intronic
1189879632 X:45476925-45476947 TGTCCAATCCCTTGAGGGTATGG + Intergenic
1190839959 X:54134748-54134770 TGTTAGATGGGTGGAGGGTGTGG - Intronic
1190889798 X:54558223-54558245 TGTCAAATGGGGGGTGGATAAGG - Intronic
1193654369 X:84181870-84181892 TATGAAAAGGGTGGAGGGTAGGG - Intronic
1198363324 X:135916941-135916963 TGTCACATGGTTGGAGGGAAAGG + Intergenic
1202052711 Y:20797525-20797547 GGTCAAATCCGAGGAGGGCAGGG - Intergenic