ID: 905804158

View in Genome Browser
Species Human (GRCh38)
Location 1:40863816-40863838
Sequence GAGAGTGTCAAATGCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905804158_905804168 19 Left 905804158 1:40863816-40863838 CCCTCCACGCATTTGACACTCTC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 86
905804158_905804172 28 Left 905804158 1:40863816-40863838 CCCTCCACGCATTTGACACTCTC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 905804172 1:40863867-40863889 GTGGCATCCTTGGGACTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 167
905804158_905804163 9 Left 905804158 1:40863816-40863838 CCCTCCACGCATTTGACACTCTC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 905804163 1:40863848-40863870 TCTGACCTTCCCCCGACCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 126
905804158_905804166 18 Left 905804158 1:40863816-40863838 CCCTCCACGCATTTGACACTCTC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905804158 Original CRISPR GAGAGTGTCAAATGCGTGGA GGG (reversed) Intergenic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
901163301 1:7197218-7197240 GTGTGTGTCAAATGTGAGGATGG + Intronic
903469429 1:23575566-23575588 GAGGGTGTCACAAGAGTGGAGGG - Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
905871221 1:41405644-41405666 GAGAGTGACAAGTGTGGGGAGGG + Intergenic
906931356 1:50172797-50172819 GAGAGAATCAAATGCATAGAAGG + Intronic
906941753 1:50261721-50261743 GAGAGTGTCAGATTAGGGGAAGG - Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
908773265 1:67615393-67615415 CAGAGTGACTAATGCCTGGAGGG + Intergenic
915704857 1:157833940-157833962 GAGAGTTTCAAATGTGCTGATGG - Intronic
916744420 1:167673763-167673785 CAAAGTGTCAAAAGCATGGAAGG - Intronic
917577239 1:176336414-176336436 GAGTGTGGCAAATGGATGGAGGG + Intergenic
918163731 1:181924862-181924884 GAGAGTGGCAAAAGTGTGGAGGG - Intergenic
919030464 1:192235662-192235684 GAGAGTCTCAAATGTGAGTAGGG + Intergenic
1064155905 10:12902966-12902988 GTGAATGTGAAAAGCGTGGATGG + Intronic
1064186718 10:13168192-13168214 GAGAATGTCACATGCCTGCAAGG - Intronic
1067551409 10:47238870-47238892 GAGGGTGTCACCTGCGAGGATGG + Intergenic
1070829038 10:79407543-79407565 CAGAGTCTCAAATGCCTGGGCGG + Intronic
1072288058 10:93935679-93935701 GAGAGTGTGAAAAGGGTGGAAGG + Intronic
1072985017 10:100131759-100131781 GTCAGTGTGAAGTGCGTGGATGG + Intergenic
1073618561 10:105023414-105023436 GAGAGTTTCCAATGGTTGGAGGG + Intronic
1074290092 10:112131840-112131862 GAGAGGGTCAAATGCGGGGTTGG - Intergenic
1074882558 10:117670088-117670110 GAGATTCTCAAATTTGTGGATGG - Intergenic
1076510953 10:131013204-131013226 GAGAGTGAAAAATGTGTGCAGGG - Intergenic
1083111116 11:60408247-60408269 GAGAGTGTAGAATACGTGGAAGG - Intronic
1084313065 11:68327702-68327724 GAAAGTGTGACAGGCGTGGAGGG + Intronic
1089759782 11:120714967-120714989 CAGAGTGGCAAATGCATGGGAGG + Intronic
1092092587 12:5815206-5815228 GAGAGTGTAAAATGCATGGCAGG - Intronic
1098302385 12:69067405-69067427 GTGAGTGTAAAATGCAAGGACGG + Intergenic
1098652901 12:72995976-72995998 AAGTGTGTCAAAAGCCTGGAAGG - Intergenic
1101404450 12:104415671-104415693 GAGAATATAAAATGCGGGGAGGG + Intergenic
1102096614 12:110246314-110246336 GAGGGTGTCAAAGGCCTGTAAGG - Intergenic
1103211889 12:119173195-119173217 GAGAGTGACGACTGCCTGGAAGG - Intergenic
1107028482 13:35826994-35827016 GAAAATGTCAAATGTATGGAAGG + Intronic
1107629168 13:42325947-42325969 GAGAATGTCAAATCTGTGGCTGG - Intergenic
1110371904 13:74750070-74750092 TAGGGTGTCTAATGGGTGGAAGG - Intergenic
1113863573 13:113507002-113507024 GACAGAGTCAGATGCGTGGAAGG + Intronic
1116097769 14:40393694-40393716 GAGAGAGTCAATAGTGTGGAAGG - Intergenic
1118163989 14:63317912-63317934 GATAGTGACAAATGCATGGTTGG - Intronic
1118712518 14:68533924-68533946 GAGAGGGGCAAAGGCGTGTAAGG + Intronic
1122046070 14:99024937-99024959 GAGAATGTGCAATGCATGGAGGG + Intergenic
1122639145 14:103147094-103147116 GAAAGAGGCAAATGCTTGGAAGG - Intergenic
1127952502 15:63823145-63823167 GAGAGTGGAAAATGGGAGGAGGG - Intronic
1128992927 15:72275399-72275421 GAGAGATTCAAATGTTTGGAGGG - Intronic
1129051123 15:72782927-72782949 GGGCGTGTTCAATGCGTGGAAGG + Intronic
1131075995 15:89495328-89495350 GAGAATGTCTAAGGTGTGGAGGG + Intronic
1132097073 15:98994670-98994692 GACAGTGTGAAATGCAAGGAGGG - Intronic
1135618662 16:23934049-23934071 AAGAAAGTCAAATGGGTGGATGG - Intronic
1143393486 17:6574425-6574447 GAGAGAGTGCAATGGGTGGAAGG + Intergenic
1143736683 17:8916220-8916242 GAGCGTGTCAAAGGGGTGGGTGG - Intronic
1144329682 17:14212516-14212538 GAGAGTGTCACAGGCGAGGTTGG - Intergenic
1150714909 17:67563874-67563896 GAGAGAGAGAAATGGGTGGATGG + Intronic
1153203102 18:2666666-2666688 GAGTGTTTCAAATGAATGGAAGG + Intronic
1155199164 18:23502776-23502798 GAGGGTGTAAAATTAGTGGAAGG - Intergenic
1155417608 18:25616788-25616810 GAGAGAGTCAGCTGAGTGGAAGG + Intergenic
1156467365 18:37356344-37356366 GAGAGTGACAAAAGGGTGGGGGG + Intronic
1157467300 18:47958275-47958297 GAGAGTATCACATGTGTAGAAGG - Intergenic
1160951278 19:1668844-1668866 CAGAGTTTCAAATGCCTGTAAGG - Intergenic
1163505226 19:17701813-17701835 GTGAGTGTGAAATGCCTGCAAGG + Intergenic
1165498733 19:36170770-36170792 GCGAGTGTAGAATGTGTGGATGG + Intergenic
928148060 2:28799379-28799401 AAGGGTGTCAAATGGCTGGATGG - Exonic
933185200 2:79270616-79270638 GAGAGTCTCAAATGCCTGAGAGG - Intronic
935373845 2:102375406-102375428 GAGGGTGTCAAAGGTGTGGGTGG + Intronic
937298018 2:120821479-120821501 GAGACTGTCAAATCCTCGGATGG + Intronic
940701473 2:157049387-157049409 GAGAATGTTACATGCTTGGAAGG + Intergenic
940938360 2:159526043-159526065 AAGAGTGACAAATGAGGGGATGG + Intronic
945972821 2:216246867-216246889 GAGAATGTCATAGGCATGGAAGG - Intergenic
949066011 2:241990630-241990652 CAGAGTGACAGATGCATGGATGG - Intergenic
1168939449 20:1696354-1696376 GAGAGTATCTAATGCCAGGATGG + Intergenic
1170058827 20:12237985-12238007 GTCAGTGTCAAATTGGTGGAAGG + Intergenic
1174048944 20:47754071-47754093 TAGGGAGTCAAATGCGTGCAGGG + Intronic
1177034279 21:16022452-16022474 GTGAGTGTCTAATAAGTGGAAGG + Intergenic
1180880023 22:19197105-19197127 GAGAGTGTCAGAGGCGTGTGGGG - Intronic
1181830675 22:25558120-25558142 GAGAGTGTCAGATGGATTGAAGG + Intergenic
1184562272 22:45269930-45269952 GAGACTGTGAAAAGCGGGGAGGG - Intergenic
950140517 3:10612000-10612022 GAGAGTGTAAAATGCGATGCTGG - Intronic
951836247 3:26986576-26986598 GAGAGAGTCAAATGATTGCAGGG - Intergenic
955787898 3:62559144-62559166 AAGTGTGTCAAATGCAAGGAAGG - Intronic
964004665 3:151812835-151812857 AAGAGTGTGAAATGCCAGGATGG - Intergenic
977512849 4:97983403-97983425 CAGATTTTCAAATGCTTGGAGGG + Intronic
979321765 4:119332908-119332930 GAGAGTGAGAAATGTGGGGATGG - Intergenic
980586515 4:134823623-134823645 TAGAGAGCCACATGCGTGGAAGG - Intergenic
986913070 5:12581507-12581529 GAGAATGTAAAATGTGTAGATGG + Intergenic
988484107 5:31654224-31654246 GTGTGTGTCAAATGCTTTGAGGG - Intronic
990377849 5:55190608-55190630 GAGAGTAACAAATACGAGGAGGG + Intergenic
997377255 5:133406072-133406094 GATGGTGTTAAATGCGAGGAAGG + Intronic
1004764918 6:18715215-18715237 GAGAGTGTCAAATGAATGTCTGG - Intergenic
1010058490 6:71592461-71592483 GAGAGAGTCAAATTCTTGGCAGG + Intergenic
1016685280 6:146874413-146874435 CAAAGTGTCAAATGAGTGGAAGG - Intergenic
1020684525 7:11276645-11276667 GAGACTGTCAGATTTGTGGATGG + Intergenic
1021458069 7:20851262-20851284 AAGAATGACAAATGGGTGGATGG + Intergenic
1021936410 7:25636430-25636452 GAGAGAGTCACATCCATGGAGGG + Intergenic
1022691033 7:32654775-32654797 GAGTGTATAAAATGCATGGAAGG + Intergenic
1022918600 7:34988668-34988690 GAGTGTATAAAATGCATGGAAGG + Intronic
1023331259 7:39119470-39119492 GAGAGAGTCAAATGGAAGGATGG + Intronic
1026858043 7:73767980-73768002 GAGAGATTCAAATGACTGGATGG - Intergenic
1028767689 7:94578552-94578574 GAGACTGGCAAATGGGTGGGGGG - Intergenic
1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG + Intronic
1035727058 8:1831229-1831251 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727103 8:1831467-1831489 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727112 8:1831511-1831533 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727121 8:1831555-1831577 GACAGTGTGACATCCGTGGAGGG + Intronic
1045056546 8:98373062-98373084 GAGAGAGTCAGATGAGGGGAAGG + Intergenic
1045402602 8:101834188-101834210 GAGGGTGTGAAATGTGTGCAAGG + Intronic
1055893872 9:81153093-81153115 GAAAGTGTCAAGTAAGTGGATGG - Intergenic
1059585404 9:115600797-115600819 GAGAGTGTGAAATGTGGAGAAGG + Intergenic
1059664978 9:116437911-116437933 GAGAGCCTCAAATTCTTGGAGGG + Intronic
1187052706 X:15710284-15710306 GTGACTGTGAAATGAGTGGATGG + Intronic
1189546945 X:42051205-42051227 GTGGGTGTGACATGCGTGGATGG - Intergenic
1191662918 X:63669122-63669144 GAGAGCGTCAAATGAGTTCATGG + Intronic
1195464398 X:105164304-105164326 GAGAGTGACCAATGTGTTGAGGG + Intronic
1198159693 X:133995294-133995316 GAGGGTGGAAAATGCGAGGAGGG + Intergenic